Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula"

Transcript

1 Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento

2 DNA, RNA e mirna revolutions Controllo traduzionale Trasporto di RNA Domande, approfondimenti

3 Differenziamento Mantenimento della diversita Alterazioni

4 Gli spazi omici

5 Gli spazi omici metaboloma (piccole molecole) proteoma (proteine) trascrittoma (mrna) genoma (DNA)

6 Nobel prize in Physiology or Medicine, Maurice Wilkins J. Watson & F. Crick Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid. Dogma centrale della Biologia molecolare: DNA mrna (RNA messaggero) Proteina

7 Ribosoma DNA Trascrizione (nucleo) mrna Proteina Traduzione (Citoplasma) Funzione X

8

9

10

11 Grandezza del genoma in differenti organismi ~ 12*10 6 ~ 2,7*10 9 ~ 180*10 6 ~ 3*10 9 ~ 100*10 6 ~ 120*10 6 ~ 1*10 9

12 ~ 3*10 9 Grandezza α Complessita? Grandezza α Longevita? ~ 140*10 9 ~ 670*10 9 Piramide della complessita? Piramide della longevita? ~ 590*10 3

13 Un paradosso? Il numero dei geni codificanti proteine non può giustificare le differenze evolutive tra gli eucarioti. ~6,5k <30k ~15k ~25k ~20k ~31k >30k

14 Stesso genoma Stesso numero di geni espressi

15 La spiegazione della differenza evolutiva (e differenziativa) sembra legata all espressione dei geni in: Quantità Luogo (cellule, tessuti) Tempi diversi Controllo combinatorio: trascrizionale post-trascrizionale post-traduzionale (fosfo e defosforilazioni, metilazoni, acetilazioni, ubiquitinazioni e sumoilazioni)

16 1 2

17 1. Splicing 2. Controllo traduzionale

18 The Nobel Prize in Physiology or Medicine 1993 "for their discoveries of split genes" Richard J. Roberts Phillip Sharp

19 Aumentare la complessità aumentando l uso combinatorio di esoni mediante splicing alternativo Trascritto primario Splicing alternativo Funzione A Funzione B Membrana Rilascio extra-cellulare (gradiente) Ancoraggio membrana (contatto mediata) OUT IN

20 1. Splicing 2. Controllo traduzionale: microrna

21 microrna DNA mrna Proteina +/- Trascrizione (nucleo) Traduzione (Citoplasma)

22 microrna world Craig Mello Andrew Fire Nobel prize in Physiology or Medicine, 2006

23

24 Origine e meccanismo di azione RISC: RNA-induced silencing complex

25 302 (1/3) are neurons Accumulation around the ring Simple NS hope to model & understand an entire NS

26 Zebrafish come organismo modello: The vertebrate C. elegans

27 Embrioni trasparenti che si sviluppano in un chorion trasparente sviluppo embrionale estremamente rapido (molti organi si formano in 24 ore) organi composti da un numero relativamente basso di cellule grande numero di progenie: 1 femmina: >200 uova/ sett. tempo generazionale: 2-3 mesi 10 cm Petri dish Nüsslein-Volhard Lab, Max Planck Institute, Tübingen

28 microrna world: non solo C. elegans..

29 Laboratory tool: - Silenziamento specifico - Veloce - Usi terapeutici - Rnd mir

30 1. Splicing 2. Controllo traduzionale: trasporto RNA

31 Esempi di localizzazione di RNA. Oskar mrna in oocita gurken mrna nell oocita (defining the dorsal, anterior and posterior regions of the embryo) bicoid mrna in embrione

32 Esempi di localizzazione di RNA...non solo Drosophila... Actin mrna nei fibroblasti ASH1 mrna in lievito (S. cerevisiae)

33 ...ma anche neuroni RNA che NON localizza nei dendriti RNA che localizza nei dendriti

34 Movimento di RNA nei dendriti neuronali

35 Perche le cellule localizzano RNA? Efficiente: 1 molecola mrna proteine Sicuro: previene l interazione aspecifica di proteine con altre proteine Rapido: Permette di avere dei cambiamenti rapidi locali della concentrazione di una determinata proteina

36 Come fa l RNA a localizzare in maniera specifica in un determinato compartimento cellulare? 1. Sequenze specifiche (codice postale) ATG.STOP 5 non tradotta Regione codificante 3 non tradotta Trasporto Proteina 2. Proteine (proteine che legano RNA, motor proteins)

37 Come la memoria viene immagazzinata a livello cellulare? Quali molecole sono coinvolte in questo processo? Come fa il neurone a creare nuove specifiche sinapsi?

38 Dendrites Cell Body Axon Ramon y Cajal ca. 1890

39 Apprendimento e Memoria Modifiche di specifiche sinapsi Engert and Bonhoeffer, Nature 1999 Formazione di nuove sinapsi in un neurone

40 Apprendimento e Memoria Modifiche di specifiche sinapsi Modificami, Sto imparando! Come il neurone modifica alcune sinapsi ma non altre? Localizzando mrna! Lasciami riposare!

41 Neurone normale Neurone normale?? Assone Dendriti Assone Dendriti?? GFP 3 GFP / sirna

42 SMA: spinal muscular atrophy SCA: spinocerebellar ataxia ALS: amyotrophic lateral sclerosis

43

44 Grazie dell attenzione!

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Le proteine sono biologicamente attive solo se ripiegate nella conformazione corretta (Folding)

Le proteine sono biologicamente attive solo se ripiegate nella conformazione corretta (Folding) Livelli di organizzazione delle proteine Le proteine sono biologicamente attive solo se ripiegate nella conformazione corretta (Folding) es. Folding ossidativo Il corretto ripiegamento è aiutato da specifiche

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

I mirna NEI MECCANISMI ANTIVIRALI

I mirna NEI MECCANISMI ANTIVIRALI Davide Schiavone Biochimica A.A. 2004-2005 I mirna NEI MECCANISMI ANTIVIRALI I processi di difesa antivirale operati da RNA sfruttano diversi meccanismi che sono raggruppati sotto il nome di RNA silencing.

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Relatrice: dott.ssa Ilaria Pegoretti

Relatrice: dott.ssa Ilaria Pegoretti Relatrice: dott.ssa Ilaria Pegoretti IL LABORATORIO DI BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni 26 Novembre 2011 Auditorium Presidio Ospedaliero S.Chiara, Trento Scoperta

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati

Dettagli

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI Testi di riferimento: Alberts B. et al. Biologia molecolare della cellula - Ed. Zanichelli Gilbert S.F. Biologia dello sviluppo - Ed. Zanichelli COS E UNA CELLULA

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA

MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA APLYSIA: VANTAGGI: Sistema nervoso semplice Poche e grosse (1 mm) cellule riconoscibili (20.000) MEMORIA PROCEDURALE Priming Motorie Apprendimento (abilità,abitudini)

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Affidabilità nella diagnostica

Affidabilità nella diagnostica Affidabilità nella diagnostica Passione per la ricerca Research & Innovation è un laboratorio di medicina molecolare che esegue test genetici avanzati al servizio dei medici e delle strutture di diagnosi

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

Citoscheletro Microtubuli

Citoscheletro Microtubuli PROPRIETA DEI MICROTUBULI, FILAMENTI INTERMEDI E FILAMENTI DI ACTINA Citoscheletro Microtubuli Biotec _ 2011 Da G. Karp, BIOLOGIA CELLULARE E MOLECOLARE, 3a ed, CORRETTA Microtubuli Microfilamenti Filamenti

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

PRINCIPALI TIPI CELLULARI DEL SISTEMA NERVOSO NEURONI (CELLULE NERVOSE ) CELLULE GLIALI, O GLIA

PRINCIPALI TIPI CELLULARI DEL SISTEMA NERVOSO NEURONI (CELLULE NERVOSE ) CELLULE GLIALI, O GLIA PRINCIPALI TIPI CELLULARI DEL SISTEMA NERVOSO NEURONI (CELLULE NERVOSE ) CELLULE GLIALI, O GLIA Corteccia cerebrale ed aree associate: da 12 a 15 miliardi di neuroni Cervelletto: 70 miliardi di neuroni

Dettagli

Stem Cells. Medicine Biology. Bioethics

Stem Cells. Medicine Biology. Bioethics Stem Cells Medicine Biology Bioethics Dal DNA all organismo complesso Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Corso di aggiornamento sulle Biotecnologie CusMiBio

Corso di aggiornamento sulle Biotecnologie CusMiBio Corso di aggiornamento sulle Biotecnologie CusMiBio Regolazione dell espressione genica dal DNA alle proteine Prof. Paolo Plevani, Aula 200, 22/09/2014 LEARNING WEEK Qualche novità e/o stimolo sul controllo

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

DMM SCIENTIFIC MEETING PADOVA, 29-30 MAGGIO 2014

DMM SCIENTIFIC MEETING PADOVA, 29-30 MAGGIO 2014 DMM SCIENTIFIC MEETING PADOVA, 29-30 MAGGIO 2014 DMM SCIENTIFIC MEETING - PADOVA, 29-30 MAGGIO 2014 QUESTIONARIO RISPOSTE CORRETTE 1. I vaccini a DNA sono potenziati dall uso della elettroporazione in

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

L endocitosi dell EGFR

L endocitosi dell EGFR L endocitosi dell EGFR IFOM per la scuola Lo Studente Ricercatore 2011 Muzio Giulia Istituto d Istruzione Superiore Maserati Voghera Gruppo di lavoro: Determinanti della trasformazione neoplastica e della

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli