Messa a punto dell analisi della

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Messa a punto dell analisi della"

Transcript

1 SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro di Diploma di Responsabili AMBRA CATTANI Dott.ssa Francesca Molinari Dott. Milo Frattini 1

2 Sommario 1. Abstract Abbreviazioni Introduzione I tumori tiroidei Alterazioni molecolari del carcinoma tiroideo Alterazioni molecolari del carcinoma papillare La mutazione del gene BRAF La traslocazione RET/PTC Scopo del lavoro Pazienti, materiali e metodi Pazienti Materiali e metodi Estrazione degli acidi nucleici Quantificazione degli acidi nucleici estratti dai tessuti Amplificazione del DNA genomico tramite PCR Analisi dello stato mutazionale del gene BRAF Elettroforesi su gel di agarosio Purificazione del DNA amplificato PCR di sequenza (cyclesequencing) Purificazione del DNA dopo PCR di sequenza Il sequenziamento Retrotrascrizione dell RNA a cdna Messa a punto dell analisi delle traslocazioni RET/PTC tramite metodica di RT PCR Scelta dei primers e PCR a gradiente di temperatura Validazione della metodica di analisi di traslocazione RET/PTC Amplificazione dei geni di controllo PGK1 e PAX Analisi dei prodotti di amplificazione tramite elettroforesi capillare Risultati Messa a punto delle reazioni di PCR per l analisi delle traslocazioni RET/PTC1 e RET/PTC Validazione della metodica per l analisi dei frammenti delle traslocazioni RET/PTC1 e RET/PTC3, tramite RT PCR ed analisi dei frammenti Analisi dello stato mutazionale del gene BRAF

3 7. Discussione Conclusione Bibliografia Ringraziamenti Allegati Estrazione di DNA genomico da tessuti fissati in formalina ed inclusi in paraffina (FFPE) Estrazione RNA da tessuto FFPE Quantificazione degli acidi nucleici Costituzione della miscela di reazione per la PCR Elettroforesi su gel di agarosio Purificazione del DNA amplificato PCR di sequenza (cyclesequencing) Purificazione del DNA dopo PCR di sequenza

4 1. Abstract Introduzione I tumori tiroidei rappresentano il principale tipo di tumore endocrino, con una prevalenza dei tumori papillari (circa l 80%). Il metodo di indagine diagnostica preoperatorio più diffuso e accurato per la valutazione della natura benigna o maligna dei noduli tiroidei è l esame citologico su aspirazione bioptica con ago sottile. Tuttavia, nel 15 20% circa delle analisi citologiche non è possibile giungere a diagnosi certa. In questi casi le analisi delle alterazioni di marcatori molecolari specifici del carcinoma tiroideo possono essere d aiuto nel discriminare i campioni patologici e aiutare nelle scelte terapeutiche. Nei carcinomi papillari tiroidei le alterazioni più frequenti e specifiche di tale tumore sono rappresentate da mutazioni puntiformi del gene BRAF e dalle traslocazioni RET/PTC, ovvero riarrangiamenti del gene RET con geni eterologhi espressi ubiquitariamente. Le due forme più frequenti di riarrangiamento sono RET/PTC1 e RET/PTC3, determinate dalla fusione del gene RET con i geni CCDC6 e NCOA4 rispettivamente. Scopo del lavoro Lo scopo di questo lavoro di diploma è quello di ottimizzare un protocollo di analisi delle traslocazioni RET/PTC tramite RT PCR ed analisi dei frammenti nel Laboratorio di Patologia Molecolare dell Istituto Cantonale di Patologia di Locarno. Materiali e metodi Per la messa a punto del protocollo delle analisi RET/PTC sono stati usati due costrutti plasmidici contenenti le traslocazioni RET/PTC1 e RET/PTC3. I protocolli di PCR, specifici per individuare le traslocazioni RET/PTC1 e RET/PTC3, sono stati messi a punto tramite PCR a gradiente di temperatura e validati su 17 campioni di RNA estratto da tessuti fissati in formalina ed inclusi in paraffina di pazienti affetti da tumore papillare tiroideo. I campioni di RNA analizzati sono stati estratti tramite un kit commerciale e retrotrascritti a cdna tramite protocolli già in uso presso l ICP. I cdna ottenuti sono stati analizzati tramite PCR seguendo il protocollo messo a punto sui costrutti plasmidici e gli amplificati ottenuti sono stati analizzati al sequenziatore. Inoltre, per ottenere un quadro molecolare più completo, è stata valutata la mutazione dell esone 15 del gene BRAF tramite PCR e sequenziamento diretto, partendo da DNA genomico dei pazienti analizzati, seguendo i protocolli già in uso presso l ICP. 4

5 Risultati e conclusione I risultati ottenuti dalle PCR a gradiente di temperatura e dalla successiva analisi dei frammenti effettuati su costrutti plasmidici, si sono rilevati ottimi a tutte le temperature provate, e pertanto è stata stabilita come temperatura di ibridazione la temperatura media del gradiente pari a 57 C. Due campioni di tessuto tumorale su 17 (11,8%), a fronte di nessuno dei tessuti sani, sono risultati positivi per le traslocazioni RET/PTC, risultato concordante con la letteratura. L analisi del gene BRAF ha identificato una mutazione in 10 campioni su 17 (58,8%), una percentuale alta, ma comunque concordante con diversi testi presenti in letteratura. In conclusione si può dire che le metodiche messe a punto sono state validate con successo e possono essere introdotte in diagnosi. Background Thyroid tumors are the main type of endocrine tumor, with a prevalence of papillary tumors (about 80%). The most popular and accurate method of preoperative diagnostic evaluation of benign or malignant thyroid nodules is the cytologic examination of fine needle aspiration biopsy. However, in 15 20% of cytological analysis it is not possible to arrive at a diagnosis. In these cases the analysis of alterations of specific molecular markers of thyroid carcinoma may be helpful in discriminating the pathological samples and help with therapeutic choices. In papillary thyroid carcinomas, the most frequent and specific alterations of this tumor are represented by point mutations of the BRAF gene and RET/PTC translocations, or rearrangements of the RET gene with heterologous genes ubiquitously expressed. The two most frequent forms of rearrangement are RET/PTC1 and RET/PTC3 and determined by a fusion of the RET gene with the genes NCOA4 and CCDC6 respectively. The aim of this study The aim of this diploma work is to optimize a protocol analysis of RET/PTC translocations using RT PCR and fragments analysis in the Molecular Pathology Laboratory of Locarno. Materials and methods For the elaboration of the Protocol of the RET/PTC analysis, two plasmid constructs containing translocations RET/PTC1 and RET/PTC3 were used. PCR Protocols, specific to identifying translocations RET/PTC1 and RET/PTC3, were developed by means of temperature gradient PCR and tested on 17 RNA samples retrieved from formalin fixed paraffin embedded tissue of patients thyroid papillary cancer. The RNA samples analyzed 5

6 were extracted using a commercial kit and retrotranscripted to cdna using protocols already in use at the ICP. The cdna obtained were analyzed by PCR using the Protocol developed on plasmid constructs and the amplified samples obtained were analyzed on the sequencer. In addition, to obtain a more complete molecular framework, genomic DNA of the analyzed patients, was evaluated for the mutation of the Exon 15 of the BRAF gene by PCR and direct sequencing, following the protocols already in use at the ICP. Results and conclusion The results obtained from temperature gradient PCR and subsequent analysis of the fragments performed on plasmid constructs, were found excellent at all temperatures tested, and thus the average temperature gradient of 57 C was established as hybridization temperature. Two samples of tumor tissue in 17 (11.8%), compared with none of the healthy tissues, were positive for translocations RET/PTC, results consistent with the literature. The BRAF gene analysis has identified a mutation in 10 samples out of 17 (58.8%), a high percentage, but still consistent with several texts presented in literature. In conclusion we can say that the methods developed were validated successfully and can be introduced in diagnosis.. 6

7 2. Abbreviazioni bp: ddntps: dntps: FFPE: FTC: Fw: ICP: PCR: PTC: RTK: RT PCR: Rw: Tm: WT: paia di basi dideossinucleotidi trifosfati deossinucleotidi trifosfati tessuti fissati in formalina e inclusi in paraffina tumore follicolare tiroideo forward Istituto Cantonale di Patologia Polymerase Chain Reaction tumore papillare tiroideo recettori tirosin chinasici Reverse Transcription Polimerase Chain Reaction reverse temperature di melting Wild Type 7

8 3. Introduzione 3.1 I tumori tiroidei I carcinomi della tiroide rappresentano la neoplasia più frequente del sistema endocrino e la loro incidenza è in costante crescita negli Stati Uniti e nella maggior parte degli altri paesi (Nikiforov, 2011). L aumento complessivo dell incidenza del tumore è maggiore nelle donne rispetto agli uomini ed è maggiore nei soggetti di età compresa tra i 45 e i 50 anni. Uno dei principali fattori di rischio predisponenti allo sviluppo del tumore tiroideo è rappresentato dall esposizione a radiazioni ionizzanti. Tale associazione è stata accertata da diversi studi condotti dopo il disastro di Chernobyl del 1986, che hanno evidenziato un aumento dell incidenza di neoplasie tiroidee nei soggetti che al momento dell esposizione avevano un età compresa tra i 5 e i 10 anni. Altre condizioni predisponenti includono una familiarità per tumore tiroideo, una preesistente patologia tiroidea benigna, fattori ormonali e gravidanze, aumenti di peso ed un insufficiente apporto di iodio nella dieta (Romei et al, 2012). Più del 95% dei tumori tiroidei originano dalle cellule dell epitelio follicolare e comprendono adenomi, carcinomi ben differenziati, carcinomi poco differenziati e carcinomi anaplastici, mentre il 3,2% dei tumori tiroidei sono derivati dalle cellule C o parafollicolari (Chien et al, 2012). I carcinomi ben differenziati rappresentano circa l 80% di tutti i tumori tiroidei e comprendono due tipi principali: il carcinoma papillare (PTC) e il carcinoma follicolare (FTC). Il PTC è il tipo più comune e rappresenta l 80% di tutte le neoplasie tiroidee. Il PTC è generalmente indolente e curabile, ma questo tumore può comunque diffondere localmente ai linfonodi e molto comuni sono la persistenza della malattia e le recidive. Il FTC rappresenta il 15% di tutte le neoplasie tiroidee ed è il secondo tipo più comune di carcinoma ben differenziato originato dall epitelio follicolare della tiroide ed è anch esso caratterizzato da un fenotipo indolente (Nikiforov, 2009). I carcinomi poco differenziati e i carcinomi anaplastici sono invece molto aggressivi e possono insorgere de novo o da preesistenti carcinomi follicolari o papillari (Kondo et al, 2006). Importanti fattori sia da un punto di vista prognostico sia da quello decisionale terapeutico risultano essere: l età alla diagnosi, il tipo istologico e l estensione della neoplasia. Tale estensione è definita dal sistema di stadiazione TNM che classifica il tumore in base alle dimensioni e al grado di infiltrazione (T), all implicazione dei linfonodi (N) e alla presenza di metastasi a distanza (M). I noduli tiroidei sono molto frequenti nella popolazione adulta con una frequenza negli USA del 4 7%, ma solo una minima percentuale di questi noduli (5 10%) risulta essere maligna (Romei et al, 8

9 2012). Poiché la maggioranza dei noduli tiroidei sono benigni e poiché la maggior parte dei tumori tiroidei sono curabili con tecniche chirurgiche se identificati precocemente, è molto importante distinguere tra i noduli benigni e maligni in modo tale che il paziente possa ricevere un trattamento appropriato, minimizzando il rischio di interventi non necessari. Attualmente la citologia su aspirazione bioptica con ago sottile (FNA), sotto controllo ecografico, è il metodo di indagine preoperatorio più diffuso che permette di diagnosticare accuratamente la maggior parte delle lesioni benigne o maligne, indirizzando quindi le decisioni terapeutiche o i follow up. In generale nel 15% dei casi si ottiene un campione non diagnostico e in circa il 20% dei casi i campioni sono classificati nella categoria diagnostica di proliferazione follicolare di significato indeterminato per malignità (TIR3). In questa categoria, solo il 20% dei casi risultano poi essere carcinomi all esame istologico, eseguito dopo emitiroidectomia diagnostica (Nelva et al, 2011). Il trattamento d elezione per il carcinoma differenziato della tiroide prevede l asportazione totale della tiroide. Tale trattamento viene completato somministrando radio iodio a scopo ablativo di eventuali residui tiroidei e successiva terapia ormonale sostitutiva a vita con L tiroxina (LT4) con lo scopo di correggere l ipotiroidismo indotto e di sopprimere i livelli ematici di TSH di secrezione ipofisaria. 3.2 Alterazioni molecolari del carcinoma tiroideo Numerose alterazioni genetiche sono coinvolte nello sviluppo del tumore tiroideo derivante dall epitelio follicolare. Tali alterazioni sono rappresentate prevalentemente da mutazioni puntiformi e traslocazioni che portano all attivazione oncogenica di importanti vie di trasduzione del segnale, in particolare la via delle MAPK (Mitogen Activated Protein Kinase) che regola processi chiave della proliferazione, differenziamento e apoptosi cellulare, tramite l attivazione costitutiva di oncogeni come RET, NTRK 1, MET, BRAF e KRAS o il silenziamento di oncosoppressori come p53, PPARγ e PTEN. Alcune di queste alterazioni genetiche sono specifiche di alcuni tipi di carcinoma tiroideo (Tabella 1) e possono essere utilizzate come importante strumento per migliorare la diagnosi delle neoplasie tiroidee (Hunt et al, 2002). Quattro tipi di alterazioni genetiche costituiscono la maggioranza delle mutazioni che incorrono nei tumori papillari e follicolari e costituiscono importanti marcatori diagnostici e prognostici. Le più frequenti alterazioni nei PTC sono rappresentate da mutazioni puntiformi nei geni BRAF e RAS (riscontrate nel 40% e nel 10% dei casi rispettivamente) e riarrangiamenti RET/PTC (riscontrati nel 10 20% dei casi), e quelli che contengono il gene TRK (meno del 5% dei casi). Nel complesso, queste 9

10 alterazioni identificano il 70% dei PTC e sono generalmente mutuamente esclusive. Le più frequenti alterazioni che incorrono negli FTC sono rappresentate invece da mutazioni di RAS (nel 45% dei casi) e da riarrangiamenti PAX/PPAγ (nel 35% dei casi) che sono anch esse mutuamente esclusive. Mutazioni di RAS e in un minor misura traslocazioni PAX8/PPARγ sono riscontrate anche negli adenomi follicolari con frequenze del 20 40% e del 2 13%, rispettivamente. Diversi studi hanno mostrato che la valutazione preoperatoria di questi marcatori può migliorare l accuratezza della diagnosi citologica fatta su FNA per pazienti con diagnosi di significato indeterminato o con sospetto di malignità per identificare le lesioni maligne e aiutare quindi nella scelta terapeutica (Nikiforov, 2011). Tabella 1: alterazioni molecolari del carcinoma tiroideo (tratta da Nikiforov, 2011) Carcinoma papillare della tiroide Prevalenza (%) Mutazione BRAF Traslocazione RET/PTC Mutazione RAS Traslocazione TRK <5 Carcinoma follicolare della tiroide Prevalenza (%) Mutazione RAS Traslocazione PAX8/PPARy Alterazioni molecolari del carcinoma papillare La mutazione del gene BRAF L alterazione più comune dei PTC è la mutazione del gene BRAF (presente nel 40 45% dei casi). BRAF è una proteina serin treonina chinasi che appartiene alla famiglia delle proteine RAF, effettori intracellulari della cascata delle MAPK. Le mutazioni principali di BRAF nel PTC sono mutazioni puntiformi che coinvolgono il nucleotide 1799 e che portano alla sostituzione di una valina con un acido glutammico al codone 600 (V600E). Tale mutazione comporta la costitutiva attivazione della chinasi BRAF con conseguente attivazione cronica della via metabolica delle MAPK e successiva deregolazione della crescita e della proliferazione cellulare. La mutazione V600E di BRAF è tipica del PTC con istologia classica e della variante a cellule alte, mentre è rara nella variante follicolare. Le mutazioni di BRAF non sono state trovate nei FTC e nei noduli tiroidei benigni e, rappresentano pertanto un marcatore specifico del PTC e, quindi, un utile supporto per 10

11 migliorare l accuratezza della diagnosi citologica dei noduli tiroidei (Nikiforov, 2011). Diversi studi indicano che le mutazioni di BRAF si associano ad una maggiore aggressività del tumore in termini di invasione, stadio clinico e rischio di ripresa dalla malattia (Xing et al, 2005). Inoltre tali mutazioni sono associate alla perdita della capacità di captare lo iodio 131 e quindi ad una scarsa risposta terapeutica. Per questi motivi la valutazione preoperatoria dello stato mutazionale di BRAF rappresenterebbe un utile parametro per la scelta di un miglior approccio chirurgico e terapeutico La traslocazione RET/PTC Il proto oncogene RET codifica per un recettore tirosin chinasico (RTK) di membrana coinvolto nel controllo della differenziazione cellulare e della proliferazione. Normalmente il gene RET è espresso nelle cellule parafollicolari o cellule C, ma non nelle cellule follicolari dove, invece, può essere attivato solo in caso di presenza di un riarrangiamento del gene RET. Il recettore RET è una proteina transmembrana che presenta una porzione extracellulare formata da quattro domini simili alle caderine (cadherin like) e una parte intracellulare che presenta dei domini ricchi in tirosina (Figura 1). In presenza di specifici ligandi quali neururina, artimina, persepina e i fattori di derivazione dalle cellule gliali, il recettore RET, presente nella membrana cellulare sotto forma di monomero, dimerizza con un altro recettore. Tale dimerizzazione porta all attivazione del recettore tramite un processo di autofosforilazione dei domini tirosinchinasici (TK) e quindi all attivazione delle cascate metaboliche a valle (MAPK e via di PI3K AKT). Tali cascate intracellulari sevono a propagare i segnali del recettore RET di membrana all interno del nucleo attraverso una serie di proteine adattatore e chinasi intracitoplasmatiche (tra le quali RAS e BRAF) che portano alla regolazione della trascrizione di geni coinvolti nella differenziazione, nella proliferazione e nella sopravvienza cellulare (Figura 2). Nel PTC l attivazione di questa via metabolica è causata principalmente da mutazioni puntiformi di RAS e BRAF o da riarrangiamenti RET/PTC e tale attivazione costitutiva risulta essere responsabile dell insorgenza e della progressione tumorale (Nikiforov, 2011). 11

12 Figura 1: struttura del recettore RET formato da un dominio extracellulare N terminale, di legame con il ligando, da un dominio trans membrana, e da un dominio intracellulare C terminale dove sono presenti residui di tirosina (domini tirosin chinasici). Figura 2: cascate metaboliche intracellulari attivate dal recettore RET. 12

13 I riarrangiamenti a carico del gene RET (RET/PTC), rappresentano la seconda alterazione più comune nei PTC. Tali riarrangiamenti sono presenti in circa il 35% dei casi di PTC sebbene la percentuale sia variabile tra il 3 e l 85% a seconda degli studi, in funzione dell area geografica di provenienza dei tumori, delle differenti metodologie di analisi utilizzate e dell eterogeneità tumorale. La distribuzione del riarrangiamento RET/PTC all interno di un tumore può essere infatti eterogenea e può essere presente o nella maggior parte delle cellule neoplastiche (riarrangiamento RET/PTC di tipo clonale), oppure in una piccola frazione di cellule tumorali (riarrangiamento RET/PTC di tipo non clonale) (Santoro et al, 2006). Questo aspetto è da tenere in considerazione per le scelte delle differenti metodologie di analisi utilizzate: l analisi di questa traslocazione può infatti essere effettuata sia con RT PCR (Reverse Transcription Polimerase Chain Reaction), tecnica migliore per tessuti freschi o congelati con una sensibilità che non dovrebbe essere maggiore all 1% per evitare di rilevare mutazioni non clonali e quindi senza rilevanza clinica, oppure mediante FISH, tecnica più performante in caso di tessuti FFPE ma la cui valutazione richiede la determinazione di livelli di cut off corretti affinché non si incorra in risultati falsi positivi (Nikiforov, 2011). I riarrangiamenti clonali sono descritti in circa il 20% dei PTC mentre i riarrangiamenti non clonali sono stati identificati non solo nei PTC, ma anche nel 10 45% degli adenomi tiroidei e altre lesioni non neoplastiche (Santoro et al, 2006). I riarrangiamenti RET/PTC risultano essere più frequenti nei pazienti esposti a radiazioni (50 80%) e nei carcinomi papillari dei bambini o adolescenti (40% 70%) (Nikiforov, 2011). Tali riarrangiamenti sono specifici delle lesioni papillari maligne e generalmente non sono riscontrati (se non con metodologie di analisi molto sensibili) negli adenomi e nelle lesioni benigne. I riarrangiamenti RET/PTC portano alla formazione di oncogeni chimerici che risultano dalla fusione tra la porzione 3 del gene RET e la porzione 5 di geni eterologhi ubiquitariamente espressi e caratterizzati dalla presenza di sequenze nucleotidiche codificanti per proteine che formeranno domini coiled coil che permettono la dimerizzazione costitutiva del dominio tirosin chinasico di RET. Le proteine di fusione contengono il dominio tirosin chinasico del recettore RET intatto e risultano costitutivamente attivate portando quindi all attivazione costitutiva della cascata delle MAPK. Tale processo determina una proliferazione incontrollata delle cellule follicolari caratterizzate dalla presenza del riarrangiamento RET/PTC e quindi allo sviluppo successivo del tumore. Sono state descritte più di 11 varianti, ma i due tipi di riarrangiamento più frequenti sono RET/PTC1 (nel 60 70% dei casi) e RET/PTC3 (nel 20 30% dei casi). RET/PTC1 è formato dalla fusione del gene RET con il gene CCDC6 (H4) e RET/PTC3 dalla fusione del gene RET con il gene NCOA4 (ELE1). Entrambe le traslocazioni 13

14 sono inversioni paracentriche poiché sia il gene RET che i geni CCDC6 ed NCOA4 si trovano sul braccio lungo del cromosoma 10 (Nikiforov, 2003). RET/PTC1 si trova con maggiore frequenza nei tumori sporadici e nelle varianti classiche del PTC, ma può essere anche trovato nei microcarcinomi papillari, mentre RET/PTC3 è maggiormente presente nei carcinomi papillari indotti da radiazioni e nelle varianti solide dei PTC (Santoro et al, 2006). La correlazione tra la presenza delle traslocazioni RET/PTC e la prognosi non sono attualmente chiarite; vi sono evidenze che indicano un associazione tra la presenza di un riarrangiamento RET/PTC1 a un decorso più favorevole della malattia, rispetto ai pazienti con presenza di traslocazione RET/PTC3, associata ad un comportamento clinico più aggressivo. Altri studi hanno suggerito che i casi positivi per la presenza di un riarrangiamento RET/PTC sembrano mostrare un estensione più ampia della malattia e un tasso di coinvolgimento linfonodale maggiore rispetto ai casi negativi per le traslocazioni. Tuttavia altri studi hanno confutato tali considerazioni (Romei et al, 2012). Dal punto di vista diagnostico lo studio della traslocazione RET/PTC ha poco significato nel caso in cui vi sia un prelievo istologico, perché i tumori caratterizzati dalla traslocazione RET/PTC normalmente hanno un architettura di tipo papillare, che non crea grosse difficoltà diagnostiche. Al contrario tale analisi potrebbe risultare particolarmente utile nelle diagnosi preoperatorie effettuate mediante FNA dove sovente si hanno difficoltà a livello diagnostico soprattutto nei casi che hanno una citologia di significato indeterminato (TIR3) (Nikiforov, 2011). 14

15 4. Scopo del lavoro Negli ultimi anni l acquisizione di conoscenze sempre più approfondite e specifiche riguardanti le alterazioni genetiche proprie delle neoplasie tiroidee ha aperto la possibilità di applicare metodiche molecolari per l analisi di tali deregolazioni alla diagnostica citologica delle patologie tiroidee. Le principali alterazioni molecolari specifiche dei carcinomi tiroidei sono i riarrangiamenti PAX8/PPARγ e mutazioni RAS per i carcinomi follicolari, e riarrangiamenti RET e mutazioni BRAF per i carcinomi papillari. Nel Laboratorio di Patologia Molecolare dell ICP di Locarno sono già in uso diagnostico le analisi di PAX8/PPARG, RAS e di BRAF per coadiuvare l analisi citologica dei tumori tiroidei. L obiettivo del mio lavoro sarà quello di mettere a punto l analisi delle traslocazioni RET/PTC con lo scopo di completare il pannello delle principali analisi molecolari per la diagnostica del tumore tiroideo. 15

16 5. Pazienti, materiali e metodi 5.1 Pazienti Per la validazione dell analisi di traslocazione RET/PTC sono stati analizzati 17 pazienti affetti da PTC con diagnosi istologica effettuata presso l ICP di Locarno tra il 2010 e il I tessuti di ogni paziente, fissati in formalina ed inclusi in paraffina (FFPE) sono disponibili presso gli archivi dell ICP. Per ogni paziente l analisi della traslocazione RET/PTC è stata effettuata sia su tessuto tumorale sia sul tessuto normale della tiroide. Sul tessuto tumorale è stata effettuata inoltre l analisi dello stato mutazionale del gene BRAF, per ottenere un quadro completo delle alterazioni molecolari più frequenti nel PTC. 5.2 Materiali e metodi Per eseguire le metodiche descritte nel presente lavoro di diploma, è stato necessario lavorare in sterilità e nelle migliori condizioni che evitassero il più possibile le contaminazioni: i banconi di lavoro, le pipette e gli strumenti utilizzati sono stati puliti con ipoclorito di sodio per le lavorazioni con acidi nucleici (DNA e RNA) e con RNAsi Zap (Invitrogen) per le lavorazioni con RNA, i guanti sono stati cambiati ad ogni passaggio e la fase di estrazione degli acidi nucleici è stata effettuata sotto cappa chimica precedentemente irradiata con raggi UV Estrazione degli acidi nucleici Il DNA e l RNA sono stati estratti da tessuti FFPE dopo la valutazione delle sezioni istologiche, colorate mediante ematossilina eosina, da un medico patologo. Per l analisi RET/PTC l RNA è stato estratto sia da tessuto tumorale sia da tessuto sano. L analisi dello stato mutazionale di BRAF è stata effettuata solo su DNA genomico estratto da tessuto tumorale. Per l estrazione di DNA e RNA da tessuto tumorale, nei casi in cui l area di tumore selezionato fosse composta da più del 70% di cellule tumorali, sono state poste 6 7 sezioni istologiche da 7 µm (per il DNA) o 2 4 sezioni da 10 µm (per l RNA) in provette Eppendorf da 2ml. Per i tessuti in cui la quantità di cellule tumorali era inferiore al 70% è stata effettuata una macrodissezione: l area selezionata dal patologo è stata prelevata con bisturi monouso da sezioni in bianco su vetrino (dello stesso spessore delle sezioni poste in provetta) e posta in provette Eppendorf da 2 ml. Per l analisi del tessuto sano sono stati scelti reperi comprendenti il 100% di cellule sane. Per l estrazione del DNA e dell RNA da FFPE 16

17 sono stati usati kit commerciali: il QIAmp DNA MiniKIT e l RNAeasi MiniKit (Qiagen, Chatsworth, CA, USA) in cui sono presenti reagenti e materiali necessari per l estrazione. I protocolli prevedono una fase di lisi cellulare che permetta il rilascio degli acidi nucleici e una purificazione degli acidi nucleici tramite l assorbimento su una membrana di silice della colonnina presente nei kit. In seguito è prevista una fase di eluizione in cui gli acidi nucleici vengono rilasciati dalla membrana nel tampone di eluizione o in acqua DNAasi e RNAasi free. I procedimenti sono descritti dettagliatamente negli allegati 11.1 e Quantificazione degli acidi nucleici estratti dai tessuti La quantificazione degli acidi nucleici è stata effettuata tramite uno spettrometro UV visibile Nanodrop 1000 (Witec, Littau, CH) che stabilisce la concentrazione di acidi nucleici misurando l assorbanza dei campioni in volumi di 2 µl. Il procedimento è descritto in dettaglio nell allegato Amplificazione del DNA genomico tramite PCR Il DNA genomico estratto è stato amplificato tramite reazione di PCR (Polymerase Chain Reaction), reazione che permette l amplificazione in vitro degli acidi nucleici. La reazione di PCR inizia con una denaturazione di 10 minuti a 95 C, in seguito alla quale vengono ripetuti tre passaggi per volte con tempi e temperature definite. Questi passaggi sono la denaturazione (92 98 C) che permette di separare le due catene complementari di DNA, l Ibridazione (40 60 C), passaggio in cui i primers si legano a specifiche sequenze complementari del DNA stampo e la cui temperatura è determinata sperimentalmente, e l estensione (70 72 C), passaggio in cui la DNA polimerasi sintetizza il nuovo filamento di DNA. La reazione avviene all interno di termociclatori, strumenti che mantengono i campioni in incubazione, variando le temperature a seconda dell impostazione del protocollo. 50 ng di DNA (2 µl di una diluizione a 25 ng/µl) vengono aliquotati in provette da 0,2 ml, aggiungendo un controllo positivo, che consiste in un campione di DNA già amplificato precedentemente con successo, e un controllo bianco, cioè acqua sterile, privo di DNA, per valutare la presenza di contaminazioni. A questi verranno aggiunti 23 µl di una miscela di reazione, la cui costituzione è descritta nell allegato

18 5.2.4 Analisi dello stato mutazionale del gene BRAF L analisi dello stato genico dell esone 15 di BRAF è stata eseguita mediante PCR e sequenziamento diretto seguendo i protocolli già in uso presso l ICP per l attività diagnostica. Per l analisi dello stato mutazionale del gene BRAF è stata amplificata, tramite primers specifici, una regione dell esone 15 comprendente il codone 600, codone in cui avvengono la quasi totalità delle mutazioni oncogeniche del gene BRAF. Per l analisi dell esone 15 del gene BRAF è stato utilizzato il seguente protocollo (tabelle 2 e 3) con la seguente coppia di primers, con la relativa temperatura di ibridazione e lunghezza dell amplificato: Primer BRAF esone 15 Forward: 5 TCATAATGCTTGCTCTGATAGGA 3 Primer BRAF esone 15 Reverse: 5 GGCCAAAAATTTAATCAGTGGA 3 Temperatura di annealing: 52 C Dimensione dell amplificato: 250 bp Tabella 2: composizione della miscela di reazione per la reazione di PCR dell esone 15 del gene BRAF Concentrazione iniziale Conc./quantità finale Volume/campione DNA 25,0 ng/µl 50 ng 2,0 µl PCR Buffer 10X 1X 2,5 µl MgCl2 25 mm 3 mm 3,0 µl dntps 10 mm 0,2 mm 0,5 µl dutp 10 mm 0,04 mm 0,1 µl Primer BRAF Fw 10 µm 0,5 µm 1,25 µl Primer BRAF Rw 10 µm 0,5 µm 1,25 µl Taq Gold 5 U/µM 2, U/campione 0,4 µl Acqua sterile 14 µl 18

19 Tabella 3: protocollo di amplificazione dell esone 15 del gene BRAF Temperature Tempo di reazione Stabilizzazione reazione 50 C 2 Denaturazione iniziale 95 C 10 Denaturazione 95 C 15 Ibridazione 52 C cicli Estensione 72 C 30 Estensione finale 72 C 3 Fine PCR 10 C Elettroforesi su gel di agarosio Al fine di verificare l ottenimento di un buon prodotto di amplificazione per tutti i campioni analizzati si è ricorso alla corsa su gel di agarosio. Si tratta di un metodo che permette di separare le molecole di DNA in base alle loro dimensioni: molecole piccole infatti migrano più velocemente rispetto a quelle grandi. La tecnica sfrutta la carica elettrica negativa del DNA per permettere la sua migrazione in un campo elettrico, verso il polo positivo. La migrazione avviene attraverso un gel di agarosio che funge da setaccio molecolare, rallentando la corsa delle molecole. La concentrazione del gel può variare a seconda delle necessità: se le molecole da separare hanno dimensioni poco diverse l una dall altra, occorrerà avere maglie più strette e perciò la concentrazione del gel dovrà essere maggiore. Se, come nel nostro caso, i prodotti di amplificazione sono di dimensioni di circa bp, è sufficiente utilizzare un gel all 1,8%. La dimensione degli amplificati ottenuti è stata poi valutata grazie ad un marker, una miscela di frammenti di DNA a lunghezza nota che viene fatta correre nello stesso gel. I procedimenti di preparazione del gel di agarosio, della corsa elettroforetica e di visualizzazione dei risultati sono descritti in dettaglio nell allegato Purificazione del DNA amplificato Prima di procedere alla PCR di sequenza è necessario purificare il DNA amplificato, per eliminare i reagenti in esubero della PCR rimasti in soluzione (primers, nucleotidi non incorporati e la Taq Polimerasi), che potrebbero compromettere il corretto sequenziamento del DNA. Per questo scopo è stato usato il kit MSB SPIN PCRapace (STRATEC Molecular, Gmbh, Berlino, Germania), che 19

20 contiene colonne con un filtro che trattiene il DNA, mentre i contaminanti vengono eliminati tramite un lavaggio. In seguito il DNA viene eluito con un buffer in una provetta Eppendorf da 1,5 ml. Il procedimento di purificazione è descritto in dettaglio nell allegato PCR di sequenza (cyclesequencing) I filamenti del prodotto amplificato, a seguito della purificazione, vengono marcati e amplificati nella reazione di sequenziamento (cyclesequencing). Si tratta di una particolare PCR effettuata in presenza di un solo primer (forward o reverse), dei quattro dntps e di quattro dideossinucleotidi trifosfati (ddntps) marcati con quattro fluorocromi differenti che fungono da terminatori della reazione. La reazione avviene normalmente, ma in alcune catene vengono introdotti casualmente i ddntps che bloccano la reazione siccome sono privi del gruppo ossidrile ( OH) all estremità 3 che permetterebbe l incorporamento di ulteriori nucleotidi. Ciò permette la formazione di frammenti di lunghezze diverse, marcate a seconda del nucleotide che blocca la reazione. Questi frammenti verranno rilevati grazie ad un raggio laser di un sequenziatore automatico e interpretati da un programma apposito. Il dettaglio è descritto nell allegato Purificazione del DNA dopo PCR di sequenza Prima di poter sequenziare i frammenti ottenuti mediante la PCR di sequenza è necessario eliminare i dntps, i ddntps e i primers che non sono stati incorporati nella reazione. Per tale scopo viene usato il kit G50 Dye Terminator Removal kit (RBC Bioscience) che fornisce delle colonne contenenti sfere di gel pre idratate. Il principio è quello della cromatografia per gelfiltrazione, dove i contaminanti vengono separati dal DNA sfruttando il differente peso molecolare e le differenti dimensioni. Il DNA attraversa velocemente il gel e viene recuperato all interno di una eppendorf di 1,5 ml. Il procedimento è scritto in dettaglio nell allegato Il sequenziamento Il sequenziamento avviene in uno strumento in grado di effettuare l elettroforesi capillare, dotato da un raggio laser (3130 Genetic Analyzer, Applied Biosystems). Esso è in grado di separare due frammenti di DNA che differiscono solo di 1 bp distinguendoli grazie ai fluorocromi marcati. Per ottenere le sequenze dell amplificato del gene d interesse, i pellet ottenuti a seguito della seconda purificazione sono stati risospesi in 15 µl di formammide (Hi Di Formammide, Applied Biosystems) 20

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Biologia molecolare nella diagnosi citologica

Biologia molecolare nella diagnosi citologica Carcinoma differenziato della tiroide: dalla diagnosi al follow up 21 Marzo 2009 Biologia molecolare nella diagnosi citologica Giovanni Tallini Universita di Bologna Anatomia Patologica Osp. Bellaria Patogenesi

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO Documento redatto da: Dott.ssa T.Venesio, Dr.ssa A. Balsamo - Laboratorio di Patologia

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Le zone grigie della citologia tiroidea.

Le zone grigie della citologia tiroidea. Carcinoma differenziato della tiroide: dalla diagnosi al follow-up Bologna 21 marzo 2009 Le zone grigie della citologia tiroidea. Cosa deve dire il patologo Gian Piero Casadei Anatomia Patologica Ospedale

Dettagli

Analisi mutazionale di K-RAS metodiche a confronto

Analisi mutazionale di K-RAS metodiche a confronto Analisi mutazionale di K-RAS metodiche a confronto Aula Magna Villa Sironi Gallarate 16 ottobre Dott. Carmelo Lupo Coordinatore Tecnico Anatomia Patologica e Patologia Molecolare Oncologica PERCHÉ K-RAS

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

AlphaReal BREAST Scheda Tecnica

AlphaReal BREAST Scheda Tecnica AlphaReal BREAST Scheda Tecnica A3 DS RT 607 ARBreast_01_2015.doc Pag. 1 di 5 Rev. 01 del Gennaio 2015 Prodotto: AlphaReal BREAST Codice prodotto: RT-607.05.20 / RT-607.10.20 N Tests: 5/10 tests Destinazione

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

Il Nodulo Tiroideo dalla diagnosi alla Terapia

Il Nodulo Tiroideo dalla diagnosi alla Terapia Il Nodulo Tiroideo dalla diagnosi alla Terapia Genova Voltri 15 Dicembre 2012 Luca Anselmi Anatomia Patologica Sestri Ponente Percorso Diagnostico Terapeutico Multidisciplinare ENDOCRINOLOGO RADIOLOGO

Dettagli

Strumenti e Tecniche di studio in patologia

Strumenti e Tecniche di studio in patologia Strumenti e Tecniche di studio in patologia Gli strumenti della patologia: Microscopia Biologia molecolare Indagini biochimiche Microscopia Ottica citopatologia ed istopatologia citochimica ed istochimica

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

Tiroide. laterali uniti da un segmento. continua con una propaggine. laringe. circa40mmeilpesointornoai20. ad età e fattori geografici

Tiroide. laterali uniti da un segmento. continua con una propaggine. laringe. circa40mmeilpesointornoai20. ad età e fattori geografici Tiroide La tiroide è formata da due lobi laterali uniti da un segmento trasversale (istmo) che si continua con una propaggine (lobo piramidale) aderente alla laringe L altezza media della tiroide è di

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE)

ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE) ESTRAZIONE ACIDI NUCLEICI CON PARTICOLARE RIFERIMENTO A DNA ESTRATTO DA TESSUTI FISSATI IN FORMALINA E INCLUSI IN PARAFFINA (FFPE) SALVATORE GIRLANDO LABORATORIO PATOLOGIA MOLECOLARE ANATOMIA PATOLOGICA

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

Il Nodulo Tiroideo. "Diagnostica Citologica"

Il Nodulo Tiroideo. Diagnostica Citologica Il Nodulo Tiroideo "Diagnostica Citologica" FNAC Con il termine di FNAC (Fine Needle Aspiration Cytology) si intende un prelievo citologico eseguito mediante un ago definito sottile (a partire da 22G ),

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Dr.ssa Stefania Bruni CPS_ Tecnico di Laboratorio Biomedico Laboratorio di Fisiopatologia Endocrina Azienda Ospedaliero-Universitaria Sant Anna di

Dr.ssa Stefania Bruni CPS_ Tecnico di Laboratorio Biomedico Laboratorio di Fisiopatologia Endocrina Azienda Ospedaliero-Universitaria Sant Anna di Dr.ssa Stefania Bruni CPS_ Tecnico di Laboratorio Biomedico Laboratorio di Fisiopatologia Endocrina Azienda Ospedaliero-Universitaria Sant Anna di Ferrara Diagnostica Molecolare svolta nel Laboratorio

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Moria del pero (Candidatus Phytoplasma pyri) Fitoplasmi: Microrganismi

Dettagli

Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario

Dettagli

Preparazione dei campioni da inviare per il sequenziamento

Preparazione dei campioni da inviare per il sequenziamento Preparazione dei campioni da inviare per il sequenziamento PCR preparativa Buffer 10x dntp 2mM Taq polimerasi Oligonucleotidi up e down 100 ng/ul Volume finale 2 ul/campione 2 ul/campione 0,5 U/campione

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

GIE - Gruppo Italiano di studio di Ematopatologia

GIE - Gruppo Italiano di studio di Ematopatologia INDAGINI DI CARATTERIZZAZIONE CITOFLUORIMETRICA E GENETICO- MOLECOLARE PREFAZIONE La diagnosi delle malattie linfoproliferative si basa sull integrazioni delle informazioni istomorfologiche con i dati

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

Linfoma a cellule B: Paragone tra due metodiche di Biologia Molecolare per una diagnosi più efficace

Linfoma a cellule B: Paragone tra due metodiche di Biologia Molecolare per una diagnosi più efficace Linfoma a cellule B: Paragone tra due metodiche di Biologia Molecolare per una diagnosi più efficace Linda Olsson Scuola Superiore Medico Tecnica Locarno Anno 2008/ 09 Lavoro di Diploma eseguito presso:

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

RD-100i. OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario

RD-100i. OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario RD-1i OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario RD-1i OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario La biopsia del

Dettagli

LE NEOPLASIE DIFFERENZIATE DELLA TIROIDE Paolo Fracchia SOC ORL ASL AL Casale Monferrato

LE NEOPLASIE DIFFERENZIATE DELLA TIROIDE Paolo Fracchia SOC ORL ASL AL Casale Monferrato LE NEOPLASIE DIFFERENZIATE DELLA TIROIDE Paolo Fracchia SOC ORL ASL AL Casale Monferrato 19 marzo-2 aprile 2011 INTRODUZIONE Il carcinoma papillare ed il carcinoma follicolare della tiroide, definiti carcinomi

Dettagli

Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Linfonodo sentinella. metodo OSNA: esperienze e confronto con il metodo tradizionale

Linfonodo sentinella. metodo OSNA: esperienze e confronto con il metodo tradizionale Linfonodo sentinella secondo metodo OSNA: esperienze e confronto con il metodo tradizionale Dott.ssa C.M.. Antonacci U.O. Anatomia Patologica A.O. Ospedale Luigi Sacco di Milano Linfonodo sentinella Il

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

La tiroide è una ghiandola posta nel collo, appena sotto la cartilagine tiroidea (il cosiddetto pomo d'adamo).

La tiroide è una ghiandola posta nel collo, appena sotto la cartilagine tiroidea (il cosiddetto pomo d'adamo). COS'È IL TUMORE ALLA TIROIDE La tiroide è una ghiandola posta nel collo, appena sotto la cartilagine tiroidea (il cosiddetto pomo d'adamo). Ha la forma di una farfalla con le due ali poste ai lati della

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

IL TEST DI CITOTOSSICITÀ

IL TEST DI CITOTOSSICITÀ IL TEST DI CITOTOSSICITÀ Questo test permette di valutare in vitro la capacità di un agente di inibire la crescita cellulare. La riduzione nel numero delle colonie può derivare sia dal blocco della proliferazione

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

ZytoLight SPEC ALK/EML4 TriCheck Probe

ZytoLight SPEC ALK/EML4 TriCheck Probe ZytoLight SPEC ALK/EML4 TriCheck Probe Z-2117-200 Z-2117-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del riarrangiamento dei geni ALK- EML4 mediante ibridazione in situ fluorescente (FISH).... Dispositivo

Dettagli

La ricerca degli oncogeni RET/PTC, trk e BRAF V 600E negli agoaspirati inconclusivi migliora la diagnosi citologica e modifica la scelta terapeutica

La ricerca degli oncogeni RET/PTC, trk e BRAF V 600E negli agoaspirati inconclusivi migliora la diagnosi citologica e modifica la scelta terapeutica La ricerca degli oncogeni RET/PTC, trk e BRAF V 600E negli agoaspirati inconclusivi migliora la diagnosi citologica e modifica la scelta terapeutica Maria Ilaria Moretti 1, Anna Guerra 1, Diega Marranca

Dettagli

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi IV Congresso Regionale I Congresso del Middle Management di Area Tecnica Federazione Italiana Tecnici di Laboratorio Biomedico Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi Dott.ssa

Dettagli

Tecniche di patologia molecolare finalizzate all'analisi di mutazioni

Tecniche di patologia molecolare finalizzate all'analisi di mutazioni Tecniche di patologia molecolare finalizzate all'analisi di mutazioni dei geni predittivi di risposta alla terapia oncologica Carmelo Lupo Casa di Cura La Maddalena Palermo Test molecolari PREDITTIVI di

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Le malattie della tiroide (dalla diagnosi alla terapia ) Focus sui percorsi aziendali A cura del Gruppo tiroide ASLAL Coordinatore: Dr.

Le malattie della tiroide (dalla diagnosi alla terapia ) Focus sui percorsi aziendali A cura del Gruppo tiroide ASLAL Coordinatore: Dr. Le malattie della tiroide (dalla diagnosi alla terapia ) Focus sui percorsi aziendali A cura del Gruppo tiroide ASLAL Coordinatore: Dr. Singarelli Il follow-up del paziente operato Piero Iacovoni Acqui

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli ANALISI OGM SOYA Il progetto si proponeva di verificare le caratteristiche qualitative di diversi lotti di soya rispetto alla contaminazione accidentale da OGM per avere una valutazione indicativa della

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

Medicina personalizzata: Trasferimento tecnologico kit IVDD di medicina iomolecolare a marchio Alphagenics

Medicina personalizzata: Trasferimento tecnologico kit IVDD di medicina iomolecolare a marchio Alphagenics Medicina personalizzata: Trasferimento tecnologico kit IVDD di medicina iomolecolare a marchio Alphagenics Milena Sinigaglia Quality Systems Management & Health S.r.l. Meetjob Oristano 23/24 Aprile 2013

Dettagli

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Microscopia confocale 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Esempio di analisi con

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE.

LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE. LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE. Dott.ssa Marchi Barbara Biologa sanitaria COMBINAZIONE TRA LA BIOLOGIA MOLECOLARE

Dettagli

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica Biologia molecolare clinica Organizzazione del laboratorio di biologia molecolare clinica Le tecniche di biologia molecolare negli ultimi anni si sono diffuse nei laboratori di diagnostica clinica dove

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti

Dettagli

Tumore (gonfiore) o neoplasia (nuova crescita):

Tumore (gonfiore) o neoplasia (nuova crescita): Tumore (gonfiore) o neoplasia (nuova crescita): *popolazione cellulare di nuova formazione che ha preso origine quasi sempre da una sola cellula somatica dell organismo, colpita da una serie sequenziale

Dettagli