Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA"

Transcript

1

2 Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA

3

4 Lunghezza del cromosoma di E.coli (1,7 mm) paragonata alla lunghezza di una tipica cellula di E. coli (2μm)

5 DNA di una cellula di E. coli lisata.

6 Cromosomi eucariotici

7

8 La lunghezza complessiva del DNA genomico di una cellula umana è circa 2 m. Un corpo umano adulto contiene circa cellule, e quindi la lunghezza totale del DNA corrisponde a circa 2 x km. 11 km Circonferenza della terra= 4 x 10 4 km Distanza tra la Terra e il Sole = 1,5 x 10 8 km Il DNA cellulare deve essere fortemente compattato per trovare spazio all interno della cellula!

9 Il superavvolgimento Superavvolgimento significa letteralmente avvolgimento di qualcosa che è già avvolto. Avvolgimento Il cordone del telefono è un tipico filo avvolto la cui torsione determina un superavvolgimento. Superavvolgimento

10 DNA a doppia elica (avvolto) Asse Il superavvolgimento del DNA Il DNA è avvolto in forma di una doppia elica nella quale entrambe le catene avvolte ruotano intorno ad un asse. DNA superavvolto Un ulteriore ripiegamento o una torsione di tale asse su se stesso determinano un superavvolgimento del DNA Se non vi è alcun ripiegamento del asse del DNA su se stesso, si dice che il DNA è in uno stato rilassato.

11 Il DNA compattato produce qualche forma di superavvolgimento. Anche la replicazione o la trascrizione del DNA, che richiedono una temporanea separazione delle eliche,, producono qualche forma di superavvogimento.

12 La separazione delle catene di una struttura a doppia elica circolare induce superavvolgimento.

13 In una molecola circolare chiusa che corrisponde perfettamente alla a struttura B del DNA (10,5 coppie di basi per giro d elica) d il DNA sarà rilassato. Il superavvolgimento avviene quando il DNA è deformazione strutturale. sottoposto a una sorta di I DNA circolari chiusi raramente sono rilassati e il grado di superavvolgimento è ben definito e caratteristico di ogni DNA derivato da un determinato tipo cellulare. Il grado di deformazione è regolato dalla cellula. In quasi tutti i casi la deformazione è il risultato di un disavvolgimento.. Il DNA presenta ciè un numero di giri di elica minore di quanto ci si attenderebbe per la struttura B.

14 Il disavvolgimento del DNA in vivo rende più facile separare le catene fra loro dando facile accesso all informazione contenuta al loro interno. Lo stato parzialmente disavvolto può essere matenuto solo se il DNA è in forma circolare chiusa o se è stabilizzato da interazioni con proteine in modo tale che le catene non siano libere di ruotare su se stesse. Se si verifica un interruzione in una delle due catene di un DNA circolare parzialmente disavvolto,, in quel punto la rotazione libera provocherà un ritorno spontaneo allo stato rilassato

15 Stato rilassato (8 giri) (a) Segmento di DNA di 84 bp nella sua forma rilassata con 8 giri d elica (10,5 coppie di basiu per giro), all interno di una molecola circolare chiusa. Stato deformato (7 giri) (b) Deformazione conseguente alla rimozione di un giro d elica. Vi saranno 12 coppie di basi per giro (84/7), e la molecola è termodinamicamente svantaggiata. La deformazione potrebbe essere riequilibrata tramite l avvolgimento dell asse del DNA su se stesso a formare un superavvolgimento oppure Superavvolto (supercoil) (c) Separazione delle catene (d) tramite la parziale separazione delle due catene a una distanza di circa 10 bp. La deformazione provocata dal disavvolgimento è generalmente risolta dal superavvolgimento piuttosto che dalla separazione delle catene, perché l avvolgimento dell asse del DNA richiede meno energia della rottura dei legami idrogeno che tengono unite le due catene.

16 DNA a doppia elica in forma B, costituito da 260 coppie di basi. Poiché il numero di residui nucleotidici per giro dell elica elica in una molecola di DNA non sottoposta a tensione è di 10,5, questa molecola di DNA lineare presenta 25 giri. Se si uniscono le estremità di questa molecola..

17 ...si.si ottiene una molecola circolare rilassata.

18 Se si srotola la doppia elica lineare di due giri prima di riunire re le estremità à....si.si ottiene un diverso tipo di DNA circolare con due possibili conformazioni ormazioni alternative.

19 Il DNA può ripiegarsi in una struttura contenente 23 giri di elica B e un anello srotolato

20 .. Oppure può adottare una struttura superavvolta con 25 giri di elica B e due giri di superavvolgimento destrorso,, detto superelica negativa.

21

22 Una molecola di DNA superavvolto è più compatta di una molecola di DNA rilassato con la stessa lunghezza. Una molecola di DNA superavvolto si muove più rapidamente del DNA rilassato quando è sottoposta a centrifugazione, oppure a elettroforesi.

23 La nostra comprensione della conformazione del DNA è facilitata da concetti derivati dalla topologia,, una branca della matematica che si occupa delle proprietà strutturali che non variano anche in presenza di deformazioni come lo stiramento e la curvatura.

24 Una proprietà topologica fondamentale di una molecola di DNA circolare è il suo numero di legame (linking number, Lk). Se due catene sono legate come in (a) esse sono effettivamente unite da ciò che può essere definito un legame topologico. Anche se le catene sono separate per rottura di tutte le interazioni che le tengono insieme, tale legame topologico le manterrebbe ancora unite. Se si considera una delle catene circolari come la delimitazione di una superficie immaginaria, il numero di legame è definito come il numero di volte che la seconda catena buca questa superficie. Lk negativo per eliche avvolte in senso levogiro Lk positivo per eliche avvolte in senso destrogiro Anche il numero di legame corrisponde al numero di volte in cui una catena di DNA si avvolge in direzione destrorsa intorno all asse asse dell elica, elica, quando l asse è vincolato a giacere su un piano

25 Il concetto di numero di legame applicato a molecole di DNA circolare chiuso Per una molecola di DNA circolare chiusa in stato rilassato, Lk è il numero di basi diviso per il numero di coppie di basi per giro (10,5). 2100bp Perché una molecola di DNA circolare abbia una proprietà topologica come il numero di legame, è necessario che nessuna delle due catene presenti interruzioni. Se una delle catene è rotta, è possibile in linea di principio disavvolgere le eliche e separarle completamente (Lk( è indefinito). Se, prima della chiusura, una doppia elica è srotolata, è possibile descrivere il disavvolgimento parziale del DNA in termini di cambiamento del numero di legame (ΔLk)

26 Superavvolgimento positivo e negativo Il superavvolgimento causato dal parziale disavvolgimento è detto superavvolgimento negativo. Quando il DNA è avvolto più del normale,, il superavvolgimento che ne risulta è detto positivo. Il senso della rotazione dell asse dell elica elica del DNA quando il DNA è parzialmente disavvolto (superavvolgimento negativo) è l immagine speculare di quello superavvolto (superavvolgimento positivo). Due forme di DNA circolare che differiscono solo per il numero di legame sono detti topoisomeri. I topoisomeri del DNA possono trasformarsi l uno l nell altro solo tagliando una o entrambe le catene del DNA e poi ricongiungendole tra loro.

27 Il numero di legame può essere scomposto in due componenti strutturali: turali: avvolgimento (writhe, Wr) ) e torsione (twist, Tw) La torsione può essere definita come una misura dell arrotolamento a elica dei filamenti del DNA l uno l attorno all altro. altro. L avvolgimento rappresenta una misura dei giri dell asse della doppia elica, o superavvolgimento.

28 Nastro non deformato (DNA rilassato) Grande avvolgimento, piccolo cambiamento di torsione Nessun avvolgimento, grande cambiamento di torsione

29 Quando si verifica un cambiamento del numero di legame, parte della tensione risultante è solitamente compensata dall avvolgimento avvolgimento (Wr( Wr, superavvolgimento) ) e parte da modificazioni della torsione (Tw( Tw) ) secondo l equazione: Lk = Tw + Wr

30 Il parziale disavvolgimento del DNA può indurre la formazione di strutture cruciformi DNA rilassato DNA parzialmente disavvolto DNA cruciforme

31 Gli enzimi che determinano l aumento l o la diminuzione del grado di disavvolgimento del DNA sono chiamati topoisomerasi,, e la proprietà del DNA su cui agiscono è il numero di legame. Le topoisomerasi hanno un ruolo determinante in processi quali la replicazione e l impacchettamento del DNA. Due classi di topoisomerasi: Le topoisomerasi di tipo I agiscono rompendo transitoriamente una delle catene del DNA, ruotando un estremit estremità intorno alla catena integra e riunendo le estremità interrotte. Modificano Lk con incrementi o riduzioni di 1. Le topoisomerasi di tipo II rompono entrambe le catene del DNA e modificano Lk con incrementi o riduzioni di 2.

32 Modificazioni del numero di legame catalizzate da topoisomerasi. Una popolazione di DNA plasmidici identici con lo stesso numero di legame migra come una banda discreta in elettroforesi. Le molecole di DNA superavvolto sono più compatte e in un elettroforesi su gel migrano più rapidamente delle corrispondenti molecole rilassate.

33 In E. coli ci sono almeno quattro diverse topoisomerasi, identificate da numeri romani da I a IV. Le topoisomerasi di tipo I (topoisomerasi( I e III) generalmente rilassano il DNA rimuovendo i superavvolgimenti negativi (aumentano Lk). La topoisomerasi II,, un enzima batterico di tipo II, detta anche DNA girasi, è in grado di indurre superavvolgimenti negativi (diminuisce Lk). Tale enzima utilizza l energia l dell ATP.

34 Meccanismo della DNA girasi.

35 In una molecola di DNA con superavvolgimento negativo i superavvolgimenti sono destrogiri. Il DNA superavvolto tende ad essere lungo e stretto piuttosto che compatto e spesso possiede ramificazioni. Punti di ramificazione Con le densità di superelica normalmente riscontrabili nelle cellule, la lunghezza dell asse della superelica, incluse le ramificazioni, è circa il 40% della lunghezza del DNA stesso. Questo tipo di superavvolgimento è definito superavvolgimento plectonemico (dal greco pléktos ktos, ritorto, e nèma,, filo), ed è tipico del DNA superavvolto in soluzione. Asse del superavvolgimento

36 DNA plasmidico superavvolto in modo plectonemico

37 Rappresentazione schematica di una struttura con superavvolgimento plectonemico

38 Il superavvolgimento plectonemico non fornisce la compattezza necessaria per l impacchettamentol del DNA nella cellula. Una molecola di DNA disavvolta può assumere una seconda forma di superavvolgimento, detto superavvolgimento a solenoide. Invece degli ampi superavvolgimenti destrogiri caratteristici della forma plectonemica,, il superavvolgimento a solenoide implica rotazioni levogire più strette. La struttura a solenoide è simile a quella assunta da un tubo per innaffiare ben avvolto attorno ad un rocchetto. Il superavvolgimento a solenoide, di per sè meno stabile, può essere stabilizzato dal legame con proteine ed è la forma presente nella cromatina degli eucarioti.

39 Superavvolgimento plactonemico Superavvolgimento a solenoide In (b) sono rappresentati superavvolgimenti plactomemico e solenoide della stessa molecola di DNA, disegnati con la stessa scala. Il superavvolgimento a solenoide è più compatto

40 Immagine al microscopio elettronico dei nucleosomi

41 Nucleosomi Nucleo istonico del nucleosoma DNA di collegamento (linker) del nucleosoma La cromatina è costituita da fibre che contengono proteine e DNA in quantità approssimativamente uguali, più una piccola parte di RNA. Il DNA della cromatina interagisce molto strettamente con proteine chiamate istoni,, che condensano e ordinano il DNA in unità strutturali dette nucleosomi.

42 In tutte le cellule eucariotiche sono presenti le cinque maggiori classi di istoni Gli istoni hanno masse molecolari comprese tra e e sono molto ricchi degli amminoacidi basici arginina e lisina

43 Frammento di DNA (146 coppie di basi) avvolto intorno al nucleosoma con una conformazione a solenoide levogira.

44 Vista dall alto alto della struttura del nucleosoma con il DNA legato

45 La parte centrale proteica del nucleosoma contiene 8 molecole di istone, due copie ciascuna di H2A, H2B, H3 e H4

46 La struttura del nucleosoma spiega perché il DNA eucariotico è parzialmente disavvolto. Il ripiegamento a solenoide osservato nei nucleosomi è una conformazione assunta dal DNA parzialmente disavvolto (superavvolto negativamente). Lo stretto avvolgimento del DNA attorno agli istoni nelle particelle nucleosomiche richiede la rimozione di circa un giro d elica d dal DNA per permettere tali rotazioni serrate. Nucleo istonico Superavvolgimento Negativo con istone legato (a solenoide) Topoisomerasi Riduzione numero di legame Superavvolgimento positivo privo di istoni legati (plectonemico) Superavvolgimento negativo netto In vitro le topoisomerasi sono necessarie per l assemblaggio l della cromatina a partire da istoni e DNA circolare intatto.

47 Lo stretto avvolgimento del DNA attorno al nucleo istonico richiede una compressione della scanalatura minore in questi punti. Un gruppo di due o tre coppie di basi A=T facilita tale compressione

48 I nucleosomi sono compattati in strutture regolari di ordine superiore. L avvolgimento del DNA attorno al nucleo di un nucleosoma lo rende più compatto di circa sette volte. La compattazione completa del DNA in un cromosoma è di circa volte più grande!

49 La fibra di 30 nm Il compattamento del DNA nella fibra di 30 nm richiede la presenza di una molecola di istone H1 per nucleosoma.

50 La fibra di 30 nm fornisce al DNA una compattezza di circa 100 volte.

51 Il successivo livello di ripiegamento no è stato ancora chiarito, ma sembra che alcune regioni del DNA si associno con un impalcatura nucleare. Foto al microscopio elettronico di un cromosoma umano parzialmente srotolato, che mette in evidenza le numerose anse attaccate a una struttura simile ad una impalcatura.

52 Le regioni associate all impalcatura nucleare sono separate da anse di DNA contenenti probabilmente da a coppie di basi. Il DNA di ciascuna ansa può contenere un gruppo di geni correlati i tra loro. (impalcatura nucleare)

53 Modello dei livelli di organizzazione che producono il compattamento del DNA in un cromosoma eucariotico. Due cromatidi (costituiti ciascuno da 10 avvolgimenti) Un avvolgimento (30 rosette) Una rosetta (6 anse o loop) Impalcatura nucleare Un ansa o loop (75000 bp) Fibra di 30 nm Forma a collana della cromatina

54 Il DNA batterico è compattato in una struttura chiamata nucleoide. Cellule di E. coli dove è evidente il nucleoide.

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 20 Geni e cromosomi Concetti chiave: Il DNA superavvolto può essere descritto in termini di numero di legami, avvolgimenti

Dettagli

Dimensioni di Genomi

Dimensioni di Genomi Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa

Dettagli

Alcune sequenze di DNA insolite. Palindromo. Sequenze con una simmetria doppia

Alcune sequenze di DNA insolite. Palindromo. Sequenze con una simmetria doppia Alcune sequenze di DNA insolite Palindromo Sequenze con una simmetria doppia Possono formare: Struttura a croce dette anche anse cruciformi DNA rilassato DNA parzialmente disavvolto DNA cruciforme Struttura

Dettagli

2. I nucleosomi 11/02/16

2. I nucleosomi 11/02/16 2. I nucleosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale u Ordinato e dinamico u Formazione della struttura terziaria

Dettagli

Il superavvolgimento è negativo quando consiste in una rotazione in senso opposto

Il superavvolgimento è negativo quando consiste in una rotazione in senso opposto Topoisomerasi Il DNA di batteri, mitocondri, plastidi e alcuni virus è costituito da una doppia elica circolare. Consideriamo una molecola di DNA circolare a doppia elica rilassata e chiusa, formata da

Dettagli

Il superavvolgimento del DNA

Il superavvolgimento del DNA Il superavvolgimento del DNA Superavvolgimento del DNA genomico nei procarioti ed eucarioti Plasmide: DNA extracromosomico batterico (circolare) Figura 2.32 DNA circolare rilassato e superavvolto. Il superavvolgimento:

Dettagli

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc.

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc. estremità 5' 5 3 - P N 5 2 C 3 ponte fosfodiestere P A 1 2 C 5 P 3 G N 1 2 C 5 3 P T N 1 5 2 C 3 etc. DNA C N 1 estremità 3' zucchero N 1 C 3 4 3 timina N adenina N N 1 6 N N 9 N zucchero N zucchero citosina

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 5. NUCLEOSOMI contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

MODALITA DI REPLICAZIONE

MODALITA DI REPLICAZIONE MODALITA DI REPLICAZIONE In teoria è ipotizzabile che il DNA possa duplicarsi con modalità: 1) semi-conservativa se alla generazione successiva passano due doppie eliche entrambi costituite da un'elica

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Quanto DNA è contenuto in una cellula?...

Quanto DNA è contenuto in una cellula?... Quanto DNA è contenuto in una cellula?... bp = Base Pair (coppie di basi) lungh DNA/lungh struttura ospitante E. coli: 4,6x10 6 bp (1,7 mm) 850 (unica molecola circolare) Cellula umana: 3,2x10 9 bp (~2

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

Caratteristiche strutturali dell RNA Le differenze con DNA sono date dal ribosio, dall uracile e dal fatto che normalmente non è presente nelle

Caratteristiche strutturali dell RNA Le differenze con DNA sono date dal ribosio, dall uracile e dal fatto che normalmente non è presente nelle RNA Caratteristiche strutturali dell RNA Le differenze con DNA sono date dal ribosio, dall uracile e dal fatto che normalmente non è presente nelle cellule come doppia elica. Solo in certi virus, dove

Dettagli

Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

DNA e replicazione del DNA

DNA e replicazione del DNA DNA e replicazione del DNA 1928: EXP di Griffith Scoperto il fattore trasformante Struttura elicoidale del DNA Struttura del DNA Subunità nucleotidiche Struttura del DNA Subunità nucleotidiche La replicazione

Dettagli

BIOMOLECOLE (PROTEINE)

BIOMOLECOLE (PROTEINE) BIOMOLECOLE (PROTEINE) Proteine: funzioni Strutturale (muscoli, scheletro, legamenti ) Contrattile (actina e miosina) Di riserva (ovoalbumina) Di difesa (anticorpi) Di trasporto (emoglobina, di membrana)

Dettagli

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare Principi di Citologia e Istologia. Prof. Pucci, 2003 Il compartimento nucleare Il Compartimento Nucleare Il compartimento nucleare è caratteristica propria degli eucarioti. Il compartimento consiste delle

Dettagli

REPLICAZIONE DEI GENOMI A DNA

REPLICAZIONE DEI GENOMI A DNA REPLICAZIONE DEI GENOMI A DNA LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA FIGURA 12.26 GENES VII FIGURA 13.1 GENOMI II FIGURA 13.2 GENOMI II NEL 1958 MESELSON E STAHL DIMOSTRANO CHE

Dettagli

LA GENETICA MOLECOLARE

LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

Strutture alternative e strutture superiori degli acidi nucleici

Strutture alternative e strutture superiori degli acidi nucleici Strutture alternative e strutture superiori degli acidi nucleici Strutture alternative La struttura a doppia elica proposta da Crick e Watson, e che abbiamo sopra descritto, è quella ottenuta mediante

Dettagli

Studio della regolazione dell espressione genica

Studio della regolazione dell espressione genica Studio della regolazione dell espressione genica Un gene soggetto a regolazione possiede una o più sequenze regolatorie posizionate in maniera diversa rispetto al gene. I regolatori possono essere positivi

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

L esperimento di Griffith sulla trasformazione genetica in pneumococco.

L esperimento di Griffith sulla trasformazione genetica in pneumococco. L esperimento di Griffith sulla trasformazione genetica in pneumococco. La natura chimica del materiale genetico ACIDI NUCLEICI DNA : deposito informazioni RNA: a) espressione informazione (es. sintesi

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

Adenina Adenine H H N N N N N Z

Adenina Adenine H H N N N N N Z Adenina Adenine Z Guanina O GUAIA Z Citosina CITOSIA Z O Timina Thymine C3 O Z O Siti di attacco elettrofilo 3 Thymine Basi appaiate: Timina-Adenina Adenine C 3 O O 3.ooA Basi appaiate: Citosina-Guanina

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

Chimica Biologica A.A α-elica foglietto β reverse turn

Chimica Biologica A.A α-elica foglietto β reverse turn Chimica Biologica A.A. 2010-2011 α-elica foglietto β reverse turn Str. Secondaria sperimentalmente osservata: Si distinguono fondamentalmente tre tipi di strutture secondarie: α elica foglietto β reverse

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria cellulare (Schleiden e

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

D'Addario - Biologia Molecolare

D'Addario - Biologia Molecolare 2. Struttura del DNA contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale gli acidi nucleici, acido desossiribonucleico (DNA)

Dettagli

La Topologia. La topologia è quella branca della matematica che studia le proprietà. delle strutture che non si modificano quando sono sottoposte a

La Topologia. La topologia è quella branca della matematica che studia le proprietà. delle strutture che non si modificano quando sono sottoposte a La Topologia La topologia è quella branca della matematica che studia le proprietà delle strutture che non si modificano quando sono sottoposte a deformazione. Ι - SUPERAVVOLGIMENTO DEL DNA La struttura

Dettagli

GENI, GENOMI E CROMOSOMI

GENI, GENOMI E CROMOSOMI www.fisiokinesiterapia.biz GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza

Dettagli

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione negli eucarioti I meccanismi della trascrizione Organizzazione generale delle sequenze regolative Il macchinario generale della trascrizione Si

Dettagli

DNA. simile ad una scala a chiocciola. I pioli della scala corrispondono

DNA. simile ad una scala a chiocciola. I pioli della scala corrispondono DNA Il DNA o acido desossiribonucleico è una grossa molecola chimica contenuta nel nucleo della cellula. Il DNA può essere paragonato ad un importante libro delle istruzioni che contiene l informazione

Dettagli

La cellula eucariotica animale

La cellula eucariotica animale Tutte le cellule sono circondate da una membrana plasmatica costituita da fosfolipidi e proteine. Le cellule eucariotiche posseggono organuli rivestiti di membrana. L organulo di dimensioni maggiori è

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI IL MATERIALE GENETICO Fino agli anni 40 si credeva che le proteine fossero le molecole della informazione ereditaria. C erano comunque

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

Diagramma di Ramachandran

Diagramma di Ramachandran Chimica Biologica A.A. 2010-2011 Diagramma di Ramachandran Diagramma di Ramachandran Catena polipeptidica La formazione in successione di legami peptidici genera la cosiddetta catena principale o scheletro

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Sollecitazioni delle strutture

Sollecitazioni delle strutture Sollecitazioni delle strutture I pilastri e i muri portanti sono tipicamente sollecitati a compressione Le travi e i solai sono sollecitati a flessione L indeformabilità di questi elementi costruttivi

Dettagli

sono le unità monomeriche che costituiscono le proteine hanno tutti una struttura comune

sono le unità monomeriche che costituiscono le proteine hanno tutti una struttura comune AMINO ACIDI sono le unità monomeriche che costituiscono le proteine sono 20 hanno tutti una struttura comune sono asimmetrici La carica di un amino acido dipende dal ph Classificazione amino acidi Glicina

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

MODELLO SCHEDA INSEGNAMENTO

MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino

Dettagli

Le membrane cellulari

Le membrane cellulari Le membrane cellulari Tutte le cellule, procariote ed eucariote, sono delimitate da una membrana (MEMBRANA PLASMATICA) Molti organelli intracellulari degli eucarioti sono circoscritti da membrane (MEMBRANE

Dettagli

Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi. Possono assumere forme diverse a seconda della funzione

Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi. Possono assumere forme diverse a seconda della funzione Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi Hanno elevato PM Possono assumere forme diverse a seconda della funzione svolgono molteplici funzioni Tra le proteine

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

Polimorfismo genetico del collageno

Polimorfismo genetico del collageno COLLAGENO È la proteina più abbondante del nostro corpo costituendo il 25% delle proteine totali. È la proteina principale dei tessuti connettivi, la cui matrice extracellulare contiene anche: -proteoglicani

Dettagli

Formazione del legame peptidico:

Formazione del legame peptidico: Formazione del legame peptidico: Planare, ha una forza intermedia tra il legame semplice ed il legame doppio. 2^ lezione N R C C O O O + R N R C O C O O N R C C N C C O Ogni piano delle unità peptidiche

Dettagli

Author name Giuliano Bettini. Title The Single Thread

Author name Giuliano Bettini. Title The Single Thread Author name Giuliano Bettini Title The Single Thread Abstract This short paper explores intriguing analogies between helical structures of electron and elementary particles and circular supercoiled DNA.

Dettagli

Biotecnologie. Screening delle genoteche con le sonde geniche

Biotecnologie. Screening delle genoteche con le sonde geniche Biotecnologie Screening delle genoteche con le sonde geniche Giancarlo Dessì http://www.giand.it Licenza Creative Commons BY-NC-SA (BY: attribuzione, NC: uso non commerciale, SA: condividi allo stesso

Dettagli

Funzioni delle proteine

Funzioni delle proteine Funzioni delle proteine ENZIMI Proteine di trasporto Proteine di riserva Proteine contrattili o motili Proteine strutturali Proteine di difesa Proteine regolatrici Proteine di trasporto Emoglobina Lipoproteine

Dettagli