Corso di Abilità Informatiche Secondo Modulo AA 2008/2009

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Corso di Abilità Informatiche Secondo Modulo AA 2008/2009"


1 Corso di Laurea di Primo Livello Scuola Universitaria Interfacoltà in Biotecnologie Università degli Studi di Torino PRIMI PASSI CON LINUX Corso di Abilità Informatiche Secondo Modulo AA 2008/2009 LABORATORIO INFORMATICO, LEZIONE 1: PREAMBOLO I sistemi operativi moderni hanno delle interfacce grafiche (graphical user interface, ovvero GUI), che permettono di effettuare la maggior parte delle operazioni (lanciare un'applicazione, copiare un file, creare una cartella, ecc.) in un modo facile e confortevole. Anche per Linux esistono diversi cosiddetti windowmanager, di cui i più diffusi sono KDE e Gnome. L'utilizzo di interfacce grafiche però, anche se più facili da usare, è spesso limitato a operazioni ben definite (ad esempio tramite icone cliccabili ) e quindi offrono in alcuni casi una scarsa flessibilità. Per questo l'utilizzo di un'interfaccia testuale, in Linux implementata mediante le shell, è indispensabile al fine di poter sfruttare le potenzialità di un sistema Linux al meglio. Un esempio pratico: sia data una cartella con migliaia di file contenenti delle sequenze proteiche dove il nome del file ha sempre il formato datasequenziamento_specie_nomeproteina che indica la specie a cui appartiene la proteina. Per scorpire quanti file (sequenze proteiche) per le singole specie si trovino in quella cartella, usando una GUI, bisognerebbe scorrere tutti i file e contare il numero di volte in cui appare il nome di una specie (perdendo molto tempo e rischiando di sbagliare i conti). Usando una shell, invece basterebbe digitare un singolo comando ls sed e "s/.*_\(.*\)_.*/\1/" sort uniq c per avere una lista di specie con i rispettivi numeri di sequenze proteiche. Imparare ad usare la flessibilità e la potenzialità offerte dalle shell e i programmi commandline di un sistema Linux, può quindi aiutare a risparmiare molto tempo, soprattutto nell'ambito della biologia computazionale.

2 ESERCIZIO 1: GUI e OpenOffice 1) Boot di Linux: il computer del laboratorio è un sistema dual boot su cui sono installati sia Windows che Linux. Dopo aver acceso il computer un boot loader vi permette di scegliere il sistema operativo da caricare. Scegliete Linux (la prima voce). 2) Navigazione con la GUI: noterete che l'interfaccia grafica offre funzionalità molto simili a quelle di Windows, ma troverete anche alcune differenze. 1. Su Linux spesso (ma non sempre) basta un singolo click per effettuare azioni che su Windows richiederebbero un doppio-click. 2. Esiste un menu principale simili al menu Start di Windows, ma le applicazioni sono raggruppate in modo diverso (in questo caso, usando il windowmanager Gnome, avete un menu principale con un icona a forma di piede). 3. La maggior parte dei GUI di Linux offre più di un desktop su cui è possibile aprire dei programmi e delle finestre diverse (in questo caso potete scegliere i desktop in basso a destra). Prendetevi qualche minuto per esplorare la GUI e il suo funzionamento. 3) Navigazione sul file system: cliccando sull'icona Home sul desktop avete a disposizione una finestra che vi permette di navigare nel file system per entrare nelle cartelle/directory, elencare i file in esse contenute, etc. Inizialmente vi trovate nella vostra cartella home (ogni utente definito sul sistema ne ha una). Create una nuova cartella di nome esercizi_lab1. Entrate nella cartella e create un nuovo file di testo con nome sequenza1.txt (anche tutti gli altri file dei seguenti esercizi dovranno essere creati esculsivamente all'interno di questa cartella, che alla fine verrà cancellata). Cliccando sul file si apre un editore di testo che vi permette di modificare il suo contenuto (inizialmente vuoto). Scrivete un breve sequenza nucleotidica (fittizia) in formato FASTA, come illustrato nel seguente esempio: >ENSG Breast cancer type 1 susceptibility protein CTTAGCGGTAGCCCCTTGGTTTCCGTGGCAACGGAAAAGCGCGGGAATTACAGATAAATT (...) 4) Copia e incolla (copy&paste): evidenziate una parte del testo appena scritto tenendo premuto il tasto sinistro del mouse, come fareste su Windows per copiarlo. Invece di premere Ctrl+C (e poi Ctrl+V) però, cliccate semplicemente il tasto centrale. Il testo prima evidenziato viene incollato dove si trova il puntatore del mouse. 5) Navigazione in rete: nel menu principale, sotto Applications -> Internet, trovate il web browser Konqueror. Apritelo e andate su per cercare un documento Word sulla proteomica usando le parole di ricerca proteomics use case doc Scaricate il file e salvatelo nella cartella creata al punto 3. 6) OpenOffice Writer: lanciate OpenOffice Writer (simile a Microsoft Word) dall'equivalente del menu Start. Usate il menu File di OpenOffice per aprire il documento sulla proteomica scaricato al punto precedente. Noterete che OpenOffice, oltre a poter aprire documenti Word, offre funzionalità equivalenti a quelle di Microsoft Word. Provate a ingrandire la scritta, ad usare il grasetto ecc. Salvate il file modificato (File -> Save As...) con un formato diverso da quello di Word (salvatelo come Rich Text Format, con estenzione.rtf, un formato standard a differenza del formato.doc dei documenti Word). Poi provate a convertire il file nel formato PDF (File -> Export as PDF). Salvate tutte le versioni diverse nella cartella creata al punto 3.

3 7) [facoltativo] OpenOffice Impress e OpenOffice Calc: lanciate OpenOffice Impress su desktop 1 e OpenOffice Calc su desktop 2. Noterete che i due applicativi sono molto simili a Microsoft PowerPoint e Microsoft Excel (e possono anche aprire i rispettivi file Microsoft). Prendetevi qualche minuto per esplorare i due applicativi. Create dei file in formato Excell e PowerPoint nella cartella creata al punto 3. Nota: OpenOffice è open source e può essere scaricato gratuitamente e legalmente da internet. Esistono anche delle versioni che funzionano su Windows e Mac (per chi non vuole pagare la licenza di Microsoft Office o violare la legge usando una copia illecita). ESERCIZIO 2: La shell 1) Avviare un terminale con una shell: aprite un nuovo terminale (Applications -> Accessories -> Terminal). Vedrete un prompt, che indica il nome dell'utente, il nome del computer e la cartella attuale (inizialmente vi trovate nella vostra home), e un cursore per la riga di comando. Digitate echo $SHELL per scoprire se state usando una Bourne shell (sh oppure bash), una C shell (csh oppure tcsh) o una Korne shell (ksh). Nota: Il $ indica che la parola che segue è una variabile ambientale e che deve essere utilizzato il valore (contenuto) della variabile (che in questo caso indica il tipo di shell) come argomento per il comando echo. Viene quindi scritto il contenuto della variabile sullo scermo, non il suo nome. Provate anche: echo $HOME 2) Comando echo: il comando echo serve per scrivere sullo schermo una riga di testo. Provate a scrivere: echo ACTGTTGAT Nota: questo comando può essere usato, per esempio, in uno script (una procedura o sequenza predefinita di comandi) per scrivere informazioni sullo schermo durante la sua esecuzione. 3) Cambiare la shell: se state usando una Bourne shell, lanciate una C shell digitando tcsh ; se invece state usando una C shell, lanciate una Bourne shell digitando bash. Noterete che cambia il formato del prompt (quello della bash finisce con $ e quella della tcsh con >, il formato preciso del prompt è comunque configurabile). Tornate alla shell iniziale digitando exit. 4) Utenti loggati e utente corrente: provate a farvi confermare dal computer che utente siete e a scoprire quali utenti sono loggati sul computer al momento (con i comandi whoami e who). Anche se i risultati non vi sorprenderanno, tenete conto che su altri sistemi è possibile che dozzine o centinaia di utenti siano loggati contemporaneamente. 5) Working directory: verificate che vi trovate nella vostra home directory, digitando: pwd La cartella in cui vi trovate al momento viene chiamata working directory (pwd sta per print working directory ). 6) Contenuto di una cartella / lista dei file (1): potete ottenere la lista dei file (e delle sottocartelle) digitando ls (dall'inglese list ). Per vedere anche file nascosti (il cui nome inizia con un punto, ad esempio.bashrc ) potete usare ls a. Provate per curiosità anche ls l senza spaventarvi. 7) Navigazione sul file system tramite shell: per cambiare la cartella potete usare il comando cd ( change directory ) in uno dei seguenti modi: 1. cd Il comando, se non seguito da un argomento, vi riporta nella cartella home

4 2. cd.. Il comando seguito da due punti, vi porta nella cartella in cui si trova la working directory (esempio: se vi trovate in /home/studente, digitando cd.. finirete in /home ). 3. cd cartelladestinazione Il comando, seguito dalla cartella specifica, vi porta in quest'ultima. La cartella di destinazione viene specificata con un a) path relativo alla cartella corrente: ad esempio cd../studente2 per andare dalla cartella /home/studente alla cartella /home/studente2 ; oppure un b) path assoluto (dalla radice del file system): ad esempio cd /usr/bin per andare in /usr/bin, indipendentemente da dove vi trovate al momento. I path assoluti, a differenza dei path relativi, iniziano con una barra ( /, in inglese chiamata slash ). La sola barra indica la radice del file system quindi, per andare a quest'ultima, basta digitare cd /. Provate i seguenti spostamenti, ognuno seguito dal comando pwd per verificare dove vi trovate. Usate il comando ls per vedere cosa contengono le cartelle. i) Per tornare nella cartella iniziale: cd ii) cd esercizi_lab1 iii) cd /usr/lib iv) cd.. v) cd../home vi) cd studente/esercizi_lab1 vii) cd../.. 8) Contenuto di una cartella / lista dei file (2): gli stessi path usati per il comando cd si possono anche usare per tanti altri comandi, ad esempio per elencare il contenuto di una cartella anche se non è la working directory. Tornate nella vostra home e da lì provate a vedere il contenuto di /usr/share, della cartella in cui sta la vostra home, e della cartella esercizi_lab1. Verificate ogni volta che continuate a trovarvi nella vostra home, anche se avete elencato i file contenuti in cartelle diverse da essa. 9) Lanciare un applicazione dalla shell: provate (dalla shell, non dalla GUI) ad aprire il file di testo (sequenza1.txt) che avete creato prima, usando l'applicazione gedit. Si può continuare ad usare la shell quando l'applicazione è in esecuzione? E dopo aver chiuso l'applicazione? Provate a lanciarla di nuovo aggiungendo un & alla fine del comando. La situazione cambia? Nota: per lanciare un'applicazione dalla shell si digita il suo nome (il nome del file eseguibile). Eventualmente può essere necessario aggiungere il percorso (path assoluto o relativo) che indica in che cartella del file system si trova l'eseguibile. A molte applicazioni si possono passare degli argomenti sulla riga di comando. Esempi: gedit file.txt xeyes /bin/echo "riga da scrivere sullo schermo" /usr/bin/who Di solito, la shell esegue un comando solo dopo aver terminato quello precedente. Visto che eseguire un'applicazione equivale a eseguire un comando, la shell può eseguire un un nuovo comando solo dopo che l'applicazione sia stata terminata o chiusa. Aggiungendo un & alla fine del comando che lancia l'applicazione, quest'ultima viene eseguita in background e la shell torna ad accettare altri comandi dall'utente.

5 10) Creazione di una cartella: andate nella cartella esercizi_lab1 e create una sottocartella di nome nuova_cartella usando il comando mkdir. Verificate (dalla shell) che la cartella sia effetivamente stata creata. 11) Creazione di una copia di un file: usando il comando cp (per copy ), create due copie del file PDF, una nella cartella esercizi_lab1 stessa e una in nuova_cartella. Verificate che le copie siano state create. 12) Cancellazione di un file: cancellate la prima copia del file PDF (creata nella cartella esercizi_lab1), lasciando però la seconda copia. Verificate che il file sia effettivamente stato cancellato. 13) Cancellazione di una directory: cancellate la cartella nuova_cartella. Verificate che la cartella sia effettivamente stata cancellata. 14) Importante: per concludere gli esercizi eliminate la cartella esercizi_lab1 e tutto il suo contenuto (tutti i file creati negli esercizi precedenti). Se volete potete prima salvare i file su una chiavetta USB. 15) Logout e spegnimento: Fate il logout dalla GUI (dal menu principale: Desktop -> Log Out). Essendo tornati al menu di login, arrestate (Actions -> Shut Down) il computer. È anche possibile effettuare lo spegnimento direttamente dal desktop senza fare il logout (Desktop -> Shut Down). In ogni caso, come un sistema Windows, un sistema Linux non dovrebbe mai essere spento premendo semplicemente l'interruttore. Se siete interessati a provare Linux a casa senza interferire con Windows, possiamo fornirvi una versione live su CD che non ha bisogno di essere installata sul hard disk (basta accendere il PC con il CD nel lettore). Mandate una mail entro il 3 novembre a:

Breve guida a Linux Mint

Breve guida a Linux Mint Breve guida a Linux Mint Il Desktop. Il "desktop" (scrivania) è la parte del sistema operativo che è responsabile per gli elementi che appaiono sul desktop: il Pannello, lo sfondo, il Centro di Controllo,


CdL in Medicina Veterinaria - STPA AA 2007-08

CdL in Medicina Veterinaria - STPA AA 2007-08 CdL in Medicina Veterinaria - STPA AA 2007-08 Microsoft Windows Funzionalità di un S.O. Gestione dei file Gestione dei dispositivi di ingresso/uscita Comandi per l attivazione e la gestione di programmi


Parte V. Sistemi Operativi & Reti. Sistemi Operativi. Sistemi Operativi

Parte V. Sistemi Operativi & Reti. Sistemi Operativi. Sistemi Operativi Parte V & Reti Sistema operativo: insieme di programmi che gestiscono l hardware Hardware: CPU Memoria RAM Memoria di massa (Hard Disk) Dispositivi di I/O Il sistema operativo rende disponibile anche il


Uso del Computer e Gestione dei File. Uso del Computer e Gestione dei File. Federica Ricca

Uso del Computer e Gestione dei File. Uso del Computer e Gestione dei File. Federica Ricca Uso del Computer e Gestione dei File Uso del Computer e Gestione dei File Federica Ricca Il Software Sistema Operativo Programmi: Utilità di sistema Programmi compressione dati Antivirus Grafica Text Editor


PC Crash Course: OBIETTIVI

PC Crash Course: OBIETTIVI PC Crash Course: OBIETTIVI 1. PC: uno strumento 2. Microsoft Windows XP: alcuni concetti chiave della interfaccia grafica 3. File System: file, direttori, link, 4. Il prompt dei comandi 5. Un occhiata



5-1 FILE: CREAZIONE NUOVO DOCUMENTO Capittol lo 5 File 5-1 FILE: CREAZIONE NUOVO DOCUMENTO In Word è possibile creare documenti completamente nuovi oppure risparmiare tempo utilizzando autocomposizioni o modelli, che consentono di creare


3. Gestione di un sistema operativo a interfaccia grafica (elementi di base) 3.1 Software

3. Gestione di un sistema operativo a interfaccia grafica (elementi di base) 3.1 Software Pagina 29 di 47 3. Gestione di un sistema operativo a interfaccia grafica (elementi di base) 3.1 Software Come abbiamo già detto in precedenza, l informatica si divide in due grandi mondi : l hardware



Appunti Modulo 2 - Microsoft Windows

Appunti Modulo 2 - Microsoft Windows Appunti Modulo 2 - Microsoft Windows Sistema operativo Il sistema operativo, abbreviato in SO (in inglese OS, "operating system") è un particolare software, installato su un sistema


Esercitazione 1 primi passi e uso dei file

Esercitazione 1 primi passi e uso dei file primi passi e uso dei file 1 Sistemi operativi per PC I sistemi operativi per personal computer più diffusi sono: Windows (Microsoft) Linux (freeware) MacOS (Apple) Il laboratorio verterà su Windows 2


Quaderni per l'uso di computer

Quaderni per l'uso di computer Quaderni per l'uso di computer con sistemi operativi Linux Ubuntu 2 DESKTOP, FINESTRE, CARTELLE E FILE a cura di Marco Marchetta Aprile 2013 1 DESKTOP E FINESTRE LA CARTELLA HOME : Dispositivi, Computer


Corso base di informatica

Corso base di informatica Corso base di informatica AVVIARE IL COMPUTER Per accendere il computer devi premere il pulsante di accensione posto di norma nella parte frontale del personal computer. Vedrai apparire sul monitor delle


Università degli Studi di Verona. Linux Ubuntue ilcompilatorec. Dicembre 2014 - Sergio Marin Vargas. Dipartimento di Biotecnologie

Università degli Studi di Verona. Linux Ubuntue ilcompilatorec. Dicembre 2014 - Sergio Marin Vargas. Dipartimento di Biotecnologie Università degli Studi di Verona Dipartimento di Biotecnologie Laurea in Biotecnologie Corso di Informatica2014/2015 Linux Ubuntue ilcompilatorec Dicembre 2014 - Sergio Marin Vargas Caratteristiche di


Reti Informatiche: Internet e posta. elettronica. Tina Fasulo. Guida a Internet Explorer e alla posta elettronica Windows Live Mail

Reti Informatiche: Internet e posta. elettronica. Tina Fasulo. Guida a Internet Explorer e alla posta elettronica Windows Live Mail Reti Informatiche: Internet e posta elettronica Tina Fasulo 2012 Guida a Internet Explorer e alla posta elettronica Windows Live Mail 1 Parte prima: navigazione del Web Il browser è un programma che consente


Informatica di base. Lucio Bianchi. 2 aprile 2011. Lezione 3

Informatica di base. Lucio Bianchi. 2 aprile 2011. Lezione 3 Informatica di base Lezione 3 Lucio Bianchi 2 aprile 2011 1 Sommario Indice 1 Primi passi con Ubuntu 1 1.1 Il LiveCD............................... 1 1.2 Esplorare il desktop......................... 3


Sistemi operativi: interfacce

Sistemi operativi: interfacce Sistemi operativi: interfacce I sistemi operativi offrono le risorse della macchina a soggetti diversi: alle applicazioni, tramite chiamate di procedure da inserire nel codice all utente, tramite interfaccia


Windows. Cos è I componenti principali Le funzioni essenziali. 1

Windows. Cos è I componenti principali Le funzioni essenziali. 1 Windows Cos è I componenti principali Le funzioni essenziali 1 Cos è Windows è un sistema operativo, ovvero un insieme di software che consente di eseguire le operazioni basilari


Introduzione a Microsoft Word 2007

Introduzione a Microsoft Word 2007 Introduzione a Microsoft Word 2007 Autore: Alessandra Salvaggio Tratto dal libro: Lavorare con Word 2007 Non ostante che Microsoft Office 2007 sia uscito da un po di tempo, molte persone ancora non sono


Figura 1-1: Un personal computer composto da video, tastiera, mouse e case.

Figura 1-1: Un personal computer composto da video, tastiera, mouse e case. Figura 1-1: Un personal computer composto da video, tastiera, mouse e case. (a) (b) Figura 2-1: Due interfacce d'identificazione dell'utente dette anche maschere d'accesso. A sinistra quella utilizzata


1 -Introduzione MODULO L1

1 -Introduzione MODULO L1 (A) CONOSCENZA TERMINOLOGICA Dare una breve descrizione dei termini introdotti: Login Logout Desktop Account Sessione di lavoro Processo Applicazione Multitasking WYSIWYG File (B) CONOSCENZA E COMPETENZA






(A) CONOSCENZA TERMINOLOGICA (B) CONOSCENZA E COMPETENZA (A) CONOSCENZA TERMINOLOGICA Dare una breve descrizione dei termini introdotti: Condivisione locale Condivisione di rete Condivisione web Pulitura disco Riquadro delle attività (B) CONOSCENZA E COMPETENZA


Il mio primo giorno in Laboratorio di Calcolo...

Il mio primo giorno in Laboratorio di Calcolo... Il mio primo giorno in Laboratorio di Calcolo... Disclaimer: alcune delle istruzioni che seguono potrebbero ledere la dignità di qualche lettore. Tuttavia l'esperienza acquisita negli anni passati ci ha



Programma MANUTENZIONE Programma MANUTENZIONE MANUALE UTENTE @caloisoft Programma MANUTENZIONE 1 IL PROGRAMMA MANUTENZIONE Il programma dispone di una procedura automatica di installazione. INSTALLAZIONE Per installare il programma


Uso del computer e gestione dei file

Uso del computer e gestione dei file Uso del computer e gestione dei file Parte 1 Desktop All avvio del computer compare il Desktop. Sul Desktop sono presenti le Icone. Ciascuna icona identifica un oggetto differente che può essere un file,


Laboratorio informatico di base

Laboratorio informatico di base Laboratorio informatico di base A.A. 2013/2014 Dipartimento di Scienze Aziendali e Giuridiche (DISCAG) Università della Calabria Dott. Pierluigi Muoio ( Sito Web del corso:


Word per iniziare: aprire il programma

Word per iniziare: aprire il programma Word Lezione 1 Word per iniziare: aprire il programma Per creare un nuovo documento oppure per lavorare su uno già esistente occorre avviare il programma di gestione testi. In ambiente Windows, esistono


Il Personal Computer. Uso del Computer e gestione dei File ECDL Modulo 2

Il Personal Computer. Uso del Computer e gestione dei File ECDL Modulo 2 Il Personal Computer Uso del Computer e gestione dei File ECDL Modulo 2 1 accendere il Computer Per accendere il Computer effettuare le seguenti operazioni: accertarsi che le prese di corrente siano tutte


Scuola in ospedale e istruzione domiciliare Percorso formativo per Dirigenti Scolastici e Docenti

Scuola in ospedale e istruzione domiciliare Percorso formativo per Dirigenti Scolastici e Docenti Per accedere a Mindomo, digitare nella barra degli indirizzi: Quindi cliccare su Registrati n alto a destra Apparirà la finestra di registrazione a Mindomo: Inserire, Nome, Cognome e indirizzo


SMARTBOARD. Cosa si può fare con una smartboard?

SMARTBOARD. Cosa si può fare con una smartboard? SMARTBOARD Cosa si può fare con una smartboard? si può scrivere come si farebbe su una lavagna, con il vantaggio di poter poi salvare quanto scritto; si può andare ad interagire con una presentazione PowerPoint


Creazione e gestione file e cartelle. Le finestre e l organizzazione dati

Creazione e gestione file e cartelle. Le finestre e l organizzazione dati Creazione e gestione file e cartelle Le finestre e l organizzazione dati 34 Organizzare i file sul desktop Le icone, i file e le cartelle che abbiamo sul desktop (desktop è la schermata iniziale del PC,


Operazioni da eseguire su tutti i computer

Operazioni da eseguire su tutti i computer Preparazione Computer per l utilizzo in Server Farm SEAC Reperibilità Software necessario per la configurazione del computer... 2 Verifica prerequisiti... 3 Rimozione vecchie versioni software...4 Operazioni


Word Libre Office. Barra degli strumenti standard Area di testo Barra di formattazione

Word Libre Office. Barra degli strumenti standard Area di testo Barra di formattazione SK 1 Word Libre Office Se sul video non compare la barra degli strumenti di formattazione o la barra standard Aprite il menu Visualizza Barre degli strumenti e selezionate le barre che volete visualizzare


ECDL Modulo 2. Contenuto del modulo. Uso del computer e gestione dei file

ECDL Modulo 2. Contenuto del modulo. Uso del computer e gestione dei file ECDL Modulo 2 Uso del computer e gestione dei file Contenuto del modulo Per iniziare Il desktop Organizzare i file Semplice editing Gestione della stampa Esercitazioni 1 Per iniziare (1) Per iniziare a


IL DESKTOP Lezione 2

IL DESKTOP Lezione 2 Università degli studi di Brescia Facoltà di Medicina e Chirurgia Corso di Laurea in Infermieristica a.a. 2006/2007 Docente Ing. Andrea Ghedi IL DESKTOP Lezione 2 1 Il Desktop Tipi di icone Cartelle. Una


Università degli studi di Brescia Facoltà di Medicina e Chirurgia Corso di Laurea in Infermieristica. Corso propedeutico di Matematica e Informatica

Università degli studi di Brescia Facoltà di Medicina e Chirurgia Corso di Laurea in Infermieristica. Corso propedeutico di Matematica e Informatica Università degli studi di Brescia Facoltà di Medicina e Chirurgia Corso di Laurea in Infermieristica a.a. 2008/2009 Docente Ing. Andrea Ghedi IL DESKTOP Lezione 2 Il Desktop Tipi di icone Cartelle. Una


1) Come si crea una cartella? Menù File/Nuovo/Cartella Menù File/ Nuova cartella Menù Visualizza/Cartella

1) Come si crea una cartella? Menù File/Nuovo/Cartella Menù File/ Nuova cartella Menù Visualizza/Cartella Esercizi Domande Riassuntive Prima degli esercizi veri e propri, sono proposte una serie di domande riassuntive. Alla fine delle domande ci sono le soluzioni. 1) Come si crea una cartella? Menù File/Nuovo/Cartella



LEZIONE 20. Sommario LEZIONE 20 CORSO DI COMPUTER PER SOCI CURIOSI 1 LEZIONE 20 Sommario VENTESIMA LEZIONE... 2 FILE SYSTEM... 2 Utilizzare file e cartelle... 3 Utilizzare le raccolte per accedere ai file e alle cartelle... 3 Informazioni sugli elementi di una finestra...



Talento LAB 4.1 - UTILIZZARE FTP (FILE TRANSFER PROTOCOL) L'UTILIZZO DI ALTRI SERVIZI INTERNET. In questa lezione imparerete a: Lab 4.1 Utilizzare FTP (File Tranfer Protocol) LAB 4.1 - UTILIZZARE FTP (FILE TRANSFER PROTOCOL) In questa lezione imparerete a: Utilizzare altri servizi Internet, Collegarsi al servizio Telnet, Accedere


DeskTop o Scrivania virtuale

DeskTop o Scrivania virtuale ARGOMENTI DELLA 2 LEZIONE Introduzione ai sistemi operativi. Introduzione a Windows 95/ 98/XP Accendere e spegnere un PC (Ctrl Alt Canc) Il desktop Le icone (di sistema, collegamenti, il cestino) - proprietà


Versione 2014. Installazione GSL. Copyright 2014 All Rights Reserved

Versione 2014. Installazione GSL. Copyright 2014 All Rights Reserved Versione 2014 Installazione GSL Copyright 2014 All Rights Reserved Indice Indice... 2 Installazione del programma... 3 Licenza d'uso del software... 3 Requisiti minimi postazione lavoro... 3 Requisiti


lanciare il collegamento e alla finestra di log scrivere admin con eventuale password. Vedi sotto

lanciare il collegamento e alla finestra di log scrivere admin con eventuale password. Vedi sotto SOMMARIO 1. Preparazione del collegamento a IdmNext.exe pag. 2 2. Loggarsi nel pannello come Admin pag. 3 3. La gestione accounts Insegnanti pag. 4 4. La creazione di una chiave Usb pag. 5 5. Gli Strumenti


Lab 01 Sistemi Operativi

Lab 01 Sistemi Operativi Informatica Grafica Ingegneria Edile-Architettura a.a. 2010/2011 Lab 01 Sistemi Operativi Lab01 1 Obiettivi Durante l'esercitazione vedremo come il sistema operativo si occupa di gestire: 1. i processi



SCRIVERE TESTO BLOCCO NOTE WORDPAD WORD IL PIU' DIFFUSO APRIRE WORD SCRIVERE TESTO Per scrivere del semplice testo con il computer, si può tranquillamente usare i programmi che vengono installati insieme al sistema operativo. Su Windows troviamo BLOCCO NOTE e WORDPAD.





Olga Scotti. Basi di Informatica. File e cartelle

Olga Scotti. Basi di Informatica. File e cartelle Basi di Informatica File e cartelle I file Tutte le informazioni contenute nel disco fisso (memoria permanente del computer che non si perde neanche quando togliamo la corrente) del computer sono raccolte


POSTA ELETTRONICA Per ricevere ed inviare posta occorrono:

POSTA ELETTRONICA Per ricevere ed inviare posta occorrono: Outlook parte 1 POSTA ELETTRONICA La posta elettronica è un innovazione utilissima offerta da Internet. E possibile infatti al costo di una telefonata urbana (cioè del collegamento telefonico al nostro


Manuale d uso [Rev.1 del 07/08/2015] Manutenzione impianti termici Ver. 1.0.6 [05/01/2015]

Manuale d uso [Rev.1 del 07/08/2015] Manutenzione impianti termici Ver. 1.0.6 [05/01/2015] Manuale d uso [Rev.1 del 07/08/2015] Manutenzione impianti termici Ver. 1.0.6 [05/01/2015] Realizzato e distribuito da LeggeraSoft Sommario Introduzione... 2 Installare il programma... 2 Tasto licenza...


INTERNET EXPLORER. Breve manuale d'uso



Elenco installazioni componenti fondamentali per LINUX-Ubuntu

Elenco installazioni componenti fondamentali per LINUX-Ubuntu Elenco installazioni componenti fondamentali per LINUX-Ubuntu Installazione componente per l'importazione dei documenti PDF in LibreOffice sudo apt-get install libreoffice-pdfimport Installazione dei caratteri



VIDEO CONFERENZE NETMEETING VIDEO CONFERENZE Come prima cosa dobbiamo distinguere che esistono due grande categorie di "canali comunicativi: Non Real Time: che operano in modalità asincrona come la posta elettronica, il web, i newsgroup


Archivio Parrocchiale



Avvio di Internet ed esplorazione di pagine Web.

Avvio di Internet ed esplorazione di pagine Web. Incontro 1: Corso di aggiornamento sull uso di internet Avvio di Internet ed esplorazione di pagine Web. Istituto Alberghiero De Filippi Via Brambilla 15, 21100 Varese Tel: 0332-286367



STRUMENTI PER L ACCESSIBILITÀ DEL COMPUTER. STRUMENTI PER L ACCESSIBILITÀ DEL COMPUTER. Breve introduzione a Windows 8. Windows 8 presenta una nuova veste grafica e alcune caratteristiche che lo distinguono nettamente dalle precedenti versioni:


Spiegazione di alcune funzioni di Dropbox

Spiegazione di alcune funzioni di Dropbox Spiegazione di alcune funzioni di Dropbox Caricamento da fotocamera Dopo aver installato Dropbox collegando al computer una fotocamera o una chiavetta di memoria USB parte in automatico la richiesta di

Dettagli Identificare le diverse parti di una finestra: barra del titolo, barra dei menu, barra degli strumenti, barra di stato, barra di scorrimento. Identificare le diverse parti di una finestra: barra del titolo, barra dei menu, barra degli strumenti, barra di stato, barra di scorrimento. Uso del computer e gestione dei file 57 Identificare le diverse parti di una finestra: barra del titolo, barra dei menu, barra degli strumenti, barra di stato, barra di scorrimento. All interno


Office 2007 Lezione 02. Le operazioni più

Office 2007 Lezione 02. Le operazioni più Le operazioni più comuni Le operazioni più comuni Personalizzare l interfaccia Creare un nuovo file Ieri ci siamo occupati di descrivere l interfaccia del nuovo Office, ma non abbiamo ancora spiegato come



GESTIONE DI FINESTRE, FILE E CARTELLE con Windows XP GESTIONE DI FINESTRE, FILE E CARTELLE con Windows XP Desktop (scrivania) Il Desktop è la prima schermata che appare all accensione del computer. icone Barra delle applicazioni Le piccole immagini che appaiono


Accedere alle banche dati da casa Il server PROXY di UniTO

Accedere alle banche dati da casa Il server PROXY di UniTO Accedere alle banche dati da casa Il server PROXY di UniTO 1 IL PROXY DI ATENEO Gran parte delle delle banche dati disponibili sono consultabili anche da casa. Per poter garantire il corretto riconoscimento


Il Programma... 3 I moduli... 3 Installazione... 3 La finestra di Login... 4 La suite dei programmi... 6 Pannello voci... 10

Il Programma... 3 I moduli... 3 Installazione... 3 La finestra di Login... 4 La suite dei programmi... 6 Pannello voci... 10 MANCA COPERTINA INDICE Il Programma... 3 I moduli... 3 Installazione... 3 La finestra di Login... 4 La suite dei programmi... 6 Pannello voci... 10 epico! è distribuito nelle seguenti versioni: epico!


Blocco Note Blocco Note

Blocco Note Blocco Note Blocco Note Blocco Note Che cos è? È un programma che appartiene alla famiglia dei text editor. A che cosa serve? A generare file di testo, ossia a scrivere testi Nota: nella versione inglese il programma


30 giorni di prova gratuiti, entra nel sito scarica e installa subito mypckey

30 giorni di prova gratuiti, entra nel sito scarica e installa subito mypckey DA OGGI NON IMPORTA DOVE SEI, IL TUO PC DELL UFFICIO E SEMPRE A TUA DISPOSIZIONE! Installa solo un semplice programma (nessun hardware necessario!), genera la tua chiavetta USB, e sei pronto a prendere


Il software del PC. Il BIOS

Il software del PC. Il BIOS Il software del PC La parola software è un neologismo che è stato coniato in contrapposizione all hardware (ferraglia). L hardware si può prendere a calci, contro il software si può solo imprecare. Il


Note sull ambiente di lavoro utilizzato ai Laboratori di Fondamenti di Informatica I

Note sull ambiente di lavoro utilizzato ai Laboratori di Fondamenti di Informatica I Università di Pisa Corso di Laurea in Ingegneria Informatica Note sull ambiente di lavoro utilizzato ai Laboratori di Fondamenti di Informatica I a cura di Marco Cococcioni a.a. 2013-2014 Un po di terminologia


Olga Scotti. Basi di Informatica. Il sistema operativo Windows

Olga Scotti. Basi di Informatica. Il sistema operativo Windows Basi di Informatica Il sistema operativo Windows Perchè Windows? MS-DOS: Interfaccia di solo testo Indispensabile conoscere i comandi Linux & Co. : Meno diffuso soprattutto nelle aziende Bella interfaccia


Anno 2009/2010 Syllabus 5.0

Anno 2009/2010 Syllabus 5.0 Patente Europea di Informatica ECDL Modulo 2 Lezione 3: Pannello di controllo Caratteristiche del sistema Gestione delle stampe Utilità Anno 2009/2010 Syllabus 5.0 Il Pannello di Controllo permette di



'LVSHQVD :LQGRZV GL0&ULVWLQD&LSULDQL 'LVSHQVD 'L :LQGRZV GL0&ULVWLQD&LSULDQL ',63(16$',:,1'2:6,QWURGX]LRQH Windows 95/98 è un sistema operativo con interfaccia grafica GUI (Graphics User Interface), a 32 bit, multitasking preempitive. Sistema



Windows. Windows Il Sistema Operativo Il Sistema Operativo è il software che permette l interazione tra uomo e macchina (hardware) 2.l esecuzione componenti computer coordinazione hardware(e


Microsoft Word 2007. La BARRA DI ACCESSO RAPIDO, che contiene alcuni comandi sempre visibili e può essere personalizzata.

Microsoft Word 2007. La BARRA DI ACCESSO RAPIDO, che contiene alcuni comandi sempre visibili e può essere personalizzata. Microsoft Word 2007 Microsoft Office Word è il programma di elaborazione testi di Microsoft all interno del pacchetto Office. Oggi Word ha un enorme diffusione, tanto da diventare l editor di testi più


INTERNET EXPLORER Breve manuale d uso



A destra è delimitata dalla barra di scorrimento verticale, mentre in basso troviamo una riga complessa.

A destra è delimitata dalla barra di scorrimento verticale, mentre in basso troviamo una riga complessa. La finestra di Excel è molto complessa e al primo posto avvio potrebbe disorientare l utente. Analizziamone i componenti dall alto verso il basso. La prima barra è la barra del titolo, dove troviamo indicato


Aggiornamento programma da INTERNET

Aggiornamento programma da INTERNET Aggiornamento programma da INTERNET In questo documento sono riportate, nell ordine, tutte le operazioni da seguire per il corretto aggiornamento del ns. programma Metodo. Nel caso si debba aggiornare


Modificare impostazioni e scambiare documenti

Modificare impostazioni e scambiare documenti 18 Modificare impostazioni e scambiare documenti PowerPoint ci viene in aiuto per risolvere delle situazioni che a prima vista possono apparire ingarbugliate. In particolare il programma presenta diverse


MODULO 02. Iniziamo a usare il computer

MODULO 02. Iniziamo a usare il computer MODULO 02 Iniziamo a usare il computer MODULO 02 Unità didattica 06 Usiamo Windows: Impariamo a operare sui file In questa lezione impareremo: quali sono le modalità di visualizzazione di Windows come


Esercitazione n. 10: HTML e primo sito web

Esercitazione n. 10: HTML e primo sito web + Strumenti digitali per la comunicazione A.A 0/4 Esercitazione n. 0: HTML e primo sito web Scopo: Creare un semplice sito web con Kompozer. Il sito web è composto da una home page, e da altre due pagine



ATOLLO BACKUP GUIDA INSTALLAZIONE E CONFIGURAZIONE ATOLLO BACKUP GUIDA INSTALLAZIONE E CONFIGURAZIONE PREMESSA La presente guida è da considerarsi come aiuto per l utente per l installazione e configurazione di Atollo Backup. La guida non vuole approfondire


Il Desktop. Gli elementi del Desktop. Icona Risorse del computer. Icona Cestino. Icona Risorse di rete. Lezione 3 piccolo manuale di Windows

Il Desktop. Gli elementi del Desktop. Icona Risorse del computer. Icona Cestino. Icona Risorse di rete. Lezione 3 piccolo manuale di Windows Ing. Irina Trubitsyna Ing. Ester Zumpano Università degli Studi della Calabria Anno Accademico 2003-2004 2004 Lezione 3 piccolo manuale di Windows Il Desktop Il desktop è ciò che viene visualizzato sullo


Guida installazione Winasped 4 Data ultima revisione della guida: 12-05-2014

Guida installazione Winasped 4 Data ultima revisione della guida: 12-05-2014 Guida installazione Winasped 4 Data ultima revisione della guida: 12-05-2014 Winasped è un'applicazione di tipo client - server pertando è composta da due parti: un programma client e uno server. Di seguito


Uso del Computer. Per iniziare. Avvia il computer Premi il tasto di accensione: Windows si avvia automaticamente

Uso del Computer. Per iniziare. Avvia il computer Premi il tasto di accensione: Windows si avvia automaticamente Per iniziare Uso del Computer Avvia il computer Premi il tasto di accensione: Windows si avvia automaticamente Cliccando su START esce un menù a tendina in cui sono elencati i programmi e le varie opzioni


Uso del computer e gestione dei file

Uso del computer e gestione dei file Uso del computer e gestione dei file Sommario Uso del computer e gestione dei file... 3 Sistema Operativo Windows... 3 Avvio di Windows... 3 Desktop... 3 Il mouse... 4 Spostare le icone... 4 Barra delle





Avviare il computer e collegarsi in modo sicuro utilizzando un nome utente e una password.

Avviare il computer e collegarsi in modo sicuro utilizzando un nome utente e una password. Uso del computer e gestione dei file Primi passi col computer Avviare il computer e collegarsi in modo sicuro utilizzando un nome utente e una password. Spegnere il computer impiegando la procedura corretta.


Word Elaborazione testi

Word Elaborazione testi I seguenti appunti sono tratti da : Consiglio Nazionale delle ricerche ECDL Test Center modulo 3 Syllabus 5.0 Roberto Albiero Dispense di MS Word 2003 a cura di Paolo PAVAN - Word Elaborazione



INTRODUZIONE A WINDOWS INTRODUZIONE A WINDOWS Introduzione a Windows Il Desktop Desktop, icone e finestre Il desktop è una scrivania virtuale in cui si trovano: Icone: piccole immagini su cui cliccare per eseguire comandi o



SCARICO DATI ONETOUCH Verio per EuroTouch Home GUIDA ALL USO SCARICO DATI ONETOUCH Verio per EuroTouch Home GUIDA ALL USO Sommario Installazione dell applicazione... 3 L applicazione... 4 Requisiti... 4 Avvio dell applicazione... 4 Connessione al Database di EuroTouch



AGGIORNAMENTO SOFTWARE LS7 VERSIONE 5.13 AGGIORNAMENTO SOFTWARE LS7 VERSIONE 5.13 Requisiti: E possibile installare la versione 5.13 sulla propria ls7 solo nel caso in cui la versione installata sulla stessa sia 3.00, 3.01, 3.02, 3.07, 3.08,


Gestione File e Cartelle

Gestione File e Cartelle Gestione File e Cartelle Gestione File e Cartelle 1 Formattare il floppy disk Attualmente, tutti i floppy in commercio sono già formattati, ma può capitare di dover eseguire questa operazione sia su un


Come accedere alle pubblicazioni da remoto con Windows

Come accedere alle pubblicazioni da remoto con Windows Come accedere alle pubblicazioni da remoto con Windows 1. Introduzione Molti utenti lamentano la difficoltà di accedere alle riviste scientifiche quando non si trovano in Dipartimento di Fisica, il problema


Guida TrueCrypt. Marino dott. Domenico Leone Angela. Divisione Sicurezza Dati

Guida TrueCrypt. Marino dott. Domenico Leone Angela. Divisione Sicurezza Dati Guida TrueCrypt Marino dott. Domenico Leone Angela Versione 6.1a Questa guida è rilasciata con la licenza Creative Commons Attribution-NonCommercial-NoDerivs 2.5, consultabile all indirizzo


Sistemi operativi e Microsoft Windows

Sistemi operativi e Microsoft Windows Sistemi operativi e Microsoft Windows Sistemi operativi e Microsoft Windows...1 Definizioni di carattere generale...2 Interfaccia...2 Interfaccia Utente...2 Sistema operativo...2 CPU (Central Processing


Capitolo I Esercitazione n. 1: Uso del computer e gestione dei file

Capitolo I Esercitazione n. 1: Uso del computer e gestione dei file Capitolo I Esercitazione n. 1: Uso del computer e gestione dei file Scopo: Windows, creare cartelle, creare e modificare file di testo, usare il cestino, spostare e copiare file, creare collegamenti. A


Manuale d uso [Rev.1 del 07/08/2015] Manutenzione caldaie Lite Ver. 1.0.6 [05/01/2015]

Manuale d uso [Rev.1 del 07/08/2015] Manutenzione caldaie Lite Ver. 1.0.6 [05/01/2015] Manuale d uso [Rev.1 del 07/08/2015] Manutenzione caldaie Lite Ver. 1.0.6 [05/01/2015] Realizzato e distribuito da LeggeraSoft Sommario Introduzione... 2 Installare il programma... 2 Tasto licenza... 3


Convertitore PDF (WSO2PDF) Manuale Sistemista

Convertitore PDF (WSO2PDF) Manuale Sistemista Convertitore PDF (WSO2PDF) Manuale Sistemista Pagina 1 di 12 SOMMARIO 1 Introduzione 3 2 Moduli dell applicazione 3 3 Installazione 4 3.1 Installazione da Setup Manager 4 3.2 Installazione da pacchetto


Manuale d uso software Gestione Documenti

Manuale d uso software Gestione Documenti Manuale d uso software Gestione Documenti 1 Installazione del Programma Il programma Gestione Documenti può essere scaricato dal sito oppure può essere richiesto l invio del


Microsoft PowerPoint 2003. Tutorial

Microsoft PowerPoint 2003. Tutorial Facoltà di Lettere e Filosofia Cdl in Scienze dell Educazione A.A. 2010/2011 Informatica (Laboratorio) Microsoft PowerPoint 2003 Tutorial Author Kristian Reale Rev. 2011 by Kristian Reale Liberamente distribuibile


Modulo 2 - ECDL. Uso del computer e gestione dei file. Fortino Luigi

Modulo 2 - ECDL. Uso del computer e gestione dei file. Fortino Luigi 1 Modulo 2 - ECDL Uso del computer e gestione dei file 2 Chiudere la sessione di lavoro 1.Fare Clic sul pulsante START 2.Cliccare sul comando SPEGNI COMPUTER 3.Selezionare una delle opzioni STANDBY: Serve


Il salvataggio sui pc locali è consentito solo per il tempo strettamente necessario al loro utilizzo.

Il salvataggio sui pc locali è consentito solo per il tempo strettamente necessario al loro utilizzo. Istruzioni per l accesso Server del Gruppo di Biofisica È stato messo in funzione il server per i file degli utenti del gruppo di Biofisica. Esso sarà utilizzato per memorizzare i file degli utenti del


Modulo 3 - Elaborazione Testi 3.1 Utilizzo applicazione

Modulo 3 - Elaborazione Testi 3.1 Utilizzo applicazione Università degli Studi dell Aquila Corso ECDL programma START Modulo 3 - Elaborazione Testi 3.1 Utilizzo applicazione Maria Maddalena Fornari Aprire il programma Per creare un nuovo documento oppure per



NOTE PER UTILIZZO COMPILATORE FORTRAN CON LINUX NOTE PER UTILIZZO COMPILATORE FORTRAN CON LINUX Queste pagine sono estratte dalle note del corso "Abilità Informatiche: Introduzione a Unix", Alessandra Seghini Per stampare questo documento si consiglia
