Messa a punto dell analisi della

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Messa a punto dell analisi della"

Transcript

1 SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro di Diploma di Responsabili AMBRA CATTANI Dott.ssa Francesca Molinari Dott. Milo Frattini 1

2 Sommario 1. Abstract Abbreviazioni Introduzione I tumori tiroidei Alterazioni molecolari del carcinoma tiroideo Alterazioni molecolari del carcinoma papillare La mutazione del gene BRAF La traslocazione RET/PTC Scopo del lavoro Pazienti, materiali e metodi Pazienti Materiali e metodi Estrazione degli acidi nucleici Quantificazione degli acidi nucleici estratti dai tessuti Amplificazione del DNA genomico tramite PCR Analisi dello stato mutazionale del gene BRAF Elettroforesi su gel di agarosio Purificazione del DNA amplificato PCR di sequenza (cyclesequencing) Purificazione del DNA dopo PCR di sequenza Il sequenziamento Retrotrascrizione dell RNA a cdna Messa a punto dell analisi delle traslocazioni RET/PTC tramite metodica di RT PCR Scelta dei primers e PCR a gradiente di temperatura Validazione della metodica di analisi di traslocazione RET/PTC Amplificazione dei geni di controllo PGK1 e PAX Analisi dei prodotti di amplificazione tramite elettroforesi capillare Risultati Messa a punto delle reazioni di PCR per l analisi delle traslocazioni RET/PTC1 e RET/PTC Validazione della metodica per l analisi dei frammenti delle traslocazioni RET/PTC1 e RET/PTC3, tramite RT PCR ed analisi dei frammenti Analisi dello stato mutazionale del gene BRAF

3 7. Discussione Conclusione Bibliografia Ringraziamenti Allegati Estrazione di DNA genomico da tessuti fissati in formalina ed inclusi in paraffina (FFPE) Estrazione RNA da tessuto FFPE Quantificazione degli acidi nucleici Costituzione della miscela di reazione per la PCR Elettroforesi su gel di agarosio Purificazione del DNA amplificato PCR di sequenza (cyclesequencing) Purificazione del DNA dopo PCR di sequenza

4 1. Abstract Introduzione I tumori tiroidei rappresentano il principale tipo di tumore endocrino, con una prevalenza dei tumori papillari (circa l 80%). Il metodo di indagine diagnostica preoperatorio più diffuso e accurato per la valutazione della natura benigna o maligna dei noduli tiroidei è l esame citologico su aspirazione bioptica con ago sottile. Tuttavia, nel 15 20% circa delle analisi citologiche non è possibile giungere a diagnosi certa. In questi casi le analisi delle alterazioni di marcatori molecolari specifici del carcinoma tiroideo possono essere d aiuto nel discriminare i campioni patologici e aiutare nelle scelte terapeutiche. Nei carcinomi papillari tiroidei le alterazioni più frequenti e specifiche di tale tumore sono rappresentate da mutazioni puntiformi del gene BRAF e dalle traslocazioni RET/PTC, ovvero riarrangiamenti del gene RET con geni eterologhi espressi ubiquitariamente. Le due forme più frequenti di riarrangiamento sono RET/PTC1 e RET/PTC3, determinate dalla fusione del gene RET con i geni CCDC6 e NCOA4 rispettivamente. Scopo del lavoro Lo scopo di questo lavoro di diploma è quello di ottimizzare un protocollo di analisi delle traslocazioni RET/PTC tramite RT PCR ed analisi dei frammenti nel Laboratorio di Patologia Molecolare dell Istituto Cantonale di Patologia di Locarno. Materiali e metodi Per la messa a punto del protocollo delle analisi RET/PTC sono stati usati due costrutti plasmidici contenenti le traslocazioni RET/PTC1 e RET/PTC3. I protocolli di PCR, specifici per individuare le traslocazioni RET/PTC1 e RET/PTC3, sono stati messi a punto tramite PCR a gradiente di temperatura e validati su 17 campioni di RNA estratto da tessuti fissati in formalina ed inclusi in paraffina di pazienti affetti da tumore papillare tiroideo. I campioni di RNA analizzati sono stati estratti tramite un kit commerciale e retrotrascritti a cdna tramite protocolli già in uso presso l ICP. I cdna ottenuti sono stati analizzati tramite PCR seguendo il protocollo messo a punto sui costrutti plasmidici e gli amplificati ottenuti sono stati analizzati al sequenziatore. Inoltre, per ottenere un quadro molecolare più completo, è stata valutata la mutazione dell esone 15 del gene BRAF tramite PCR e sequenziamento diretto, partendo da DNA genomico dei pazienti analizzati, seguendo i protocolli già in uso presso l ICP. 4

5 Risultati e conclusione I risultati ottenuti dalle PCR a gradiente di temperatura e dalla successiva analisi dei frammenti effettuati su costrutti plasmidici, si sono rilevati ottimi a tutte le temperature provate, e pertanto è stata stabilita come temperatura di ibridazione la temperatura media del gradiente pari a 57 C. Due campioni di tessuto tumorale su 17 (11,8%), a fronte di nessuno dei tessuti sani, sono risultati positivi per le traslocazioni RET/PTC, risultato concordante con la letteratura. L analisi del gene BRAF ha identificato una mutazione in 10 campioni su 17 (58,8%), una percentuale alta, ma comunque concordante con diversi testi presenti in letteratura. In conclusione si può dire che le metodiche messe a punto sono state validate con successo e possono essere introdotte in diagnosi. Background Thyroid tumors are the main type of endocrine tumor, with a prevalence of papillary tumors (about 80%). The most popular and accurate method of preoperative diagnostic evaluation of benign or malignant thyroid nodules is the cytologic examination of fine needle aspiration biopsy. However, in 15 20% of cytological analysis it is not possible to arrive at a diagnosis. In these cases the analysis of alterations of specific molecular markers of thyroid carcinoma may be helpful in discriminating the pathological samples and help with therapeutic choices. In papillary thyroid carcinomas, the most frequent and specific alterations of this tumor are represented by point mutations of the BRAF gene and RET/PTC translocations, or rearrangements of the RET gene with heterologous genes ubiquitously expressed. The two most frequent forms of rearrangement are RET/PTC1 and RET/PTC3 and determined by a fusion of the RET gene with the genes NCOA4 and CCDC6 respectively. The aim of this study The aim of this diploma work is to optimize a protocol analysis of RET/PTC translocations using RT PCR and fragments analysis in the Molecular Pathology Laboratory of Locarno. Materials and methods For the elaboration of the Protocol of the RET/PTC analysis, two plasmid constructs containing translocations RET/PTC1 and RET/PTC3 were used. PCR Protocols, specific to identifying translocations RET/PTC1 and RET/PTC3, were developed by means of temperature gradient PCR and tested on 17 RNA samples retrieved from formalin fixed paraffin embedded tissue of patients thyroid papillary cancer. The RNA samples analyzed 5

6 were extracted using a commercial kit and retrotranscripted to cdna using protocols already in use at the ICP. The cdna obtained were analyzed by PCR using the Protocol developed on plasmid constructs and the amplified samples obtained were analyzed on the sequencer. In addition, to obtain a more complete molecular framework, genomic DNA of the analyzed patients, was evaluated for the mutation of the Exon 15 of the BRAF gene by PCR and direct sequencing, following the protocols already in use at the ICP. Results and conclusion The results obtained from temperature gradient PCR and subsequent analysis of the fragments performed on plasmid constructs, were found excellent at all temperatures tested, and thus the average temperature gradient of 57 C was established as hybridization temperature. Two samples of tumor tissue in 17 (11.8%), compared with none of the healthy tissues, were positive for translocations RET/PTC, results consistent with the literature. The BRAF gene analysis has identified a mutation in 10 samples out of 17 (58.8%), a high percentage, but still consistent with several texts presented in literature. In conclusion we can say that the methods developed were validated successfully and can be introduced in diagnosis.. 6

7 2. Abbreviazioni bp: ddntps: dntps: FFPE: FTC: Fw: ICP: PCR: PTC: RTK: RT PCR: Rw: Tm: WT: paia di basi dideossinucleotidi trifosfati deossinucleotidi trifosfati tessuti fissati in formalina e inclusi in paraffina tumore follicolare tiroideo forward Istituto Cantonale di Patologia Polymerase Chain Reaction tumore papillare tiroideo recettori tirosin chinasici Reverse Transcription Polimerase Chain Reaction reverse temperature di melting Wild Type 7

8 3. Introduzione 3.1 I tumori tiroidei I carcinomi della tiroide rappresentano la neoplasia più frequente del sistema endocrino e la loro incidenza è in costante crescita negli Stati Uniti e nella maggior parte degli altri paesi (Nikiforov, 2011). L aumento complessivo dell incidenza del tumore è maggiore nelle donne rispetto agli uomini ed è maggiore nei soggetti di età compresa tra i 45 e i 50 anni. Uno dei principali fattori di rischio predisponenti allo sviluppo del tumore tiroideo è rappresentato dall esposizione a radiazioni ionizzanti. Tale associazione è stata accertata da diversi studi condotti dopo il disastro di Chernobyl del 1986, che hanno evidenziato un aumento dell incidenza di neoplasie tiroidee nei soggetti che al momento dell esposizione avevano un età compresa tra i 5 e i 10 anni. Altre condizioni predisponenti includono una familiarità per tumore tiroideo, una preesistente patologia tiroidea benigna, fattori ormonali e gravidanze, aumenti di peso ed un insufficiente apporto di iodio nella dieta (Romei et al, 2012). Più del 95% dei tumori tiroidei originano dalle cellule dell epitelio follicolare e comprendono adenomi, carcinomi ben differenziati, carcinomi poco differenziati e carcinomi anaplastici, mentre il 3,2% dei tumori tiroidei sono derivati dalle cellule C o parafollicolari (Chien et al, 2012). I carcinomi ben differenziati rappresentano circa l 80% di tutti i tumori tiroidei e comprendono due tipi principali: il carcinoma papillare (PTC) e il carcinoma follicolare (FTC). Il PTC è il tipo più comune e rappresenta l 80% di tutte le neoplasie tiroidee. Il PTC è generalmente indolente e curabile, ma questo tumore può comunque diffondere localmente ai linfonodi e molto comuni sono la persistenza della malattia e le recidive. Il FTC rappresenta il 15% di tutte le neoplasie tiroidee ed è il secondo tipo più comune di carcinoma ben differenziato originato dall epitelio follicolare della tiroide ed è anch esso caratterizzato da un fenotipo indolente (Nikiforov, 2009). I carcinomi poco differenziati e i carcinomi anaplastici sono invece molto aggressivi e possono insorgere de novo o da preesistenti carcinomi follicolari o papillari (Kondo et al, 2006). Importanti fattori sia da un punto di vista prognostico sia da quello decisionale terapeutico risultano essere: l età alla diagnosi, il tipo istologico e l estensione della neoplasia. Tale estensione è definita dal sistema di stadiazione TNM che classifica il tumore in base alle dimensioni e al grado di infiltrazione (T), all implicazione dei linfonodi (N) e alla presenza di metastasi a distanza (M). I noduli tiroidei sono molto frequenti nella popolazione adulta con una frequenza negli USA del 4 7%, ma solo una minima percentuale di questi noduli (5 10%) risulta essere maligna (Romei et al, 8

9 2012). Poiché la maggioranza dei noduli tiroidei sono benigni e poiché la maggior parte dei tumori tiroidei sono curabili con tecniche chirurgiche se identificati precocemente, è molto importante distinguere tra i noduli benigni e maligni in modo tale che il paziente possa ricevere un trattamento appropriato, minimizzando il rischio di interventi non necessari. Attualmente la citologia su aspirazione bioptica con ago sottile (FNA), sotto controllo ecografico, è il metodo di indagine preoperatorio più diffuso che permette di diagnosticare accuratamente la maggior parte delle lesioni benigne o maligne, indirizzando quindi le decisioni terapeutiche o i follow up. In generale nel 15% dei casi si ottiene un campione non diagnostico e in circa il 20% dei casi i campioni sono classificati nella categoria diagnostica di proliferazione follicolare di significato indeterminato per malignità (TIR3). In questa categoria, solo il 20% dei casi risultano poi essere carcinomi all esame istologico, eseguito dopo emitiroidectomia diagnostica (Nelva et al, 2011). Il trattamento d elezione per il carcinoma differenziato della tiroide prevede l asportazione totale della tiroide. Tale trattamento viene completato somministrando radio iodio a scopo ablativo di eventuali residui tiroidei e successiva terapia ormonale sostitutiva a vita con L tiroxina (LT4) con lo scopo di correggere l ipotiroidismo indotto e di sopprimere i livelli ematici di TSH di secrezione ipofisaria. 3.2 Alterazioni molecolari del carcinoma tiroideo Numerose alterazioni genetiche sono coinvolte nello sviluppo del tumore tiroideo derivante dall epitelio follicolare. Tali alterazioni sono rappresentate prevalentemente da mutazioni puntiformi e traslocazioni che portano all attivazione oncogenica di importanti vie di trasduzione del segnale, in particolare la via delle MAPK (Mitogen Activated Protein Kinase) che regola processi chiave della proliferazione, differenziamento e apoptosi cellulare, tramite l attivazione costitutiva di oncogeni come RET, NTRK 1, MET, BRAF e KRAS o il silenziamento di oncosoppressori come p53, PPARγ e PTEN. Alcune di queste alterazioni genetiche sono specifiche di alcuni tipi di carcinoma tiroideo (Tabella 1) e possono essere utilizzate come importante strumento per migliorare la diagnosi delle neoplasie tiroidee (Hunt et al, 2002). Quattro tipi di alterazioni genetiche costituiscono la maggioranza delle mutazioni che incorrono nei tumori papillari e follicolari e costituiscono importanti marcatori diagnostici e prognostici. Le più frequenti alterazioni nei PTC sono rappresentate da mutazioni puntiformi nei geni BRAF e RAS (riscontrate nel 40% e nel 10% dei casi rispettivamente) e riarrangiamenti RET/PTC (riscontrati nel 10 20% dei casi), e quelli che contengono il gene TRK (meno del 5% dei casi). Nel complesso, queste 9

10 alterazioni identificano il 70% dei PTC e sono generalmente mutuamente esclusive. Le più frequenti alterazioni che incorrono negli FTC sono rappresentate invece da mutazioni di RAS (nel 45% dei casi) e da riarrangiamenti PAX/PPAγ (nel 35% dei casi) che sono anch esse mutuamente esclusive. Mutazioni di RAS e in un minor misura traslocazioni PAX8/PPARγ sono riscontrate anche negli adenomi follicolari con frequenze del 20 40% e del 2 13%, rispettivamente. Diversi studi hanno mostrato che la valutazione preoperatoria di questi marcatori può migliorare l accuratezza della diagnosi citologica fatta su FNA per pazienti con diagnosi di significato indeterminato o con sospetto di malignità per identificare le lesioni maligne e aiutare quindi nella scelta terapeutica (Nikiforov, 2011). Tabella 1: alterazioni molecolari del carcinoma tiroideo (tratta da Nikiforov, 2011) Carcinoma papillare della tiroide Prevalenza (%) Mutazione BRAF Traslocazione RET/PTC Mutazione RAS Traslocazione TRK <5 Carcinoma follicolare della tiroide Prevalenza (%) Mutazione RAS Traslocazione PAX8/PPARy Alterazioni molecolari del carcinoma papillare La mutazione del gene BRAF L alterazione più comune dei PTC è la mutazione del gene BRAF (presente nel 40 45% dei casi). BRAF è una proteina serin treonina chinasi che appartiene alla famiglia delle proteine RAF, effettori intracellulari della cascata delle MAPK. Le mutazioni principali di BRAF nel PTC sono mutazioni puntiformi che coinvolgono il nucleotide 1799 e che portano alla sostituzione di una valina con un acido glutammico al codone 600 (V600E). Tale mutazione comporta la costitutiva attivazione della chinasi BRAF con conseguente attivazione cronica della via metabolica delle MAPK e successiva deregolazione della crescita e della proliferazione cellulare. La mutazione V600E di BRAF è tipica del PTC con istologia classica e della variante a cellule alte, mentre è rara nella variante follicolare. Le mutazioni di BRAF non sono state trovate nei FTC e nei noduli tiroidei benigni e, rappresentano pertanto un marcatore specifico del PTC e, quindi, un utile supporto per 10

11 migliorare l accuratezza della diagnosi citologica dei noduli tiroidei (Nikiforov, 2011). Diversi studi indicano che le mutazioni di BRAF si associano ad una maggiore aggressività del tumore in termini di invasione, stadio clinico e rischio di ripresa dalla malattia (Xing et al, 2005). Inoltre tali mutazioni sono associate alla perdita della capacità di captare lo iodio 131 e quindi ad una scarsa risposta terapeutica. Per questi motivi la valutazione preoperatoria dello stato mutazionale di BRAF rappresenterebbe un utile parametro per la scelta di un miglior approccio chirurgico e terapeutico La traslocazione RET/PTC Il proto oncogene RET codifica per un recettore tirosin chinasico (RTK) di membrana coinvolto nel controllo della differenziazione cellulare e della proliferazione. Normalmente il gene RET è espresso nelle cellule parafollicolari o cellule C, ma non nelle cellule follicolari dove, invece, può essere attivato solo in caso di presenza di un riarrangiamento del gene RET. Il recettore RET è una proteina transmembrana che presenta una porzione extracellulare formata da quattro domini simili alle caderine (cadherin like) e una parte intracellulare che presenta dei domini ricchi in tirosina (Figura 1). In presenza di specifici ligandi quali neururina, artimina, persepina e i fattori di derivazione dalle cellule gliali, il recettore RET, presente nella membrana cellulare sotto forma di monomero, dimerizza con un altro recettore. Tale dimerizzazione porta all attivazione del recettore tramite un processo di autofosforilazione dei domini tirosinchinasici (TK) e quindi all attivazione delle cascate metaboliche a valle (MAPK e via di PI3K AKT). Tali cascate intracellulari sevono a propagare i segnali del recettore RET di membrana all interno del nucleo attraverso una serie di proteine adattatore e chinasi intracitoplasmatiche (tra le quali RAS e BRAF) che portano alla regolazione della trascrizione di geni coinvolti nella differenziazione, nella proliferazione e nella sopravvienza cellulare (Figura 2). Nel PTC l attivazione di questa via metabolica è causata principalmente da mutazioni puntiformi di RAS e BRAF o da riarrangiamenti RET/PTC e tale attivazione costitutiva risulta essere responsabile dell insorgenza e della progressione tumorale (Nikiforov, 2011). 11

12 Figura 1: struttura del recettore RET formato da un dominio extracellulare N terminale, di legame con il ligando, da un dominio trans membrana, e da un dominio intracellulare C terminale dove sono presenti residui di tirosina (domini tirosin chinasici). Figura 2: cascate metaboliche intracellulari attivate dal recettore RET. 12

13 I riarrangiamenti a carico del gene RET (RET/PTC), rappresentano la seconda alterazione più comune nei PTC. Tali riarrangiamenti sono presenti in circa il 35% dei casi di PTC sebbene la percentuale sia variabile tra il 3 e l 85% a seconda degli studi, in funzione dell area geografica di provenienza dei tumori, delle differenti metodologie di analisi utilizzate e dell eterogeneità tumorale. La distribuzione del riarrangiamento RET/PTC all interno di un tumore può essere infatti eterogenea e può essere presente o nella maggior parte delle cellule neoplastiche (riarrangiamento RET/PTC di tipo clonale), oppure in una piccola frazione di cellule tumorali (riarrangiamento RET/PTC di tipo non clonale) (Santoro et al, 2006). Questo aspetto è da tenere in considerazione per le scelte delle differenti metodologie di analisi utilizzate: l analisi di questa traslocazione può infatti essere effettuata sia con RT PCR (Reverse Transcription Polimerase Chain Reaction), tecnica migliore per tessuti freschi o congelati con una sensibilità che non dovrebbe essere maggiore all 1% per evitare di rilevare mutazioni non clonali e quindi senza rilevanza clinica, oppure mediante FISH, tecnica più performante in caso di tessuti FFPE ma la cui valutazione richiede la determinazione di livelli di cut off corretti affinché non si incorra in risultati falsi positivi (Nikiforov, 2011). I riarrangiamenti clonali sono descritti in circa il 20% dei PTC mentre i riarrangiamenti non clonali sono stati identificati non solo nei PTC, ma anche nel 10 45% degli adenomi tiroidei e altre lesioni non neoplastiche (Santoro et al, 2006). I riarrangiamenti RET/PTC risultano essere più frequenti nei pazienti esposti a radiazioni (50 80%) e nei carcinomi papillari dei bambini o adolescenti (40% 70%) (Nikiforov, 2011). Tali riarrangiamenti sono specifici delle lesioni papillari maligne e generalmente non sono riscontrati (se non con metodologie di analisi molto sensibili) negli adenomi e nelle lesioni benigne. I riarrangiamenti RET/PTC portano alla formazione di oncogeni chimerici che risultano dalla fusione tra la porzione 3 del gene RET e la porzione 5 di geni eterologhi ubiquitariamente espressi e caratterizzati dalla presenza di sequenze nucleotidiche codificanti per proteine che formeranno domini coiled coil che permettono la dimerizzazione costitutiva del dominio tirosin chinasico di RET. Le proteine di fusione contengono il dominio tirosin chinasico del recettore RET intatto e risultano costitutivamente attivate portando quindi all attivazione costitutiva della cascata delle MAPK. Tale processo determina una proliferazione incontrollata delle cellule follicolari caratterizzate dalla presenza del riarrangiamento RET/PTC e quindi allo sviluppo successivo del tumore. Sono state descritte più di 11 varianti, ma i due tipi di riarrangiamento più frequenti sono RET/PTC1 (nel 60 70% dei casi) e RET/PTC3 (nel 20 30% dei casi). RET/PTC1 è formato dalla fusione del gene RET con il gene CCDC6 (H4) e RET/PTC3 dalla fusione del gene RET con il gene NCOA4 (ELE1). Entrambe le traslocazioni 13

14 sono inversioni paracentriche poiché sia il gene RET che i geni CCDC6 ed NCOA4 si trovano sul braccio lungo del cromosoma 10 (Nikiforov, 2003). RET/PTC1 si trova con maggiore frequenza nei tumori sporadici e nelle varianti classiche del PTC, ma può essere anche trovato nei microcarcinomi papillari, mentre RET/PTC3 è maggiormente presente nei carcinomi papillari indotti da radiazioni e nelle varianti solide dei PTC (Santoro et al, 2006). La correlazione tra la presenza delle traslocazioni RET/PTC e la prognosi non sono attualmente chiarite; vi sono evidenze che indicano un associazione tra la presenza di un riarrangiamento RET/PTC1 a un decorso più favorevole della malattia, rispetto ai pazienti con presenza di traslocazione RET/PTC3, associata ad un comportamento clinico più aggressivo. Altri studi hanno suggerito che i casi positivi per la presenza di un riarrangiamento RET/PTC sembrano mostrare un estensione più ampia della malattia e un tasso di coinvolgimento linfonodale maggiore rispetto ai casi negativi per le traslocazioni. Tuttavia altri studi hanno confutato tali considerazioni (Romei et al, 2012). Dal punto di vista diagnostico lo studio della traslocazione RET/PTC ha poco significato nel caso in cui vi sia un prelievo istologico, perché i tumori caratterizzati dalla traslocazione RET/PTC normalmente hanno un architettura di tipo papillare, che non crea grosse difficoltà diagnostiche. Al contrario tale analisi potrebbe risultare particolarmente utile nelle diagnosi preoperatorie effettuate mediante FNA dove sovente si hanno difficoltà a livello diagnostico soprattutto nei casi che hanno una citologia di significato indeterminato (TIR3) (Nikiforov, 2011). 14

15 4. Scopo del lavoro Negli ultimi anni l acquisizione di conoscenze sempre più approfondite e specifiche riguardanti le alterazioni genetiche proprie delle neoplasie tiroidee ha aperto la possibilità di applicare metodiche molecolari per l analisi di tali deregolazioni alla diagnostica citologica delle patologie tiroidee. Le principali alterazioni molecolari specifiche dei carcinomi tiroidei sono i riarrangiamenti PAX8/PPARγ e mutazioni RAS per i carcinomi follicolari, e riarrangiamenti RET e mutazioni BRAF per i carcinomi papillari. Nel Laboratorio di Patologia Molecolare dell ICP di Locarno sono già in uso diagnostico le analisi di PAX8/PPARG, RAS e di BRAF per coadiuvare l analisi citologica dei tumori tiroidei. L obiettivo del mio lavoro sarà quello di mettere a punto l analisi delle traslocazioni RET/PTC con lo scopo di completare il pannello delle principali analisi molecolari per la diagnostica del tumore tiroideo. 15

16 5. Pazienti, materiali e metodi 5.1 Pazienti Per la validazione dell analisi di traslocazione RET/PTC sono stati analizzati 17 pazienti affetti da PTC con diagnosi istologica effettuata presso l ICP di Locarno tra il 2010 e il I tessuti di ogni paziente, fissati in formalina ed inclusi in paraffina (FFPE) sono disponibili presso gli archivi dell ICP. Per ogni paziente l analisi della traslocazione RET/PTC è stata effettuata sia su tessuto tumorale sia sul tessuto normale della tiroide. Sul tessuto tumorale è stata effettuata inoltre l analisi dello stato mutazionale del gene BRAF, per ottenere un quadro completo delle alterazioni molecolari più frequenti nel PTC. 5.2 Materiali e metodi Per eseguire le metodiche descritte nel presente lavoro di diploma, è stato necessario lavorare in sterilità e nelle migliori condizioni che evitassero il più possibile le contaminazioni: i banconi di lavoro, le pipette e gli strumenti utilizzati sono stati puliti con ipoclorito di sodio per le lavorazioni con acidi nucleici (DNA e RNA) e con RNAsi Zap (Invitrogen) per le lavorazioni con RNA, i guanti sono stati cambiati ad ogni passaggio e la fase di estrazione degli acidi nucleici è stata effettuata sotto cappa chimica precedentemente irradiata con raggi UV Estrazione degli acidi nucleici Il DNA e l RNA sono stati estratti da tessuti FFPE dopo la valutazione delle sezioni istologiche, colorate mediante ematossilina eosina, da un medico patologo. Per l analisi RET/PTC l RNA è stato estratto sia da tessuto tumorale sia da tessuto sano. L analisi dello stato mutazionale di BRAF è stata effettuata solo su DNA genomico estratto da tessuto tumorale. Per l estrazione di DNA e RNA da tessuto tumorale, nei casi in cui l area di tumore selezionato fosse composta da più del 70% di cellule tumorali, sono state poste 6 7 sezioni istologiche da 7 µm (per il DNA) o 2 4 sezioni da 10 µm (per l RNA) in provette Eppendorf da 2ml. Per i tessuti in cui la quantità di cellule tumorali era inferiore al 70% è stata effettuata una macrodissezione: l area selezionata dal patologo è stata prelevata con bisturi monouso da sezioni in bianco su vetrino (dello stesso spessore delle sezioni poste in provetta) e posta in provette Eppendorf da 2 ml. Per l analisi del tessuto sano sono stati scelti reperi comprendenti il 100% di cellule sane. Per l estrazione del DNA e dell RNA da FFPE 16

17 sono stati usati kit commerciali: il QIAmp DNA MiniKIT e l RNAeasi MiniKit (Qiagen, Chatsworth, CA, USA) in cui sono presenti reagenti e materiali necessari per l estrazione. I protocolli prevedono una fase di lisi cellulare che permetta il rilascio degli acidi nucleici e una purificazione degli acidi nucleici tramite l assorbimento su una membrana di silice della colonnina presente nei kit. In seguito è prevista una fase di eluizione in cui gli acidi nucleici vengono rilasciati dalla membrana nel tampone di eluizione o in acqua DNAasi e RNAasi free. I procedimenti sono descritti dettagliatamente negli allegati 11.1 e Quantificazione degli acidi nucleici estratti dai tessuti La quantificazione degli acidi nucleici è stata effettuata tramite uno spettrometro UV visibile Nanodrop 1000 (Witec, Littau, CH) che stabilisce la concentrazione di acidi nucleici misurando l assorbanza dei campioni in volumi di 2 µl. Il procedimento è descritto in dettaglio nell allegato Amplificazione del DNA genomico tramite PCR Il DNA genomico estratto è stato amplificato tramite reazione di PCR (Polymerase Chain Reaction), reazione che permette l amplificazione in vitro degli acidi nucleici. La reazione di PCR inizia con una denaturazione di 10 minuti a 95 C, in seguito alla quale vengono ripetuti tre passaggi per volte con tempi e temperature definite. Questi passaggi sono la denaturazione (92 98 C) che permette di separare le due catene complementari di DNA, l Ibridazione (40 60 C), passaggio in cui i primers si legano a specifiche sequenze complementari del DNA stampo e la cui temperatura è determinata sperimentalmente, e l estensione (70 72 C), passaggio in cui la DNA polimerasi sintetizza il nuovo filamento di DNA. La reazione avviene all interno di termociclatori, strumenti che mantengono i campioni in incubazione, variando le temperature a seconda dell impostazione del protocollo. 50 ng di DNA (2 µl di una diluizione a 25 ng/µl) vengono aliquotati in provette da 0,2 ml, aggiungendo un controllo positivo, che consiste in un campione di DNA già amplificato precedentemente con successo, e un controllo bianco, cioè acqua sterile, privo di DNA, per valutare la presenza di contaminazioni. A questi verranno aggiunti 23 µl di una miscela di reazione, la cui costituzione è descritta nell allegato

18 5.2.4 Analisi dello stato mutazionale del gene BRAF L analisi dello stato genico dell esone 15 di BRAF è stata eseguita mediante PCR e sequenziamento diretto seguendo i protocolli già in uso presso l ICP per l attività diagnostica. Per l analisi dello stato mutazionale del gene BRAF è stata amplificata, tramite primers specifici, una regione dell esone 15 comprendente il codone 600, codone in cui avvengono la quasi totalità delle mutazioni oncogeniche del gene BRAF. Per l analisi dell esone 15 del gene BRAF è stato utilizzato il seguente protocollo (tabelle 2 e 3) con la seguente coppia di primers, con la relativa temperatura di ibridazione e lunghezza dell amplificato: Primer BRAF esone 15 Forward: 5 TCATAATGCTTGCTCTGATAGGA 3 Primer BRAF esone 15 Reverse: 5 GGCCAAAAATTTAATCAGTGGA 3 Temperatura di annealing: 52 C Dimensione dell amplificato: 250 bp Tabella 2: composizione della miscela di reazione per la reazione di PCR dell esone 15 del gene BRAF Concentrazione iniziale Conc./quantità finale Volume/campione DNA 25,0 ng/µl 50 ng 2,0 µl PCR Buffer 10X 1X 2,5 µl MgCl2 25 mm 3 mm 3,0 µl dntps 10 mm 0,2 mm 0,5 µl dutp 10 mm 0,04 mm 0,1 µl Primer BRAF Fw 10 µm 0,5 µm 1,25 µl Primer BRAF Rw 10 µm 0,5 µm 1,25 µl Taq Gold 5 U/µM 2, U/campione 0,4 µl Acqua sterile 14 µl 18

19 Tabella 3: protocollo di amplificazione dell esone 15 del gene BRAF Temperature Tempo di reazione Stabilizzazione reazione 50 C 2 Denaturazione iniziale 95 C 10 Denaturazione 95 C 15 Ibridazione 52 C cicli Estensione 72 C 30 Estensione finale 72 C 3 Fine PCR 10 C Elettroforesi su gel di agarosio Al fine di verificare l ottenimento di un buon prodotto di amplificazione per tutti i campioni analizzati si è ricorso alla corsa su gel di agarosio. Si tratta di un metodo che permette di separare le molecole di DNA in base alle loro dimensioni: molecole piccole infatti migrano più velocemente rispetto a quelle grandi. La tecnica sfrutta la carica elettrica negativa del DNA per permettere la sua migrazione in un campo elettrico, verso il polo positivo. La migrazione avviene attraverso un gel di agarosio che funge da setaccio molecolare, rallentando la corsa delle molecole. La concentrazione del gel può variare a seconda delle necessità: se le molecole da separare hanno dimensioni poco diverse l una dall altra, occorrerà avere maglie più strette e perciò la concentrazione del gel dovrà essere maggiore. Se, come nel nostro caso, i prodotti di amplificazione sono di dimensioni di circa bp, è sufficiente utilizzare un gel all 1,8%. La dimensione degli amplificati ottenuti è stata poi valutata grazie ad un marker, una miscela di frammenti di DNA a lunghezza nota che viene fatta correre nello stesso gel. I procedimenti di preparazione del gel di agarosio, della corsa elettroforetica e di visualizzazione dei risultati sono descritti in dettaglio nell allegato Purificazione del DNA amplificato Prima di procedere alla PCR di sequenza è necessario purificare il DNA amplificato, per eliminare i reagenti in esubero della PCR rimasti in soluzione (primers, nucleotidi non incorporati e la Taq Polimerasi), che potrebbero compromettere il corretto sequenziamento del DNA. Per questo scopo è stato usato il kit MSB SPIN PCRapace (STRATEC Molecular, Gmbh, Berlino, Germania), che 19

20 contiene colonne con un filtro che trattiene il DNA, mentre i contaminanti vengono eliminati tramite un lavaggio. In seguito il DNA viene eluito con un buffer in una provetta Eppendorf da 1,5 ml. Il procedimento di purificazione è descritto in dettaglio nell allegato PCR di sequenza (cyclesequencing) I filamenti del prodotto amplificato, a seguito della purificazione, vengono marcati e amplificati nella reazione di sequenziamento (cyclesequencing). Si tratta di una particolare PCR effettuata in presenza di un solo primer (forward o reverse), dei quattro dntps e di quattro dideossinucleotidi trifosfati (ddntps) marcati con quattro fluorocromi differenti che fungono da terminatori della reazione. La reazione avviene normalmente, ma in alcune catene vengono introdotti casualmente i ddntps che bloccano la reazione siccome sono privi del gruppo ossidrile ( OH) all estremità 3 che permetterebbe l incorporamento di ulteriori nucleotidi. Ciò permette la formazione di frammenti di lunghezze diverse, marcate a seconda del nucleotide che blocca la reazione. Questi frammenti verranno rilevati grazie ad un raggio laser di un sequenziatore automatico e interpretati da un programma apposito. Il dettaglio è descritto nell allegato Purificazione del DNA dopo PCR di sequenza Prima di poter sequenziare i frammenti ottenuti mediante la PCR di sequenza è necessario eliminare i dntps, i ddntps e i primers che non sono stati incorporati nella reazione. Per tale scopo viene usato il kit G50 Dye Terminator Removal kit (RBC Bioscience) che fornisce delle colonne contenenti sfere di gel pre idratate. Il principio è quello della cromatografia per gelfiltrazione, dove i contaminanti vengono separati dal DNA sfruttando il differente peso molecolare e le differenti dimensioni. Il DNA attraversa velocemente il gel e viene recuperato all interno di una eppendorf di 1,5 ml. Il procedimento è scritto in dettaglio nell allegato Il sequenziamento Il sequenziamento avviene in uno strumento in grado di effettuare l elettroforesi capillare, dotato da un raggio laser (3130 Genetic Analyzer, Applied Biosystems). Esso è in grado di separare due frammenti di DNA che differiscono solo di 1 bp distinguendoli grazie ai fluorocromi marcati. Per ottenere le sequenze dell amplificato del gene d interesse, i pellet ottenuti a seguito della seconda purificazione sono stati risospesi in 15 µl di formammide (Hi Di Formammide, Applied Biosystems) 20

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

La biopsia del linfonodo sentinella nel carcinoma. Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it

La biopsia del linfonodo sentinella nel carcinoma. Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it La biopsia del linfonodo sentinella nel carcinoma duttale in situ: : si,no, forse Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it Definizione Il carcinoma duttale in situ della mammella è una

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona CIN 2 3: CHE FARE? P Cattani Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona Istologia: diagnosi e gradi della CIN biopsia cervicale o escissione maturazione cell stratificazione cell anormalità

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Vitamina D, PTH ed omeostasi del calcio

Vitamina D, PTH ed omeostasi del calcio Vitamina D, PTH ed omeostasi del calcio Funzioni principali della vit D Stimolazione dell'assorbimento del calcio e del fosforo a livello intestinale; Regolazione, in sinergia con l'ormone paratiroideo,

Dettagli

Deceduti Regione LOMBARDIA

Deceduti Regione LOMBARDIA Tumore della vescica Di maggior rilievo nei maschi (più di 3/4 dei casi), presenta variazioni geografiche di entità modestissima, minori di ogni altro tipo di carcinoma. Il 9-95% circa è costituito da

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

I linfomi non-hodgkin

I linfomi non-hodgkin LINFOMA NON HODGKIN I linfomi non-hodgkin (LNH) sono un eterogeneo gruppo di malattie neoplastiche che tendono a riprodurre le caratteristiche morfologiche e immunofenotipiche di una o più tappe dei processi

Dettagli

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

SILVIA SAVASTANO ANNA MARIA COLAO. Che cosa è la tiroide?

SILVIA SAVASTANO ANNA MARIA COLAO. Che cosa è la tiroide? SILVIA SAVASTANO ANNA MARIA COLAO CAPITOLO 7 LA TIROIDE CHE SI AMMALA DI PIÙ È FEMMINILE 147 Che cosa è la tiroide? La tiroide è una ghiandola endocrina posta alla base del collo. Secerne due tipi di ormoni,

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

SISTEMA ROBOTICO DA VINCI

SISTEMA ROBOTICO DA VINCI SISTEMA ROBOTICO DA VINCI Dalla Laparoscopia urologica alla Chirurgia robotica. S I S T E M A R O B O T I C O D A V I N C I CHE COSA BISOGNA SAPERE SUL SISTEMA ROBOTICO DA VINCI: 1 IL VANTAGGIO PRINCIPALE

Dettagli

LA REFERTAZIONE DELLA PET-TC ONCOLOGICA con 18F-FDG: istruzioni pratiche per un referto standardizzato e di qualità

LA REFERTAZIONE DELLA PET-TC ONCOLOGICA con 18F-FDG: istruzioni pratiche per un referto standardizzato e di qualità LA REFERTAZIONE DELLA PET-TC ONCOLOGICA con 18F-FDG: istruzioni pratiche per un referto standardizzato e di qualità Maria Lucia Calcagni, Paola Castaldi, Alessandro Giordano Università Cattolica del S.

Dettagli

L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE.

L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE. L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE. C. Sintoni C. Galli Servizio di Anatomia Patologica - Presidio Ospedaliero S. M. delle Croci - Ravenna Attualmente nel nostro

Dettagli

REaD REtina and Diabetes

REaD REtina and Diabetes Progetto ECM di formazione scientifico-pratico sulla retinopatia diabetica REaD REtina and Diabetes S.p.A. Via G. Spadolini 7 Iscrizione al Registro delle 20141 Milano - Italia Imprese di Milano n. 2000629

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

CROMATOGRAFIA SU COLONNA

CROMATOGRAFIA SU COLONNA 1 CROMATOGRAFIA SU COLONNA La cromatografia è una tecnica di migrazione differenziata che permette la separazione dei costituenti di una miscela di sostanze affini. La cromatografia può essere di tipo

Dettagli

I TUMORI COLORETTALI GIOVANILI ( 40 ANNI) IN 25 ANNI DI UN REGISTRO SPECIALIZZATO

I TUMORI COLORETTALI GIOVANILI ( 40 ANNI) IN 25 ANNI DI UN REGISTRO SPECIALIZZATO Università degli studi di Modena e Reggio Emilia I TUMORI COLORETTALI GIOVANILI ( 40 ANNI) IN 25 ANNI DI UN REGISTRO SPECIALIZZATO Domati F., Maffei S., Kaleci S., Di Gregorio C., Pedroni M., Roncucci

Dettagli

E SE MI CHIAMANO... DOPO IL PAP TEST?

E SE MI CHIAMANO... DOPO IL PAP TEST? E SE MI CHIAMANO... DOPO IL PAP TEST? Informazioni sui percorsi di approfondimento diagnostico e di cura PROGRAMMA REGIONALE PER LA PREVENZIONE DEI TUMORI FEMMINILI Coordinamento editoriale e di redazione:

Dettagli

LE DOMANDE POSSIBILI PER LO SCREENING MAMMOGRAFICO VADEMECUM PER GLI OPERATORI DI SCREENING DELLA ASL RMC

LE DOMANDE POSSIBILI PER LO SCREENING MAMMOGRAFICO VADEMECUM PER GLI OPERATORI DI SCREENING DELLA ASL RMC LE DOMANDE POSSIBILI PER LO SCREENING MAMMOGRAFICO VADEMECUM PER GLI OPERATORI DI SCREENING DELLA ASL RMC (*risponde l infermiera / l ostetrica/ il medico) AGGIORNATO A Maggio 2009 1 CHE COSA E UN PROGRAMMA

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Cosa dovrebbero sapere i genitori sulla sicurezza delle radiazioni per uso medico

Cosa dovrebbero sapere i genitori sulla sicurezza delle radiazioni per uso medico Cosa dovrebbero sapere i genitori sulla sicurezza delle radiazioni per uso medico Gli esami radiologici consentono ai medici di effettuare la diagnosi e decidere il corretto iter terapeutico dei loro pazienti.

Dettagli

La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di

La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di La base di partenza per la maggior parte dei processi produttivi di materiali ceramici sono le sospensioni. Queste si ottengono dalla miscelazione di un solido (polvere) che diverrà il ceramico, con un

Dettagli

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott.

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott. C. I. D. I. M. U. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI Resp. Dott. Antonio Vercelli OSTEOPOROSI *Come prevenirla* *Come curarla* *Consigli pratici* *Cos è l osteoporosi?* L osteoporosi

Dettagli

TUMORI DELLA MAMMELLA

TUMORI DELLA MAMMELLA TUMORI DELLA MAMMELLA INFORMAZIONI GENERALI La mammella Struttura e funzione della mammella La mammella è costituita da grasso (tessuto adiposo), tessuto connettivo e tessuto ghiandolare. Quest'ultimo

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Lo screening cervicale.

Lo screening cervicale. Lo screening cervicale. Per migliorare il grado di informazione dei pazienti su alcuni importanti argomenti (quali ad esempio le terapie svolte, l alimentazione da seguire e gli esercizi di riabilitazione)

Dettagli

VADEMECUM PER MISURA DELLA VITAMINA D (25-idrossivitamina D e 1,25-diidrossivitamina D)

VADEMECUM PER MISURA DELLA VITAMINA D (25-idrossivitamina D e 1,25-diidrossivitamina D) DAI Diagnostica di Laboratorio - Laboratorio Generale - Direttore Dr. Gianni Messeri Gentile Collega, negli ultimi anni abbiamo assistito ad un incremento delle richieste di dosaggio di vitamina D (25-

Dettagli

L EQUILIBRIO CHIMICO

L EQUILIBRIO CHIMICO EQUIIBRIO CHIMICO Molte reazioni chimiche possono avvenire in entrambe i sensi: reagenti e prodotti possono cioè scambiarsi fra di loro; le reazioni di questo tipo vengono qualificate come reazioni reversibili.

Dettagli

La programmazione di uno studio clinico: dalla domanda al disegno

La programmazione di uno studio clinico: dalla domanda al disegno Metodo epidemiologici per la clinica _efficacia / 1 La programmazione di uno studio clinico: dalla domanda al disegno La buona ricerca clinica Non è etico ciò che non è rilevante scientificamente Non è

Dettagli

Conduzione di uno studio epidemiologico (osservazionale)

Conduzione di uno studio epidemiologico (osservazionale) Conduzione di uno studio epidemiologico (osservazionale) 1. Definisco l obiettivo e la relazione epidemiologica che voglio studiare 2. Definisco la base dello studio in modo che vi sia massimo contrasto

Dettagli

Samuele Di Rita - Classe 2 B sa - 16/03/2015 - Gruppo 5: Di Rita, Dal Maso

Samuele Di Rita - Classe 2 B sa - 16/03/2015 - Gruppo 5: Di Rita, Dal Maso Samuele Di Rita - Classe 2 B sa - 16/03/2015 - Gruppo 5: Di Rita, Dal Maso SAGGI ANALITICI SU ALIMENTI CONTENENTI CARBOIDRATI OBIETTIVI Fase 1: Dimostrare, mediante l uso del distillato di Fehling, se

Dettagli

Aptima HIV-1 Quant Dx Assay

Aptima HIV-1 Quant Dx Assay Aptima Aptima HIV-1 Quant Dx Assay Per uso diagnostico in vitro. Solo per l esportazione dagli USA. Informazioni generali................................................ 2 Utilizzo previsto................................................................

Dettagli

La richiesta di materiale biologico da struttura a struttura: «second opinion»

La richiesta di materiale biologico da struttura a struttura: «second opinion» A.O. S.Antonio Abate, Gallarate Segreteria Scientifica dr. Filippo Crivelli U.O. di Anatomia Patologica Corso di Aggiornamento per Tecnici di Laboratorio di Anatomia Patologica AGGIORNAMENTI 2011 I edizione:

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

dell epidermide. Compare soprattutto tra i 30 e i 60 anni, con una leggera prevalenza nelle donne, dove è spesso localizzato agli arti inferiori,

dell epidermide. Compare soprattutto tra i 30 e i 60 anni, con una leggera prevalenza nelle donne, dove è spesso localizzato agli arti inferiori, melanoma Il melanoma è il tumore che nasce dai melanociti, cellule responsabili della colorazione della pelle e che si trovano nello strato più profondo 2 dell epidermide. Compare soprattutto tra i 30

Dettagli

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine VITAMINA D: SINTESI, METABOLISMO E CARENZA Il 40-50% della

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Altre informazioni sul virus HPV: informazioni approfondite per le utenti

Altre informazioni sul virus HPV: informazioni approfondite per le utenti Altre informazioni sul virus HPV: informazioni approfondite per le utenti Questo è un documento di approfondimento sull HPV. Prima di leggerlo consultate il documento Alcune informazioni sul virus HPV

Dettagli

TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA

TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA CENTRIFUGAZIONE La centrifugazione è un processo che permette di separare una fase solida immiscibile da una fase liquida o due liquidi

Dettagli

Fonti alimentari di Inositolo

Fonti alimentari di Inositolo Fonti alimentari di Inositolo Agrumi Cereali integrali Frutta secca(arachidi) Semi(germe di grano) Legumi(fagioli) Lievito di birra Gli alimenti freschi contengono molto più Inositolo rispetto ai prodotti

Dettagli

Sopra ogni aspettativa

Sopra ogni aspettativa Sopra ogni aspettativa Pipette elettroniche Eppendorf Xplorer e Eppendorf Xplorer plus »Un modo intuitivo di lavorare.«chi dà il massimo ogni giorno, merita anche il massimo in termini di strumenti ed

Dettagli

DELIBERAZIONE N. 1017/2015 ADOTTATA IN DATA 25/06/2015 IL DIRETTORE GENERALE

DELIBERAZIONE N. 1017/2015 ADOTTATA IN DATA 25/06/2015 IL DIRETTORE GENERALE DELIBERAZIONE N. 1017/2015 ADOTTATA IN DATA 25/06/2015 OGGETTO: Fornitura in noleggio con somministrazione (durata: cinque anni) di n. 1 sistema per l analisi del linfonodo sentinella modello OSNA integrato

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

Caratterizzazione molecolare dell Anidrasi Carbonica in Trematomus spp.

Caratterizzazione molecolare dell Anidrasi Carbonica in Trematomus spp. UNIVERSITÀ DEGLI STUDI DI PADOVA FACOLTÀ DI SCIENZE MM. FF. NN. Laurea di primo livello in Biologia Curriculum di Biologia Marina Caratterizzazione molecolare dell Anidrasi Carbonica in Trematomus spp.

Dettagli

DIPARTIMENTO TUTELA DELLA SALUTE E POLITICHE SANITARIE Allegato 8.6 8.6. Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica

DIPARTIMENTO TUTELA DELLA SALUTE E POLITICHE SANITARIE Allegato 8.6 8.6. Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica 8.6 Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica 1 Premessa Qualità e sostenibilità economica sono le principali esigenze cui cerca di rispondere la concentrazione delle

Dettagli

Liponax Sol. Innovativa formulazione LIQUIDA. ad elevata biodisponibilità. Acido R (+) a-lipoico

Liponax Sol. Innovativa formulazione LIQUIDA. ad elevata biodisponibilità. Acido R (+) a-lipoico Innovativa formulazione LIQUIDA ad elevata biodisponibilità L acido a lipoico è una sostanza naturale che ricopre un ruolo chiave nel metabolismo energetico cellulare L acido a lipoico mostra un effetto

Dettagli

MODALITA DI VALUTAZIONE DELLA DOSE EFFICACE PER I LAVORATORI ESPOSTI

MODALITA DI VALUTAZIONE DELLA DOSE EFFICACE PER I LAVORATORI ESPOSTI MODALITA DI VALUTAZIONE DELLA DOSE EFFICACE PER I LAVORATORI ESPOSTI Premessa La presente relazione fornisce i criteri e le modalità mediante i quali verranno valutate le dosi efficaci per lavoratori dipendenti,

Dettagli

Analisi termografica su celle litio-ione sottoposte ad esperienze di "second life" Francesco D'Annibale, Francesco Vellucci. Report RdS/PAR2013/191

Analisi termografica su celle litio-ione sottoposte ad esperienze di second life Francesco D'Annibale, Francesco Vellucci. Report RdS/PAR2013/191 Agenzia nazionale per le nuove tecnologie, l energia e lo sviluppo economico sostenibile MINISTERO DELLO SVILUPPO ECONOMICO Analisi termografica su celle litio-ione sottoposte ad esperienze di "second

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Ipertiroidismo. Serie n. 15a

Ipertiroidismo. Serie n. 15a Ipertiroidismo Serie n. 15a Guida per il paziente Livello: medio Ipertiroidismo - Series n. 15a (Revisionato Agosto 2006) Questo opuscolo è stato prodotto dal dott. Fernando Vera, dal Prof. Gary Butler

Dettagli

L identificazione e la denominazione delle sostanze chimiche in ambito REACH

L identificazione e la denominazione delle sostanze chimiche in ambito REACH I DETERGENTI: COME CONIUGARE PRESTAZIONI ELEVATE E RISPETTO PER L AMBIENTE L identificazione e la denominazione delle sostanze chimiche in ambito REACH Resana, 5 ottobre 2007 FEDERICA CECCARELLI Ist. Sup.

Dettagli

TI R OIDIT E P O S T PA RT U M

TI R OIDIT E P O S T PA RT U M TI R OIDIT E P O S T PA RT U M La tiroidite po st partum è una particolare forma di tiroidite autoimmune che si caratterizza per avere una precisa collocazione temporale. Si manifesta, infatti, nelle donne

Dettagli

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza?

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Con ALLIANCE Uvitec di Eppendorf Italia risparmi tempo e materiale di consumo, ottieni immagini quantificabili e ci guadagni anche in salute.

Dettagli

NUOVI STRUMENTI OTTICI PER IL CONTROLLO DI LABORATORIO E DI PROCESSO

NUOVI STRUMENTI OTTICI PER IL CONTROLLO DI LABORATORIO E DI PROCESSO NUOVI STRUMENTI OTTICI PER IL CONTROLLO DI LABORATORIO E DI PROCESSO Mariano Paganelli Expert System Solutions S.r.l. L'Expert System Solutions ha recentemente sviluppato nuove tecniche di laboratorio

Dettagli

Rete Oncologica Piemonte Valle d Aosta

Rete Oncologica Piemonte Valle d Aosta Rete Oncologica Piemonte Valle d Aosta Il CAS (Centro Assistenza Servizi): Aspetti organizzativi e criticità Dott. Vittorio Fusco ASO Alessandria La Rete Oncologica: obiettivi Rispondere all incremento

Dettagli

SERVIZI TRASFUSIONALI REQUISITI MINIMI STRUTTURALI TECNOLOGICI E ORGANIZZATIVI SPECIFICI

SERVIZI TRASFUSIONALI REQUISITI MINIMI STRUTTURALI TECNOLOGICI E ORGANIZZATIVI SPECIFICI Allegato A). Requisiti strutturali, tecnologici e organizzativi minimi per l esercizio delle attività sanitarie dei servizi trasfusionali e delle unità di raccolta del sangue e degli emocomponenti, ai

Dettagli

SINDROME DA RESISTENZA AGLI ORMONI TIROIDEI (THR) o SINDROME DI REFETOFF

SINDROME DA RESISTENZA AGLI ORMONI TIROIDEI (THR) o SINDROME DI REFETOFF SINDROME DA RESISTENZA AGLI ORMONI TIROIDEI (THR) o SINDROME DI REFETOFF Dr. Vincenzo Piazza La Sindrome da resistenza agli ormoni tiroidei,descritta per la prima volta da Refetoff, è una patologia molto

Dettagli

Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic.

Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic. Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic.it è un sistema integrato completo di tutti i moduli per eseguire

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

TRATTAMENTI. Elaborazione piani di trattamento in radioterapia con fasci esterni e 30

TRATTAMENTI. Elaborazione piani di trattamento in radioterapia con fasci esterni e 30 TRATTAMENTI 1 Accesso e custodia C/C DH 2 Accesso e custodia dati pazienti informatizzati 3 Accesso e custodia faldoni cartacei referti 4 Agenda prenotazione esami interni 5 Agenda prenotazione visite

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA Che cos è la degenerazione maculare? La degenerazione maculare è una malattia che interessa la regione centrale della retina (macula), deputata alla visione distinta necessaria per la lettura, la guida

Dettagli

Altre informazioni sul papilloma virus (HPV)

Altre informazioni sul papilloma virus (HPV) Altre informazioni sul papilloma virus (HPV) Questo è un documento di approfondimento sull HPV. Prima di leggerlo guardate le informazioni di base contenute in Alcune informazioni sull esame per il papilloma

Dettagli

25/01/2014. Perché filtrare la luce? Filtri e lenti per patologie oculari. Cosa conoscere? Spettro elettromagnetico. Radiazione elettromagnetica

25/01/2014. Perché filtrare la luce? Filtri e lenti per patologie oculari. Cosa conoscere? Spettro elettromagnetico. Radiazione elettromagnetica Filtri e lenti per patologie oculari FIRENZE 19 GENNAIO 2014 Silvano Abati silvanoabati@tiscali.it Dr. Scuola Internazionale di Ottica Optometria Firenze Stazione di Santa Maria Novella Binario 1 A Perché

Dettagli

Dati della ricerca. Quali i risultati? Jonathan Trobia

Dati della ricerca. Quali i risultati? Jonathan Trobia Dati della ricerca. Quali i risultati? Jonathan Trobia Introduzione I percorsi di Arte Terapia e Pet Therapy, trattati ampiamente negli altri contributi, sono stati oggetto di monitoraggio clinico, allo

Dettagli

PET. Radionuclidi più utilizzati nella PET. Elemento prodotto T 1/2 in minuti primi B5 20 C6 10 N7 2 F 9 O8 110

PET. Radionuclidi più utilizzati nella PET. Elemento prodotto T 1/2 in minuti primi B5 20 C6 10 N7 2 F 9 O8 110 PET L acronimo PET sta per Positron Emission Tomography. Come per la SPECT, anche in questo caso si ha a che fare con una tecnica tomografica d indagine di tipo emissivo in quanto la sorgente di radiazione

Dettagli

SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE

SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE Studio prospettico, non interventistico, di coorte, sul rischio di tromboembolismo venoso (TEV) in pazienti sottoposti a un nuovo trattamento chemioterapico per

Dettagli

La degenerazione maculare correlata all età (DME) è una malattia della retina, nel fondo dell occhio.

La degenerazione maculare correlata all età (DME) è una malattia della retina, nel fondo dell occhio. Che cos è la Degenerazione Maculare correlata all Età (DME)? La degenerazione maculare correlata all età (DME) è una malattia della retina, nel fondo dell occhio. Essa porta a una limitazione o alla perdita

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? 2. Come nasce la sperimentazione clinica e che tipi di studi esistono?

STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? 2. Come nasce la sperimentazione clinica e che tipi di studi esistono? STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? Si definisce sperimentazione clinica, o studio clinico controllato, (in inglese: clinical trial), un esperimento scientifico che genera dati

Dettagli

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO Pag. 1/7 SOMMARIO 1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RIFERIMENTI BIBLIOGRAFICI...2 3. MATERIALE NECESSARIO...3 4. MODALITA OPERATIVE...4 5. REGISTRAZIONE E ARCHIVIAZIONE...7 6. RESPONSABILITA...7

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

INSUFFICIENZA RESPIRATORIA

INSUFFICIENZA RESPIRATORIA INCAPACITA VENTILATORIA (flussi e/o volumi alterati alle PFR) INSUFFICIENZA RESPIRATORIA (compromissione dello scambio gassoso e/o della ventilazione alveolare) Lung failure (ipoossiemia) Pump failure

Dettagli

Lo screening mammografico. La diagnosi precoce del cancro del seno aumenta le possibilità di guarigione

Lo screening mammografico. La diagnosi precoce del cancro del seno aumenta le possibilità di guarigione Lo screening mammografico La diagnosi precoce del cancro del seno aumenta le possibilità di guarigione Indice 03 Gli esperti raccomandano la mammografia nell ambito di un programma di screening 04 Che

Dettagli

SISTEMA DI CHIODI PER ARTRODESI DELLA CAVIGLIA VALOR 141906-2. Le seguenti lingue sono incluse in questa confezione:

SISTEMA DI CHIODI PER ARTRODESI DELLA CAVIGLIA VALOR 141906-2. Le seguenti lingue sono incluse in questa confezione: IT SISTEMA DI CHIODI PER ARTRODESI DELLA CAVIGLIA VALOR 141906-2 Le seguenti lingue sono incluse in questa confezione: English (en) Deutsch (de) Nederlands (nl) Français (fr) Español (es) Italiano (it)

Dettagli

Neoplasie Endocrine Multiple

Neoplasie Endocrine Multiple Neoplasie Endocrine Multiple di tipo 1 e 2 PREFAZIONE Le Neoplasie Endocrine Multiple (MEN) sono delle sindromi rare caratterizzate dalla presenza di iperplasie/neoplasie di numerose ghiandole endocrine

Dettagli

Informazioni ai pazienti per colonoscopia

Informazioni ai pazienti per colonoscopia - 1 - Informazioni ai pazienti per colonoscopia Protocollo informativo consegnato da: Data: Cara paziente, Caro paziente, La preghiamo di leggere attentamente il foglio informativo subito dopo averlo ricevuto.

Dettagli

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale.

Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. Modal 2 Modulo Analisi modale Modulo per l Analisi della dinamica strutturale. L analisi modale è un approccio molto efficace al comportamento dinamico delle strutture, alla verifica di modelli di calcolo

Dettagli

Castrazione e sterilizzazione

Castrazione e sterilizzazione Centro veterinario alla Ressiga Castrazione e sterilizzazione Indicazioni, controindicazioni, effetti collaterali ed alternative Dr. Roberto Mossi, medico veterinario 2 Castrazione e sterilizzazione Castrazione

Dettagli

Catene Leggere Libere nel Siero

Catene Leggere Libere nel Siero Conoscere e capire il dosaggio delle Catene Leggere Libere nel Siero International Myeloma Foundation 12650 Riverside Drive, Suite 206 North Hollywood, CA 91607 USA Telephone: 800-452-CURE (2873) (USA

Dettagli

Informazioni per i pazienti e le famiglie

Informazioni per i pazienti e le famiglie Che cos è l MRSA? (What is MRSA? Italian) Reparto Prevenzione e controllo delle infezioni UHN Informazioni per i pazienti e le famiglie Patient Education Improving Health Through Education L MRSA è un

Dettagli