Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "www.fisiokinesiterapia.biz"

Transcript

1 Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici

2 Fattori estrinseci Ambiente Danno genotossico Immunodepressione Fattori estrinseci Interazioni con ospite Immunità Angiogenesi Fattori intrinseci Fattori genetici Fattori epigenetici Interazione Neopl. Ematol

3 Leucemia = processo multistep : accumulo progressivo di eventi (lesioni genetiche, escape immunologico

4 Forme sporadiche Eventi necessari per sviluppare il tumore: x (3 nell esempio)

5 Predisposizione genetica (tumori ereditari, fattori favorenti, etc.. (1) 2 3 Eventi necessari per sviluppare il tumore: x-1 (2 nell esempio): Rischio relativo (RR) di sviluppare il tumore molto più elevato

6 Tumori ereditari Bersaglio per il secondo evento immensamente più grande: RR di sviluppare il tumore estremamente più elevato, 2 rischio quasi certo 1 2 3

7 Alterazioni citogenetiche e molecolari nelle neoplasie ematologiche (I) Forniscono informazioni riguardanti la cellula da cui si è originata la neoplasia Individuano geni e meccanismi di trasduzione del segnale responsabili di quel dato disordine onco-ematologico Marcano la popolazione neoplastica: tutte le cellule che originano dalla cellula colpita dall evento trasformante presentano infatti la stessa lesione genica ( popolazione clonale )

8 Alterazioni citogenetiche e molecolari nelle neoplasie ematologiche (II) Consentono di formulare una corretta diagnosi Identificano particolari entità clinico-biologiche all interno di uno stesso disordine oncoematologico Predicono la prognosi del paziente e possono essere sfruttate per valutare la risposta alla terapia Hanno permesso e permetteranno di sviluppare terapie molecolari sempre pià mirate

9 Cellula colpita dall evento leucemogenico Cellula totipotente non ancora differenziata in grado di dare origine a colonie mieloidi e linfoidi Cellula già differenziata o per la mielopoiesi (CFU- GEMM) o per la linfocitopoiesi

10 Prove a favore della genesi a partire da una cellula staminale Solo alcune cellule leucemiche, quelle più indifferenziate e quiescenti sono quelle che una volta trasferite nel topo determinano una malattia in tutto e per tutto identica a quella che causano nell uomo

11 Cellula staminale leucemica Condivide l assetto genico della cellula normale L unica differenza ad oggi nota è che presenta l inattivazione o la mutazione di un gene oncosoppressore, PTEN

12 PTEN: Funzioni Le cellule staminali normali che non esprimono Pten se trapiantate nel topo non permettono una ripresa dell emopoiesi a lungo termine. Dopo il trapianto l emopoiesi si esaurisce Pten controlla la differenziazione della cellula staminale sia in senso mieloide che linfoide

13 Pten e leucemogenesi Attraverso un meccanismo ancora sconosciuto ma diverso da quello operante nella cellula staminale normale le cellule staminali con l inattivazione di Pten inducono una malattia se trapiantate nel topo immunodeficiente NOG La malattia mieloproliferativa a prevalente componente mieloide si trasforma poi in leucemia perché intervengono ulteriori mutazioni

14 Leucemia Mieloide Cronica

15 Importanza di alterazioni genetiche Le traslocazioni cromosomiche MLL-AF9 e quelle coinvolgenti ERG sono da sole in grado di dare origine ad un quadro leucemico indipendentemente dal livello di differenzazione della cellula in cui si sviluppano.

16 Fattori genetici Alterazione di: oncogeni geni oncosoppressori geni regolatori (mirna etc ) geni regolatori della stabilità genetica

17 MicroRNA (mirna) Sono piccole sequenze di RNA maturo lunghe nucleotidi Riducono o impediscono l espressione di proteine Tagliano direttamente un mrna bersaglio usando un meccanismo di RNA interference o inibendo la sintesi proteica. L espressione di mirnas è tessuto specifica e correlata allo stadio maturativo di un tessuto.

18 MicroRNA Sono trascritti a partire da molecole più lunghe chiamate primirna. Questi sono processati nel nucleo della cellula in hairpin RNA, pre-mirna da una ribonucleasi che taglia mrna a doppia catena. Il pre-mirna viene trasportato al citoplasma dove è digerito da una seconda ribonucleasi che taglia mrna a doppia catena chiamata dicer. Negli animali il mirna a singolo filamento si lega ad un mrna complementare I microrna sino ad oggi identificati sono 1000

19 Processo di silencing naturale Processo di silencing indotto Potenziale modalità terapeutic

20 mirna in cancers

21 Oncogene 2006

22 Involvement of micrornas in cancer predisposition?

23 Ruolo dei mirna nella leucemia linfatica cronica (I) Primo disordine oncoematologico in cui è stata riportata l importanza dei mirna I pazienti con LLC a cellule B ed espressione del CD5 presentano come più comune singola anomalia una delezione del cromosoma 13 alla banda q14, del(13)(q14). La delezione si accompagna ad un decorso clinico indolente Linfociti B CD5 positivi di soggetti sani esprimono alti livelli di mir-15a e mir Questi mirna sono mappati esattamente all interno della regione di cromosoma 13 deleta nei pazienti con LLC

24 Ruolo dei mirna nella leucemia linfatica cronica (II) Nel 70% dei pazienti con LLC a cellule B questi due microrna sono poco espressi Mutazioni germ-line nei pri-mir-16-1/15a si osservano in casi di LLC familiare e si ritiene che predispongano allo sviluppo di questo disordine linfo-proliferativo

25 Perché nei pazienti con LLC-B CD5+ il gene BCL2 è sovraespresso?

26 mir16-1/15a nei soggetti sani ed in quelli con LLC Una sovraespressione dei due mirna si associa ad una ridotta espressione di BCL2, gene che codifica per una proteina che blocca la morte cellulare programmata Nei linfociti B CD5 positivi di soggetti sani alta espressione dei due mirna e bassa espressione di BCL2; Nei linfociti B CD5 positivi di pazienti con LLC situazione inversa: bassa espressione dei due mirna e alta espressione di BCL2.

27 Rapporti tra mir16-1/15a e BCL2 La delezione 13q14 causa la perdita dei due mir con conseguente aumentata espressione di BCL2 Risultato: Cellule leucemiche bloccate nella fase G0/G1 del ciclo cellulare particolarmente resistenti all apoptosi

28 Instabilità genomica E assolutamente necessaria: consente che la cellula leucemica o linfomatosa acquisisca sempre nuove mutazioni che ad esempio la rendono resistente ai protocolli di chemioterapia

29 Meccanismi di instabilità genomica Difettoso funzionamento dei geni preposti al riparo del DNA Accorciamento della lunghezza dei telomeri con difettoso funzionamento della telomerasi Perdita di DDR (DNA Damage chekpoint Response) Perdita di OIS (Oncogene Induced Senescence)

30

31 Progressione della LMC Fase cronica Fase accelerata-blastica 100% Dei casi 20-30% limfoide Considerazioni: Cromosoma Ph si sviluppa in una cellula pluripotente La popolazione leucemica Ph-positiva è molto instabile

32 Conosciamo molto bene i meccanismi che causano un eccessiva proliferazione ma non quelli responsabili della progressione e dell instabilità genomica

33 La notevole tendenza alla progressione del clone Ph positivo ne indica l importante instabilità genomica anni N N N N N N Ph+ N N N N Ph+ N Ph+ Ph+ N N N N Ph+ Ph+ N N N N N N N N N N N N N N 5 N N Ph+ N N N N N Difetti genici aggiuntivi Ph+ N N Ph+ N N N N N N Ph+ Ph+ Ph+ N - inattivazione N N N di p53 Ph+ N N N Ph+ N Ph+ Ph+ N- inattivazione N N di N p16 Ph+ Ph+ Ph+ N N N Ph+ Ph+ -Ninattivazione N di Rb Ph+ Ph1 Ph+ N Ph+ N N N Crisi blastica - sovraespressione N Ph+ di Ph1 EVI Ph1 Ph+ N Ph+ Ph1 Ph+ N N Ph1 Ph1 Ph1 Ph+ -..molti N Ph+ altri Ph1 Ph1 Ph+ N Ph+ Ph1 Ph1 Ph1 Ph1 Ph+ Ph+ Ph+ Ph+ Ph+ Ph+ Ph+ Ph1 Ph1 Ph+ Ph+ Ph+ Ph1 Ph+ Ph+ Ph+ Ph+ Ph+ Ph1 Ph+ Ph1Ph+ Ph1 Ph+ Ph1 I difetti genici aggiuntivi sono

34 Fattori Intrinseci Epigenetici Alterazione del processo di metilazione Alterazione del processo di acetilazione

35

36 La metilazione delle isole CpG nelle regioni che promuovono la trascrizione di un gene induce silenziamento genico per blocco della trascrizione è un meccanismo di inattivazione di tumor suppressor genes

37

38

39 p15ink4a Regolatore negativo del ciclo cellulare ( fase G1-S) Inibisce le cicline kinasi dipendenti 4 e5 Nelle preleucemie la ipermetilazione di questo gene si correla con una più breve sopravvivenza e più rapida progressione clinica

40 Sopravvivenza dei pazienti con preleucemia in base allo stato di metilazione dip15ink4b P survival Metilato Non metilato T (months) Quesnel, et al. Blood. 1998;91:2985

41 Il codice istonico La coda degli istoni contiene residui di lisina, residui di arginina e di serina conservati durante l evoluzione. Tali residui servono da substrato per la acetilazione, metilazione, fosforilazione, e ubiquitinazione. Le modificazioni dello stato combinatorio a livello della coda degli istoni viene interpretato da complessi proteici che legandovisi in modo selettivo possono modificare ulteriormente la cromatina e determinare il destino del DNA avvolto attorno agli istoni. Tali interazioni determinano attivazione trascrizionale, silenziamento, replicazione del DNA a seconda del tipo di cellula, della fase del ciclo cellulare, del grado di differenziazione e dello stress ambientale.

42 Deacetilasi istoniche Rimuovono i gruppi acetilici dai residui di lisina localizzati a livello della coda degli istoni e nei fattori trascrizionali I substrati delle deacetilasi sono i nucleosomi. Questi consistono di circa 150 paia di basi di DNA avvolto attorno ad un ottamero istonico, formato dagli istoni 2A, 2B, 3, e 4. Le code degli istoni protrudono attraverso il DNA verso la superficie del nucleosoma, dove possono essere modificati chimicamente ed interagire con altre proteine

43

44 HAT Sin3 N-cor HDAC histon acetylation -> chromatin relaxation -> transcription of target genes

45 HAT complex HDAC complex La cromatina è accessibile ai fattori trascrizionali, è possibile l espressione di geni necessari per la differenziazione

46 HAT complex HDAC complex La cromatina non è accessibile ai fattori trascrizionali, non è possibile l espressione di geni indispensabile per la differenziazione. Blocco differenziativo

47 HDAC Inattivazione di geni oncosoppressori Inattivazione di geni che regolano la proliferazione, differenzazione e l apoptosi Cruciali per preparare l istone alla rimozione di gruppi acetile tramite la metiltransferasi

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

Normale controllo della crescita cellulare

Normale controllo della crescita cellulare Normale controllo della crescita cellulare STOP STOP Cellula normale STOP Alterato controllo della crescita cellulare X STOP STOP Cellula tumorale STOP X Le cellule tumorali presentano alterazioni cromosomiche

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Crescita e divisione cellulare

Crescita e divisione cellulare 08-04-14 CANCRO Crescita e divisione cellulare ogni cellula deve essere in grado di crescere e riprodursi una cellula che cresce e si divide genera due nuove cellule figlie gene4camente iden4che alla cellula

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

SEBASTIANO FILETTI. Dipartimento di Medicina Interna e Specialità Mediche. Università di Roma Sapienza, Roma

SEBASTIANO FILETTI. Dipartimento di Medicina Interna e Specialità Mediche. Università di Roma Sapienza, Roma SEBASTIANO FILETTI Dipartimento di Medicina Interna e Specialità Mediche Università di Roma Sapienza, Roma La malattia tiroidea è in aumento negli ultimi anni. Quali le ragioni? Dati epidemiologici provenienti

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari

Dettagli

SINDROMI MIELODISPLASTICHE

SINDROMI MIELODISPLASTICHE SINDROMI MIELODISPLASTICHE MECCANISMI MOLECOLARI R. Piazza MECCANISMI MOLECOLARI Bejar R et al. JCO 2011;29:504-515 NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

ID55/2005 PROGETTO R&S Lo sviluppo di nuovi inibitori delle istone deacetilasi per un approccio epigenetico alla terapia dei tumori.

ID55/2005 PROGETTO R&S Lo sviluppo di nuovi inibitori delle istone deacetilasi per un approccio epigenetico alla terapia dei tumori. SCHEDE TECNICHE INTERVENTI CONCLUSI ATI CONGENIA - CONGENIA Srl Milano - DAC Srl Milano - NIKEM RESEARCH Srl Bollate MI - ISTITUTO EUROPEO DI ONCOLOGIA Milano - ISTITUTO FIRC DI ONCOLOGIA MOLECOLARE Milano

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Diapositiva 3: CASPASI IAP inibitor of apoptosis

Diapositiva 3: CASPASI IAP inibitor of apoptosis Diapositiva 1: Diapositiva 2: Nella presente presentazione vengono trattate le correlazioni scoperte e studiate tra la tecnica dei microrna e l apoptosi. Innanzitutto l apoptosi è il processo che porta

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

«La sola speranza di arrivare un giorno a controllare i tumori risiede nella maggiore comprensione delle cause e della patogenesi di questa malattia»

«La sola speranza di arrivare un giorno a controllare i tumori risiede nella maggiore comprensione delle cause e della patogenesi di questa malattia» «La sola speranza di arrivare un giorno a controllare i tumori risiede nella maggiore comprensione delle cause e della patogenesi di questa malattia» Oncologia Definizioni, e criteri di classificazione

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Proliferazione e morte cellulare sono eventi fisiologici

Proliferazione e morte cellulare sono eventi fisiologici MORTE CELLULARE Proliferazione e morte cellulare sono eventi fisiologici Omeostasi tissutale (di tessuti dinamici) Sviluppo embrionale Eliminazione di strutture corporee inutili - Fasi di scultura/rimodellamento

Dettagli

Il cancro è la conseguenza di anomalie della funzionalità cellulare

Il cancro è la conseguenza di anomalie della funzionalità cellulare Cellule cancerose Il cancro è la conseguenza di anomalie della funzionalità cellulare In base al tipo di tessuto colpito, diverse categorie : Carcinomi: cell. epiteliali rivestimenti est e int Sarcomi:

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Espressione di geni specifici per un determinato tumore

Espressione di geni specifici per un determinato tumore Espressione di geni specifici per un determinato tumore Paziente A: Non ha il cancro Espressione dei geni: Nessuna Biopsia Geni associati al cancro allo stomaco Paziente B: Ha un tumore allo stomaco Bassa

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

Prof. Maria Alessandra Santucci

Prof. Maria Alessandra Santucci La famiglia Abl consiste di due isoforme Abl (1a e 1b ) e due isoforme Arg (1a e 1b). Le isoforme di tipo b contengono un sito di miristoilazione all N-teminale che manca nelle isoforme a. c-abl è una

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni Perché ci troviamo oggi a parlare delle cellule staminali? Driesch (fine 800) dimostra la totipotenza dei blastomeri dell embrione embrione

Dettagli

Zecchin Davide La telomerasi come target per l inibizione nella cura del cancro

Zecchin Davide La telomerasi come target per l inibizione nella cura del cancro Zecchin Davide La telomerasi come target per l inibizione nella cura del cancro INTRODUZIONE Esistono alcuni fattori che rendono la telomerasi un target attraente e selettivo per la cura del cancro. In

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Apoptosi. Copyright (c) by W. H. Freeman and Company

Apoptosi. Copyright (c) by W. H. Freeman and Company Apoptosi La morte cellulare e la sua regolazione La morte cellulare programmata è un processo fondamentale che controlla lo sviluppo degli organismi pluricellulari; L apoptosi porta all eliminazione di

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

EFFETTI BIOLOGICI DELLE RADIAZIONI

EFFETTI BIOLOGICI DELLE RADIAZIONI EFFETTI BIOLOGICI DELLE RADIAZIONI Asp 2- Caltanissetta- Dott.ssa G. Di Franco Dirigente medico U.O. Radioterapia San Cataldo RADIAZIONI IONIZZANTI Radiazioni capaci di causare direttamente o indirettamente

Dettagli

1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità

Dettagli

LEUCEMIE ACUTE LINFOIDI DELL'ADULTO

LEUCEMIE ACUTE LINFOIDI DELL'ADULTO LEUCEMIE ACUTE LINFOIDI DELL'ADULTO La leucemia acuta linfoide è una malattia non frequente (15% delle forme leucemiche) in cui vi è una proliferazione maligna di cellule linfoidi nel midollo, nel sangue

Dettagli

Neoplasia (o tumore) Neoplasie Maligne. Neoplasie Benigne. Si definisce Neoplasia:

Neoplasia (o tumore) Neoplasie Maligne. Neoplasie Benigne. Si definisce Neoplasia: Neoplasia (o tumore) Neoplasia: classificazione Si definisce Neoplasia: una massa abnorme di tessuto la cui crescita supera quella dei tessuti normali e progredisce anche dopo la cessazione degli stimoli

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Caratterizzazione Molecolare di Cellule Staminali di Leucemia Mieloide Acuta

Caratterizzazione Molecolare di Cellule Staminali di Leucemia Mieloide Acuta 2 Workshop Nazionale SIES Ematologia Traslazionale Verona, 21-22 Maggio 2009 Caratterizzazione Molecolare di Cellule Staminali di Leucemia Mieloide Acuta Simona Salati Universita di Modena and Reggio Emilia

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Ruolo della biologia molecolare nel carcinoma ovarico

Ruolo della biologia molecolare nel carcinoma ovarico Carcinoma ovarico avanzato: quali novità per il 2015? Ruolo della biologia molecolare nel carcinoma ovarico Anna Pesci Ospedale SC Don Calabria, Negrar anna.pesci@sacrocuore.it TIPO I TIPO II Basso stadio

Dettagli

Leucemie: principi generali e fisiopatologia. Paolo Avanzini

Leucemie: principi generali e fisiopatologia. Paolo Avanzini Leucemie: principi generali e fisiopatologia Paolo Avanzini Schema Definizione Incidenza Classificazione Alcune descrizioni Fisiopatologia Alcuni casi particolari LEUCEMIE: COSA SONO Gruppo eterogeneo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

La genetica è la disciplina che si occupa della trasmissione dei caratteri ereditari Si divide in:

La genetica è la disciplina che si occupa della trasmissione dei caratteri ereditari Si divide in: La genetica La genetica è la disciplina che si occupa della trasmissione dei caratteri ereditari Si divide in: 1. Genetica mendeliana 2. Genetica citoplasmatica 3. Citogenetica 4. La genetica delle popolazioni

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

PROGRESS IN STEM CELL BIOLOGY AND MEDICAL APPLICATIONS 12/01/13

PROGRESS IN STEM CELL BIOLOGY AND MEDICAL APPLICATIONS 12/01/13 PROGRESS IN STEM CELL BIOLOGY AND MEDICAL APPLICATIONS Fare clic Stresa 14-16 per modificare maggio 2009 lo stile del sottotitolo dello schema Self-renewal vs differentiation Controllo del self renewal

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

CICLO CELLULARE EUCARIOTICO

CICLO CELLULARE EUCARIOTICO CICLO CELLULARE EUCARIOTICO COMPESSO SISTEMA DI CONTROLLO OMEOSTASI ORGANISMO NORMALE G 0 CANCRO DNA marcato con molecole intercalanti fluorescenti Fluorescence Activated Cell Sorting (FACS) Rilevazione

Dettagli