ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma."

Transcript

1 ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97% del gene codificante Almeno un terzo del genoma umano viene trascritto L evoluzione successiva dello spliceosoma ha facilitato la diffusione degli introni negli eucarioti più complessi. Nei procarioti si ha una piccolissima parte di ncdna perché i processi di trascrizione e traduzione sono quasi simultanei ncdna nei procarioti è meno dell 1%

2 Molte sequenze di RNA vengono trascritte e non tradotte in proteine. Gli RNA intronici (ed esonici) possono interagire selettivamente con molecole di DNA ed RNA con funzione di controllo dell espressione genica RNAi sirna

3 Intronic sequences represent a large fraction of most eukaryotic genomes, and they are known to play a critical role in genome evolution. Based on the conserved location of introns, conserved sequence within introns, and direct experimental evidence, it is becoming increasingly clear that introns perform important functions such as modulating gene expression. A large fraction of introns present within the human genome likely originated early in evolution, at least 600 million years ago There are functional constraints on the placement of introns in eukaryotic genes.

4 J.C. Sullivan A.M. Reitzel J.R. Finnerty A High Percentage of Introns in Human Genes Were Present Early in Animal Evolution: Evidence from the Basal Metazoan Nematostella vectensis Genome Informatics 17(1): (2006) 219

5 L espressione genica è regolata a vari livelli

6 La trascrizione è mediata dall enzima RNA-polimerasi RNA polimerasi promotore: sequenza di DNA che segnala il punto di inizio della trascrizione apertura doppia elica ( 1 giro di doppia elica 3 5 segnale di terminazione per l RNA polimerasi iniziazione catena RNA allontanamento della catena RNA per mezzo della ricostituzione di doppia elica 5 3 allungamento catena RNA nella direzione terminazione e rilascio dell RNA e della polimerasi v 30 nucleotidi/sec 5000 in 3 min

7

8

9 Procarioti Segnale di inizio La polimerasi riconosce 2 sequenze di circa 6 basi distanziate da 25 basi promotore promotore TAGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGTCCACG-3 3 -ATCACATAACTGTACTATCTTCGTGAGATGATATAAGAGTTATCCAGGTGC-5 partenza trascrizione RNA 5 3 AGGUCCACG

10 Segnale di stop sequenze palindrome poli T 5 -CCCACAGCCGCCAGTTCCGCTGGCGGCATTTTAACTTTCTTTAATGA-3 3 -GGGTGTCGGCGGTCAAGGCGACCGCCGTAAAATTGAAAGAAATTACT-5 trascrizione 5 -CCCACAGCCGCCAGUUCCGCUGGCGGCAUUUUAACUUUCUUUAATGA-3 A 5 -CCCAC C U C U G G C A U C G C G G C C G C G G C A UUUU-3 folding dell RNA che favorisce la terminazione

11

12

13 I nuclei delle cellule eucariotiche contengono tre tipi di polimerasi

14

15 irna

16 DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini

17 ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97% del gene codificante Almeno un terzo del genoma umano viene trascritto L evoluzione successiva dello spliceosoma ha facilitato la diffusione degli introni negli eucarioti più complessi. Nei procarioti si ha una piccolissima parte di ncdna perché i processi di trascrizione e traduzione sono quasi simultanei ncdna nei procarioti è meno dell 1%

18 Attività genetica: tradizionalmente si riteneva... Procarioti Eucarioti

19 ncdna Ipotesi sul ruolo del ncdna: facilita il processo di riassortimento è presente per motivi strutturali è una traccia dell assemblamento casuale prebiotico Il ncdna dopo l escissione viene semplicemente degradato e riciclato Alcune regioni del genoma codificano per l rrna e il trna necessari alla sintesi proteica I genomi sequenziati di batteri e archeobatteri sono costituiti principalmente da sequenze codificanti affiancate da regioni di controllo dell espressione..

20 ...attualmente si ritiene Eucarioti RNA intronici ed esonici interagendo con altre molecole possono dirigersi selettivamente verso bersagli posti su altre molecole di DNA ed RNA Sono state identificate migliaia di sequenze di RNA che vengono trascritte e non tradotte in proteine. Inutile spreco energetico?

21 RNAi Il meccanismo dell RNA interference, scoperto nel 1998 da studi sul C.Elegans 1, segue la scoperta delle capacità di gene silencing dell RNA antisenso: una molecola artificiale di RNA (single strand) che si lega all mrna e ne impedisce la traduzione in proteina. RNAi è in grado di combattere infezioni di RNA virus per cui si pensa che si sia evoluto per proteggere le cellule eucariotiche contro forme invasive di acidi nucleici Caratteristiche importanti dell RNAi: RNAi si diffonde nell individuo e può essere trasmesso alla progenie Solo poche molecole di dsrna sono sufficienti ad innescare il meccanismo di RNAi presenza di componenti catalitiche di amplificazione RNAi agisce a livello post-trascrizionale poiché dsrna corrispondenti a sequenze introniche non attivano l RNAi RNAi è altamente specifico: l iniezione di dsrna omologo a sequenze esoniche specifiche di un gene eliminano o riducono solo l mrna corrispondete a quel gene particolare. 1 Caenorhabditis elegans è un verme lungo circa 1 mm, che vive nel suolo, in regioni temperate.

22 RNAi 4 stadi: 1. Dicer taglia il dsrna in frammenti a doppia elica lunghi nucleotidi (sirna) 2. Gli sirna vengono incorporati in un complesso detto RISC (RNA-induced silencing complex) 3. Attivazione del RISC mediante la separazione delle due catene 4. Degradazione di mrna complementare allo strand di guida del sirna presente nel RISC 5. Si ha un ulteriore step che varia a seconda degli organismi. Questi sirna secondari vengono generati durante un amplificazione ciclica nella quale l RdRp (RNA-dependent RNA polimerase) viene direzionata sul mrna bersaglio dai sirna esistenti

23 CTAT movie

24

25

26 Figure 7-10 Molecular Biology of the Cell ( Garland Science 2008)

27

28

29 Figure 7-36 Molecular Biology of the Cell ( Garland Science 2008)

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Acidi nucleici non codificanti

Acidi nucleici non codificanti Vol. Giacca 4bozza 17-02-2011 11:05 Pagina 19 Acidi nucleici non codificanti 19 maniera controllata in modo da non favorire la crescita di eventuali tumori presenti in sedi lontane da quella in cui sono

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona CIN 2 3: CHE FARE? P Cattani Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona Istologia: diagnosi e gradi della CIN biopsia cervicale o escissione maturazione cell stratificazione cell anormalità

Dettagli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli DAI GENI AI SEMI genetica e biotecnologie in agricoltura Simona Baima e Giorgio Morelli Copyright 2010 Editori: Simona Baima e Giorgio Morelli Copertina e disegni: Franco Marchiolli [www.francomarchiolli.com]

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

COMUNICAZIONE TRA CELLULE E AMBIENTE

COMUNICAZIONE TRA CELLULE E AMBIENTE COMUNICAZIONE TRA CELLULE E AMBIENTE 1. LE CELLULE COMUNICANO TRA LORO Le cellule vegetali comunicano attraverso i plasmodesmi. Dato lo spessore della parete cellulare, come possono interagire tra loro

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Gli organismi viventi

Gli organismi viventi Gli organismi viventi Gli organismi viventi Quali caratteristiche contraddistinguono i viventi? È facile distinguere un organismo vivente da un oggetto non vivente? Gli organismi viventi Tutti gli organismi

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

-uno o più IONI INORGANICI

-uno o più IONI INORGANICI Coenzimi e vitamine Alcuni enzimi, per svolgere la loro funzione, hanno bisogno di componenti chimici addizionali, i COFATTORI APOENZIMA + COFATTORE = OLOENZIMA = enzima cataliticamente attivo Il cofattore

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Ministero dell'istruzione, dell'università e della Ricerca

Ministero dell'istruzione, dell'università e della Ricerca PROVA DI AMMISSIONE AL CORSO DI LAUREA IN MEDICINA VETERINARIA Anno Accademico 2010/2011 Test di Biologia 1. Quale dei seguenti composti NON è di natura lipidica? A) Chitina B) Tripalmitina C) Vitamina

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione PROTOCOLLO DI BIOSICUREZZA Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione Disinfezione Il ricorso a disinfettanti e disinfestanti, se unito ad altre misure tese a minimizzare

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre?

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre? Test di logica e cultura generale 1. Tre amici Carlo, Piero e Nicola acquistano della frutta al mercato. Ognuno di loro sceglie un diverso tipo di frutta e spende una somma differente. Sapendo che: - Carlo

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

Versione A Libretto Test

Versione A Libretto Test LINGUAGGIO MATEMATICO DI BASE 2 Linguaggio Matematico di Base LINGUAGGIO MATEMATICO DI BASE 1. La media aritmetica di due numeri s e t è 2 3. Allora t è uguale a A. B. C. D. E. 4 2s 3 3 2s 2 4 3s 2 4 3s

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Gli impianti di depurazione. I sistemi impermeabilizzanti MasterSeal chimico resistenti

Gli impianti di depurazione. I sistemi impermeabilizzanti MasterSeal chimico resistenti I sistemi impermeabilizzanti MasterSeal chimico resistenti from Master Builders Solutions I sistemi impermeabilizzanti MasterSeal chimico resistenti Indice : schema generale Tipo e grado di aggressione

Dettagli

DAI POLIMERI SINTETICI ALLE PLASTICHE BIODEGRADABILI

DAI POLIMERI SINTETICI ALLE PLASTICHE BIODEGRADABILI IT- Settore Tecnologico - B. FOCACCIA Salerno Piano dell Offerta Formativa 2011/2012 Presentazione del Progetto: DAI POLIMERI SINTETICI ALLE PLASTICHE BIODEGRADABILI Referente Prof. Anna Maria Madaio Cosa

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere ossidante.

L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere ossidante. Ozono (O 3 ) Che cos è Danni causati Evoluzione Metodo di misura Che cos è L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere

Dettagli

Vitamina D, PTH ed omeostasi del calcio

Vitamina D, PTH ed omeostasi del calcio Vitamina D, PTH ed omeostasi del calcio Funzioni principali della vit D Stimolazione dell'assorbimento del calcio e del fosforo a livello intestinale; Regolazione, in sinergia con l'ormone paratiroideo,

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

L ALIMENTAZIONE ANTINFIAMMATORIA PER IL PODISTA. Dott.ssa Elisa Seghetti Biologa Nutrizionista - Neurobiologa

L ALIMENTAZIONE ANTINFIAMMATORIA PER IL PODISTA. Dott.ssa Elisa Seghetti Biologa Nutrizionista - Neurobiologa L ALIMENTAZIONE ANTINFIAMMATORIA PER IL PODISTA Dott.ssa Elisa Seghetti Biologa Nutrizionista - Neurobiologa L atleta moderno ha bisogno di un maggior numero di adattamenti metabolici all esercizio fisico.

Dettagli

IL SISTEMA DELL INTERFERON: CENNI GENERALI.

IL SISTEMA DELL INTERFERON: CENNI GENERALI. IL SISTEMA DELL INTERFERON: CENNI GENERALI. Marco De Andrea, Raffaella Ravera, Daniela Gioia, Marisa Gariglio e Santo Landolfo Torino, Novara - Italia Riassunto Gli interferoni sono una famiglia di proteine

Dettagli

Aptima HIV-1 Quant Dx Assay

Aptima HIV-1 Quant Dx Assay Aptima Aptima HIV-1 Quant Dx Assay Per uso diagnostico in vitro. Solo per l esportazione dagli USA. Informazioni generali................................................ 2 Utilizzo previsto................................................................

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1 1 13. Anticorpi I edizione (vedi singoli sottocapitoli) 13. Anticorpi...1 13.1. STRUTTURA DEGLI ANTICORPI ED I GENI DELLE IMMUNOGLOBULINE...3 13.1.1. Struttura/funzione degli anticorpi...4 13.1.2. Dominii

Dettagli

CINQUE DOMANDE SU CUI RIFLETTERE

CINQUE DOMANDE SU CUI RIFLETTERE L ORIGINE DELLA VITA CINQUE DOMANDE SU CUI RIFLETTERE L ORIGINE DELLA VITA CINQUE DOMANDE SU CUI RIFLETTERE DOMANDA DOMANDA DOMANDA DOMANDA 1 Come 2 Esistono 3 Da 4 Tutte ha avuto origine la vita? PAGINA

Dettagli

Quesiti e problemi. 6 Indica quali dei seguenti sistemi sono da considerare. 7 Come puoi giustificare la liberazione di calore in

Quesiti e problemi. 6 Indica quali dei seguenti sistemi sono da considerare. 7 Come puoi giustificare la liberazione di calore in SUL LIBRO DA PAG 306 A PAG 310 Quesiti e problemi ESERCIZI 1 Le reazioni producono energia 1 Qual è il fattore più importante per stabilire se una reazione è esotermica o endotermica? Per stabilire se

Dettagli

Etichettatura degli alimenti

Etichettatura degli alimenti Ministero della Salute Direzione generale per l igiene e la sicurezza degli alimenti e la nutrizione Etichettatura degli alimenti Cosa dobbiamo sapere La scelta di alimenti e bevande condiziona la nostra

Dettagli

www.zampadicane.it Guida alle Vaccinazioni

www.zampadicane.it Guida alle Vaccinazioni VACCINAZIONI Le vaccinazioni da fare al proprio cane sono parecchie, alcune sono obbligatorie ed alcune facoltative e possono essere consigliate dal veterinario in casi specifici. Vediamo nel dettaglio

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

CAPITOLO CAPIT Tecnologie dell ecnologie dell info inf rmazione e controllo

CAPITOLO CAPIT Tecnologie dell ecnologie dell info inf rmazione e controllo CAPITOLO 8 Tecnologie dell informazione e controllo Agenda Evoluzione dell IT IT, processo decisionale e controllo Sistemi di supporto al processo decisionale Sistemi di controllo a feedback IT e coordinamento

Dettagli

Scheda dei Dati di Sicurezza Secondo le Direttive 91/155/CEE

Scheda dei Dati di Sicurezza Secondo le Direttive 91/155/CEE 1. Identificazione della sostanza/preparato e della societá o ditta 1.1 Identificazione della sostanza o del preparato Denominazione: Mercurio II Solfato soluzione 200 g/lin acido solforico diluito 1.2

Dettagli

Contratto di Conduzione, Manutenzione ed Adeguamento degli Impianti Tecnologici e delle Infrastrutture Edili

Contratto di Conduzione, Manutenzione ed Adeguamento degli Impianti Tecnologici e delle Infrastrutture Edili Contratto di Conduzione, Manutenzione ed Adeguamento degli Impianti Tecnologici e delle Infrastrutture Edili Telecom Italia - Internal Use Only - All rights reserved EVOLUZIONE MODELLO MANUTENZIONI INDUSTRIALI

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Altre informazioni sul papilloma virus (HPV)

Altre informazioni sul papilloma virus (HPV) Altre informazioni sul papilloma virus (HPV) Questo è un documento di approfondimento sull HPV. Prima di leggerlo guardate le informazioni di base contenute in Alcune informazioni sull esame per il papilloma

Dettagli

A Ferrara, 14 miliardi di anni fa

A Ferrara, 14 miliardi di anni fa A Ferrara, 14 miliardi di anni fa 1 L eredità di Copernico Quale è la relazione fra l uomo e l universo per ciò che riguarda: x : lo spazio t : il tempo m: la materia m t C X 2 Un viaggio nel tempo t di

Dettagli

Alimentazione Così si può migliorare l efficienza alimentare

Alimentazione Così si può migliorare l efficienza alimentare Ancora dal convegno di Copenaghen. Questo parametro, nell allevamento delle bovine da latte, può crescere. E non solo perfezionando il razionamento. Ma anche intervenendo su diversi altri fattori, come

Dettagli

Verifica - Conoscere le piante

Verifica - Conoscere le piante Collega con una linea nome, descrizione e disegno Verifica - Conoscere le piante Erbe Hanno il fusto legnoso che si ramifica vicino al terreno. Alberi Hanno il fusto legnoso e resistente che può raggiungere

Dettagli

ORGAN ON A CHIP. Un promettente sostituto alla sperimentazione animale

ORGAN ON A CHIP. Un promettente sostituto alla sperimentazione animale ORGAN ON A CHIP Un promettente sostituto alla sperimentazione animale 1 1.Fasi di sviluppo di un farmaco La ricerca e lo sviluppo di un farmaco sono indirizzate al processo dell identificazione di molecole

Dettagli

Business Process Management

Business Process Management Business Process Management Come si organizza un progetto di BPM 1 INDICE Organizzazione di un progetto di Business Process Management Tipo di intervento Struttura del progetto BPM Process Performance

Dettagli

Unità 12. La corrente elettrica

Unità 12. La corrente elettrica Unità 12 La corrente elettrica L elettricità risiede nell atomo Modello dell atomo: al centro c è il nucleo formato da protoni e neutroni ben legati tra di loro; in orbita intorno al nucleo si trovano

Dettagli

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale.

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. L analisi modale è un approccio molto efficace al comportamento dinamico delle strutture, alla verifica di modelli di calcolo

Dettagli

7.9 Reazioni che introducono un centro Stereogenico

7.9 Reazioni che introducono un centro Stereogenico 7.9 eazioni che introducono un centro tereogenico Molte reazioni convertono reagenti achirali a prodotti chirali. E importante ricordare, comunque che se tutti i i componenti iniziali (reagenti, catalizzatori,

Dettagli

LA COMUNICAZIONE VERBALE E NON VERBALE. MODALITÀ DI COMUNICAZIONE EFFICACE ED INEFFICACE

LA COMUNICAZIONE VERBALE E NON VERBALE. MODALITÀ DI COMUNICAZIONE EFFICACE ED INEFFICACE LA COMUNICAZIONE VERBALE E NON VERBALE. MODALITÀ DI COMUNICAZIONE EFFICACE ED INEFFICACE LA COMUNICAZIONE La comunicazione è una condizione essenziale della vita umana e dell ordinamento sociale, poiché

Dettagli

Definizione di una policy per l archivio istituzionale ISS

Definizione di una policy per l archivio istituzionale ISS CONFERENCE Institutional archives for research: experiences and projects in open access Istituto Superiore di Sanità Rome, 30/11-1/12 2006 Definizione di una policy per l archivio istituzionale ISS Paola

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Principali malattie parassitarie del cane; Le malattie parassitarie che maggiormente interessano e colpiscono il cane sono molte ed alcune di queste possono colpire e provocare conseguenze anche per l

Dettagli

Siamo così arrivati all aritmetica modulare, ma anche a individuare alcuni aspetti di come funziona l aritmetica del calcolatore come vedremo.

Siamo così arrivati all aritmetica modulare, ma anche a individuare alcuni aspetti di come funziona l aritmetica del calcolatore come vedremo. DALLE PESATE ALL ARITMETICA FINITA IN BASE 2 Si è trovato, partendo da un problema concreto, che con la base 2, utilizzando alcune potenze della base, operando con solo addizioni, posso ottenere tutti

Dettagli

Castrazione e sterilizzazione

Castrazione e sterilizzazione Centro veterinario alla Ressiga Castrazione e sterilizzazione Indicazioni, controindicazioni, effetti collaterali ed alternative Dr. Roberto Mossi, medico veterinario 2 Castrazione e sterilizzazione Castrazione

Dettagli

IMAGING BIO_MOLECOLARE con DaTSCAN

IMAGING BIO_MOLECOLARE con DaTSCAN IMAGING BIO_MOLECOLARE con DaTSCAN Stelvio Sestini, MD, PhD Unità di Medicina Nucleare - USL4 Prato Università degli Studi di Firenze Concetto 1. Le M. Neurodegenerative sono in aumento Concetto 2. Le

Dettagli

CIRCOLAZIONE NATURALE. NATURAL SOL Pacchetti solari a circolazione naturale

CIRCOLAZIONE NATURALE. NATURAL SOL Pacchetti solari a circolazione naturale CIRCOLAZIONE NATURALE NATURAL SOL Pacchetti solari a circolazione naturale 1964 2014 Immergas. Una lunga storia alle spalle, insegna a guardare in avanti. Il 5 febbraio del 1964, Immergas nasceva dal

Dettagli

Non è la specie più forte che sopravvive né la più intelligente ma quella più ricettiva ai cambiamenti. Charles Darwin (1809-1882)

Non è la specie più forte che sopravvive né la più intelligente ma quella più ricettiva ai cambiamenti. Charles Darwin (1809-1882) Non è la specie più forte che sopravvive né la più intelligente ma quella più ricettiva ai cambiamenti Charles Darwin (1809-1882) L evoluzione secondo LAMARCK (1744-1829) 1. Gli antenati delle giraffe

Dettagli

Guida alle attività. Tutto sulle cellule staminali

Guida alle attività. Tutto sulle cellule staminali Guida alle attività è un attività da usare con studenti dagli 11 ai 14 anni o con più di 16 anni. Consiste in un set di carte riguardanti le conoscenze basilari sulle cellule staminali e sulle loro applicazioni

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier RICERCA APPLICATA / Stress ossidativo, invecchiamento e malattie degenerative Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier A cura del Dipartimento Scientifico

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

FONDAMENTI DI BIOLOGIA DELLO SVILUPPO

FONDAMENTI DI BIOLOGIA DELLO SVILUPPO FONDAMENTI DI BIOLOGIA DELLO SVILUPPO Grazyna Ptak, PhD, DSc Dipartimento di Scienze Biomediche Comparate Università degli Studi di Teramo Il ciclo della vita: gli stadi dello sviluppo animale 1. specificazione

Dettagli

Informazioni per i pazienti e le famiglie

Informazioni per i pazienti e le famiglie Che cos è l MRSA? (What is MRSA? Italian) Reparto Prevenzione e controllo delle infezioni UHN Informazioni per i pazienti e le famiglie Patient Education Improving Health Through Education L MRSA è un

Dettagli

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale?

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Questo vecchio slogan pubblicitario riconduce ad una parziale verità scientifica, oggi più che attuale. E risaputo che parlare di zucchero

Dettagli

IL SISTEMA NERVOSO. Organizzazione e struttura

IL SISTEMA NERVOSO. Organizzazione e struttura IL SISTEMA NERVOSO Organizzazione e struttura IL SISTEMA NERVOSO. è costituito due tipi cellulari: il neurone (cellula nervosa vera e propria) e le cellule gliali (di supporto, di riempimento: astrociti,

Dettagli

Università degli Studi di Napoli Federico II Dottorato in Biologia Avanzata - 22 ciclo -

Università degli Studi di Napoli Federico II Dottorato in Biologia Avanzata - 22 ciclo - Università degli Studi di Napoli Federico II Dottorato in Biologia Avanzata - 22 ciclo - Effetti citogenetici indotti in cellule umane da ioni pesanti relativistici Candidata: Diana Pignalosa Tutor: Prof.

Dettagli

Sostituzioni sull anello aromatico

Sostituzioni sull anello aromatico Sostituzioni sull anello aromatico Criteri per stabilire l esistenza di carattere aromatico 1. Il composto deve essere ciclico, planare e deve avere una nuvola ininterrotta di elettroni π sopra e sotto

Dettagli

il materiale contenuto nel presente documento non può essere utilizzato o riprodotto senza autorizzazione

il materiale contenuto nel presente documento non può essere utilizzato o riprodotto senza autorizzazione Reliability Management La gestione del processo di Sviluppo Prodotto Ing. Andrea Calisti www.indcons.eu Chi sono... Andrea CALISTI Ingegnere meccanico dal 1995 al 2009 nel Gruppo Fiat Assistenza Clienti

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

Present Perfect SCUOLA SECONDARIA I GRADO LORENZO GHIBERTI ISTITUTO COMPRENSIVO DI PELAGO CLASSI III C/D

Present Perfect SCUOLA SECONDARIA I GRADO LORENZO GHIBERTI ISTITUTO COMPRENSIVO DI PELAGO CLASSI III C/D SCUOLA SECONDARIA I GRADO LORENZO GHIBERTI ISTITUTO COMPRENSIVO DI PELAGO CLASSI III C/D Present Perfect Affirmative Forma intera I have played we have played you have played you have played he has played

Dettagli

ATTIVITA 2012 L ORMA. Educazione e Promozione Sociale. Presentazione servizi e attività Anno 2012

ATTIVITA 2012 L ORMA. Educazione e Promozione Sociale. Presentazione servizi e attività Anno 2012 ATTIVITA 2012 L ORMA Educazione e Promozione Sociale Presentazione servizi e attività Anno 2012 L Orma è una realtà che opera da più di 10 anni nel settore dell Educazione e della Promozione Sociale. Tutte

Dettagli

AALBORG+10 ISPIRARE IL FUTURO

AALBORG+10 ISPIRARE IL FUTURO AALBORG+10 ISPIRARE IL FUTURO LA NOSTRA VISIONE COMUNE Noi, governi locali europei, sostenitori della Campagna delle Città Europee Sostenibili, riuniti alla conferenza di Aalborg+10, confermiamo la nostra

Dettagli

Igiene Generale ed applicata. Indice. 1 Epidemiologia generale delle malattie infettive ---------------------------------------------------- 3

Igiene Generale ed applicata. Indice. 1 Epidemiologia generale delle malattie infettive ---------------------------------------------------- 3 INSEGNAMENTO DI IGIENE GENERALE ED APPLICATA LEZIONE II EPIDEMIOLOGIA GENERALE DELLE MALATTIE INFETTIVE PROF.SSA DANIELA ANASTASI Indice 1 Epidemiologia generale delle malattie infettive ----------------------------------------------------

Dettagli