Studio dello svernamento di Tomato Spotted Wilt Virus (TSWV) e della sua incidenza su diverse colture orticole in una serra del Canton Ticino

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Studio dello svernamento di Tomato Spotted Wilt Virus (TSWV) e della sua incidenza su diverse colture orticole in una serra del Canton Ticino"

Transcript

1 Studio dello svernamento di Tomato Spotted Wilt Virus (TSWV) e della sua incidenza su diverse colture orticole in una serra del Canton Ticino Lavoro di diploma Dafne Gianettoni Novembre 2002 Aprile 2003 Institute of Plant Sciences Plant Pathology Group Swiss Federal Institute of Technology Zurich Referente: Supervisori scientifici: Dr. Cesare Gessler Dr. Andrea Patocchi Giovanni Broggini

2 RIASSUNTO... 3 ABSTRACT INTRODUZIONE CENNI STORICI DISTRIBUZIONE GEOGRAFICA LA SITUAZIONE NEL CANTON TICINO IMPORTANZA ECONOMICA IL VIRUS TASSONOMIA BIOLOGIA PIANTE OSPITI SINTOMATOLOGIA SINTOMI SU POMODORO (Lycopersicon esculentum) SINTOMI SU MELANZANA (Solanum melongena) SINTOMI SU LATTUGA (Lactuca sativa) SINTOMI SU MALERBE TRASMISSIONE DEL VIRUS INSETTI VETTORI F. OCCIDENTALIS PERGANDE T. TABACI LINDERMAN ALTRI MODI DI TRASMISSIONE METODI DI LOTTA RIDUZIONE DELL INOCULO CONTROLLO DEI VETTORI PIANTE RESISTENTI A TSWV EVOLUZIONE DEI VIRUS EVOLUZIONE DI TSWV ANALISI FILOGENETICHE SCOPI DEL LAVORO MATERIALE E METODI PRELIEVO DEI CAMPIONI ESTRAZIONE DI RNA SINTESI DI CDNA AMPLIFICAZIONE SPECIFICA TRAMITE PCR NESTED PCR GEL ELETTROFORESI DEL PRODOTTO PCR PURIFICAZIONE DEL PRODOTTO PCR QUANTIFICAZIONE DEL PRODOTTO PCR CYCLE SEQUENCING PURIFICAZIONE DEI PRODOTTI DI CYCLE SEQUENCING SEQUENZIAMENTO ELABORAZIONE DEGLI ELETTROFEROGRAMMI ALLINEAMENTO DELLE SEQUENZE ANALISI FILOGENETICHE

3 3. RISULTATI INCIDENZA DI TSWV IN OTTO COLTURE ORTICOLE INCIDENZA DI TSWV IN UNA COLTURA INVERNALE PIANTE INFESTANTI SEQUENZE DEI CAMPIONI ANALIZZATI APLOTIPI ANALISI FILOGENETICHE VARIABILITÀ DELLE SEQUENZE SEQUENZE TROVATE DURANTE QUESTA RICERCA SEQUENZE DI TUTTI GLI ISOLATI TICINESI CONFRONTO TRA SEQUENZE TICINESI E SEQUENZE PUBBLICATE DENDOGRAMMI BASATI SULLE SEQUENZE NUCLEOTIDICHE SEQUENZE TROVATE DURANTE QUESTA RICERCA SEQUENZE DI TUTTI GLI ISOLATI TICINESI CONFRONTO TRA SEQUENZE TICINESI E SEQUENZE PUBBLICATE DENDOGRAMMI BASATI SULLE SEQUENZE AMINOACIDICHE SEQUENZE TROVATE DURANTE QUESTA RICERCA SEQUENZE DI TUTTI GLI ISOLATI TICINESI CONFRONTO TRA SEQUENZE TICINESI E SEQUENZE PUBBLICATE APLOTIPI PARTICOLARI DISCUSSIONE INCIDENZA DI TSWV IN OTTO COLTURE ORTICOLE TSWV IN UNA COLTURA INVERNALE PIANTE INFESTANTI COME SERBATOIO DI TSWV FREQUENZA E DISTRIBUZIONE DEGLI APLOTIPI DI TSWV EVOLUZIONE DI TSWV IN TICINO APLOTIPI PARTICOLARI CONCLUSIONI OUTLOOK COLTURA INVERNALE EVOLUZIONE DI TSWV ELISA (Enzyme-linked immunosorbent assay) RINGRAZIAMENTI LETTERATURA APPENDICE

4 RIASSUNTO La malattia causata da Tomato Spotted Wilt Virus (TSWV) provoca ingenti danni alle numerose colture sensibili. In Ticino i sintomi dell avvizzimento maculato del pomodoro sono stati osservati per la prima volta nel Da allora il virus è stato rilevato in diverse aziende ed è divenuto un grave problema nelle colture orticole del Cantone. Per sviluppare una strategia di lotta basata su una miglior conoscenza della diffusione del patogeno, della sua presenza in diverse colture, del suo luogo di svernamento e del modo con cui è importato nelle colture, e basandosi su una ricerca svolta nel 2002 (Matasci, 2002) sono stati fissati gli scopi seguenti per questo lavoro: stabilire l incidenza di TSWV in otto colture orticole, testarne la presenza in una coltura invernale, valutare l importanza delle malerbe come serbatoio del virus e valutare l evoluzione di TSWV in Ticino. Sono stati analizzati 263 campioni di foglia di undici specie ospiti del virus: cavolo rapa, coste, formentino, Galinsoga sp., lattuga batavia, lattuga cappuccio, lattuga foglia di quercia, lattughino lollo rosso, melanzane, pomodori e Stellaria media; tutti i campioni sono stati prelevati in un azienda di Muzzano presso la quale era stata accertata in precedenza la presenza del virus. Cavolo rapa, formentino, lattughino lollo rosso, melanzane, S. media e lattuga foglia di quercia (messa a dimora durante l inverno) non presentavano sintomi. Le analisi sono state eseguite tramite estrazione di RNA, sintesi di cdna e successiva amplificazione tramite nested PCR del gene NP, il gene virale che codifica la proteina nucleocapsidica. L incidenza del virus nelle colture orticole prese in considerazione si è rivelata elevata; nessuna ne era esente, a conferma dell elevata polifagia di TSWV. Le percentuali di infezioni variano dal 25 % al 100 %. Anche nella coltura messa a dimora durante il periodo invernale, ovvero quando i tripidi vettori del virus sono attivi in misura ridotta, è stata rilevata la presenza di TSWV (19,5 % di campioni infetti). Pure le piante infestanti analizzate si sono rivelate infette, a riprova della loro possibile funzione come serbatoio per il virus; le percentuali di campioni positivi variano dal 63,6 % al 100 %. Tramite il sequenziamento di 154 prodotti RT-PCR sono stati individuati 30 aplotipi di TSWV: in Ticino è presente un elevata diversità genetica. 29 aplotipi sono nuovi; uno, il più frequente in tutte le specie, era già stato trovato nell azienda di Muzzano ed in altre due aziende ticinesi (a Stabio e a Novazzano). Eseguendo le analisi filogenetiche si è potuta osservare una probabile evoluzione dall aplotipo più frequente che potrebbe aver generato tutti i nuovi aplotipi, con un numero ridotto di sostituzioni nucleotidiche e aminoacidiche. Il confronto degli aplotipi presenti sul territorio cantonale con le sequenze pubblicate in GenBank (confronto effettuato con sequenze di 513 nucleotidi), ha permesso di situare gli aplotipi ticinesi in due gruppi: uno è simile ad isolati provenienti dall Olanda e dalla Repubblica Ceca; l altro è vicino ad un isolato italiano. Questo lascia ipotizzare una correlazione tra il Paese di provenienza delle piantine acquistate (Olanda ed Italia) e gli aplotipi presenti in origine, dai quali sarebbero stati generati tutti gli altri presenti nell azienda considerata. 3

5 ABSTRACT Tomato Spotted Wilt Virus (TSWV) has become an increasing problem as a result of significant economic losses in many agronomic and ornamental crops worldwide. The virus was detected in Ticino for the first time in 1997 and has become an important problem in many horticultural cultures. The aims of this study were to investigate the incidence of TSWV in eight cultures, to verify its presence in a winter cultivated culture, to test the importance of infesting weeds as reservoirs of virus and to determine the genetic diversity of TSWV in Ticino. Cabbage, eggplant, lettuce (four varieties), swiss chard, Valerianella locusta, tomato (as infesting weed in other cultures), Galinsoga sp. and Stellaria media leafs were sampled from October 2002 to February The samples were taken from a greenhouse in Muzzano where the virus was present during 2000 and Total RNA of 263 samples was extracted and the nucleoprotein gene (NP) was amplified by nested RT-PCR with specific primers. RT-PCR products were sequenced. Nested RT-PCR testing showed that TSWV was present in all the species, infecting a high percentage of plants (166 samples): 68,2 % of the samples of eight cultures, 19,5 % of the plants cultivated during the winter and 82,6 % of the weeds were infected. Plants without symptoms were also infected. The infected plants were randomly distributed in the field; it is hypothesized that vector insects coming from outside were responsible for the primary infection. The infesting weeds can act as reservoirs from which the virus can spread to susceptible crops. 30 haplotypes were detected by sequencing 154 RT-PCR products; 29 haplotypes are new, one was previously discovered on the same greenhouse. This one is the more frequent in all the species. Strong similarities were found between the 30 haplotypes by comparison of the nucleotide sequences. The 29 new haplotypes could have been generated by mutation from the haplotype which was previously present. Comparison of amino acid sequences showed lower variability: the most substitutions are synonymous. 4

6 1. INTRODUZIONE 1.1. CENNI STORICI I sintomi della malattia causata da Tomato Spotted Wilt Virus (TSWV) furono osservati per la prima volta nel 1915 su piante di pomodoro nello stato di Victoria, in Australia (Brittlebank, 1919). L autore denominò la malattia spotted wilt of tomato. La prima indicazione di un virus quale agente causale della malattia, fu riportata da Samuel et al. (1930) che diede alla malattia il nome tomato spotted wilt virus. In Europa il virus fu osservato per la prima volta nel 1931 in Gran Bretagna (Smith, 1932). Dopo la seconda guerra mondiale TSWV perse d importanza in Europa, probabilmente perché il vettore Thrips tabaci era presente in quantità relativamente debole. Il tripide californiano Frankliniella occidentalis, vettore molto efficiente del virus, iniziò a diffondersi verso il 1980 ed è attualmente presente in tutte le zone europee e del mediterraneo. La diffusione di TSWV in Europa è associata all introduzione ed in seguito all espansione di questo vettore (EPPO, 2001). Nel 1987 la malattia riapparve quindi in Francia su peperone (Gebre-Selassie et al., 1989) e nei Paesi Bassi su pomodoro (Stijger et al., 1989). In seguito fu segnalata in Inghilterra (Barker, 1989), in Italia (Bellardi & Vicchi, 1990), in Portogallo (Louro, 1990) ed in Spagna (Jordá & Osca, 1991). Nel 1994, nel Canton Vaud, fu fatta la prima osservazione del virus in Svizzera (OCVCM, 1996). Il TSWV o virus della bronzatura del pomodoro, detto anche avvizzimento maculato del pomodoro, è dichiarato dall EPPO (European and Mediterranean Plant Protection Organization) organismo di quarantena DISTRIBUZIONE GEOGRAFICA Il virus TSWV è presente in tutte le regioni temperate e subtropicali del pianeta (Fig. 1); è stato segnalato in Asia, Africa, America, Europa ed Oceania. Prima della seconda guerra mondiale era considerato in molte regioni il virus più pericoloso, in particolare per quel che riguarda i pomodori (Gebre-Selassie, 1989). Nelle zone europee e mediterranee è presente in Algeria, Austria, Belgio, Bulgaria, Cechia, Croazia, Cipro, Egitto, Francia, Germania, Gran Bretagna, Grecia, Irlanda, Israele, Italia (Sicilia inclusa), Libia, Lituania, Malta, Marocco (non confermato), Moldavia, Norvegia (in via d eradicazione), Polonia, Portogallo, Romania, Russia, Slovacchia, Spagna (Isole Canarie incluse), Svezia, Svizzera, Tunisia (non confermato), Turchia, Ucraina, Ungheria e Yugoslavia. È stato debellato in Danimarca e Finlandia (EPPO, 2001). 5

7 Fig. 1: Distribuzione geografica di TSWV (EPPO/CABI, 1998). 6

8 1.3. LA SITUAZIONE NEL CANTON TICINO Nel 1997 si è verificato a Tenero (Fig. 2, azienda 1) il primo ritrovamento di TSWV in Ticino, su pomodoro di provenienza olandese (Pedrinis, 1998). Nel 1999 il virus è stato rilevato a Coldrerio (Fig. 2, azienda 2) su lattuga proveniente dall Italia. Nel 2000 ha fatto la sua apparizione in tre aziende orticole. A Coldrerio è stato segnalato su lattuga a cappuccio e su pomodoro provenienti dall Italia. In un azienda orticola di Muzzano (Fig. 2, azienda 3) TSWV ha infettato una serra coltivata con pomodori di provenienza olandese ed è stato rinvenuto anche su lattuga cappuccio, su batavia rossa e su batavia verde. Il virus è stato ritrovato anche in un azienda orticola di Stabio (Fig. 2, azienda 4) in tunnel coltivati con pomodori di provenienza italiana (Pedrinis, 2001). Nel 2001 sono state colpite quattro aziende: quelle a Stabio e Muzzano già colpite nel 2000 e due nuove aziende, una ad Iragna (Fig. 2, azienda 5) e l altra a Novazzano (Fig. 2, azienda 6). L orticoltore dell azienda di Coldrerio colpita nel 2000 ha abbandonato l attività orticola; non si hanno quindi informazioni sull evoluzione della situazione in quest azienda. Nell azienda di Stabio il virus è stato ritrovato in due tunnel su alcune piante di lattuga e su quasi tutte quelle di pomodoro, proveniente dalla Sicila. A Muzzano il virus è stato riscontrato su pomodoro, anche in questo caso proveniente dalla Sicilia, ma fornito da una ditta diversa. Pure nelle aziende di Iragna e Novazzano il virus è stato rilevato su pomodoro. Le piantine dell azienda nel Sopraceneri provenivano dall Olanda, mentre quelle dell azienda nel Sottoceneri dall Italia. Nel 2002 il virus è stato rilevato in una seconda azienda di Novazzano (Fig. 2, azienda 7) su colture di lattuga e lattuga foglia di quercia provenienti dall Olanda, nell azienda di Muzzano già colpita negli anni precedenti su una pianta di pomodoro proveniente dalla Sicilia, e su pomodoro nell azienda di Stabio (Matasci, 2002). Fig. 2: Localizzazione delle aziende orticole colpite da TSWV nel canton Ticino, tra il 1997 ed il 2002 (Matasci, 2002). 1: Tenero, primo e unico rilevamento nel : Coldrerio, primo rilevamento nel : Muzzano, primo rilevamento nel : Stabio, primo rilevamento nel : Iragna, primo rilevamento nel : Novazzano (Brusata), primo rilevamento nel : Novazzano, primo rilevamento nel

9 In Ticino è presente un elevata variabilità genetica di TSWV: nei campioni prelevati in cinque aziende nel corso di due anni (2001 e 2002) sono stati individuati 11 aplotipi. Gli aplotipi rinvenuti nel materiale raccolto nel 2002 sono in alcuni casi identici a quelli dell anno precedente ed in altri casi variano per un numero ridotto di sostituzioni nucleotidiche; ciò può indicare un evoluzione degli aplotipi già presenti nel 2001 dai quali deriverebbero quelli del 2001 (Matasci, 2002). In Tab. 1 sono presentati i diversi aplotipi di TSWV trovati in Ticino nel 2002 ed è indicato in quanti campioni ed in quante aziende essi sono stati rilevati. Il nome dei diversi aplotipi si compone della sigla del canton Ticino (TI), dell anno in cui l aplotipo è stato trovato per la prima volta, della coltura (TO = pomodoro, LE = lattuga) e di un indicazione partendo dalla lettera A. Gli aplotipi TI01TOA e TI01TOD risultano identici nel confronto di 518 nucleotidi; considerando le sequenze più lunghe (638 nucleotidi) sono invece distinguibili. La sequenza TI02LEL non è esattamente determinata data la presenza di tre sostituzioni dubbie. La mutazione che rende l aplotipo TI02LEM differente da TI01TOB non è sicura. Tab. 1: Aplotipi di TSWV presenti in Ticino, totale dei campioni e delle aziende in cui sono stati rilevati nel Aplotipo TI01TOA TI01TOB TI01TOC TI01TOD TI01TOE TI01TOF TI01TOG TI02TOH TI02LEI TI02LEL* TI02LEM** Totale campioni 2 (0) 1 7 (8) (12) (0) 2 Totale aziende Tra parentesi il numero di campioni se si considera TI01TOD uguale a TI01TOA (identico nel confronto di 518 nucleotidi) 2 Tra parentesi il numero di campioni se si considera inesistente la mutazione che rende TI02LEM diverso da TI01TOB * sequenza non esattamente determinata data la presenza di tre sostituzioni dubbie ** esistenza non certa dell aplotipo data la presenza di una mutazione non certa 8

10 1.4. IMPORTANZA ECONOMICA L impatto economico di TSWV è enorme. La grave sintomatologia, l elevato numero di specie sensibili, la grande polifagia degli insetti vettori e i limiti della difesa sia chimica sia biologica contro di essi, sono gli aspetti che rendono i tospovirus un problema di difficile risoluzione (Vicchi, 1999). A questi fattori si aggiunge la vasta distribuzione geografica della malattia. I danni arrecati alle colture sono ingenti e possono determinare la perdita dell intero raccolto, come riportato da Berling et al. (1992) per lattuga, peperoni e melanzane (Fig. 3). Le perdite causate annualmente da TSWV a livello mondiale superano il miliardo di dollari (Galitelli & Davino, 1998; Adkins, 2000). Esso è reputato fra i dieci virus maggiormente distruttivi dal punto di vista economico (Adkins, 2000). Fig. 3: Perdite dovute a TSWV in un tunnel di Muzzano (2002). 9

11 1.5. IL VIRUS TASSONOMIA TSWV appartiene al genere Tospovirus (famiglia Bunyaviridae) ed è un tipico esempio di virus polifago. La famiglia Bunyaviridae comprende cinque generi: Bunyavirus, Hantavirus, Nairovirus, Phlebovirus e Tospovirus. Quest ultimo è l unico a comprendere patogeni di vegetali (Heinze et al., 2001); agli altri quattro generi appartengono infatti solo virus animali. Il genere Tospovirus è suddiviso in due sierogruppi: Tomato spotted wilt e Watermelon silver mottle; entrambi contengono tre specie. Non sono raggruppate in nessun sierogruppo sette ulteriori specie (Tab. 2). Tab. 2: Suddivisione del genere Tospovirus: specie ed abbreviazioni dei virus appartenenti ai diversi sierogruppi (Moyer, 2000). Sierogruppo Specie Abbreviazione Tomato spotted wilt Tomato spotted wilt virus TSWV Groundnut ringspot virus GRSV Tomato chlorotic spot virus TCSV Watermelon silver mottle Watermelon silver mottle virus WSMV Watermelon bud necrosis virus WBNV Groundnut bud necrosis virus GBNV Ungrouped Impatiens necrotic spot virus INSV Chrysanthemum stem necrosis virus CNSV Iris yellow spot virus IYSV Peanut chlorotic fan-spot virus PCFV Peanut yellow spot virus PYSV Physalis severe mottle virus PSMV Zucchini lethal chlorosis virus ZLCV 10

12 BIOLOGIA Le particelle virali di TSWV sono sferiche, con un diametro di nm, e possiedono una membrana lipidica coperta da glicoproteine, chiamate G1 (78K) e G2 (58K). Il genoma virale consiste in tre segmenti lineari di RNA a singolo filamento (ssrna), chiamati in base alle loro dimensioni: S (small, 2,9 kb), M (medium, 4,8 kb) e L (large, 8,9 kb). I segmenti di RNA sono incapsulati da numerose copie della proteina N (nucleocapside) (de Ávila et al., 1993). Il filamento L RNA, della lunghezza di 8897 nucleotidi, codifica la proteina L (331,5K), una trascrittasi inversa. I filamenti S e M RNA hanno strategia codificante ambisense. S RNA (2916 nucleotidi) codifica la proteina nucleocapsidica N (29K) in viral complementary sense ed una proteina non strutturale (NSs, 52,4K) in viral sense (Kormelink et al., 1992). M RNA (4821 nucleotidi) codifica un precursore delle due glicoproteine G1 e G2 in viral complementary sense ed un altra proteina non strutturale (NSm, 34K) in viral sense (de Ávila et al., 1993) (Fig. 4). Fig. 4: Rappresentazione tridimensionale di una particella di TSWV (http://www.unb.br/ib/cel/nvme/linha1.htm). Il genoma consiste in tre segmenti a singolo filamento: S (small), M (medium) e L (large). G1 e G2: glicoproteine; N: proteina nucleocapsidica; NSs: proteina non strutturale codificata dal segmento S; NSm: proteina non strutturale codificata dal segmento M. 11

13 1.6. PIANTE OSPITI Il virus, caratterizzato da elevata polifagia, infetta piante d interesse orticolo e floricoloornamentale, siano esse dicotiledoni o monocotiledoni, tra cui solanacee, composite, leguminose e crucifere (Vicchi, 1999) (Tab. 3). È capace di infettare più di 650 specie vegetali appartenenti a 45 famiglie botaniche (Gallitelli & Davino, 1998). Nell epidemiologia di TSWV, le piante infestanti o appartenenti alla flora spontanea possono avere un ruolo importante per la capacità di fungere da serbatoio di virus (Grieco et al., 2000). Queste erbe giocano un ruolo fondamentale durante i mesi invernali, durante i quali non sono disponibili colture sensibili al virus ed i tripidi vettori non sono particolarmente attivi. Da un esperimento svolto da Groves et al. (2001) risulta che il 75% delle piante di Stellaria media e Sonchus annuus mantengono l infezione di TSWV durante l inverno. Tab. 3: Specie orticole ed industriali, piante infestanti ed appartenenti alla flora spontanea, e piante ornamentali ospiti di TSWV. Specie orticole ed industriali Piante infestanti e flora spontanea Carciofo (Cynara scolymus) 1 Amaranthus spp., Conyza Cavolo (Brassica oleracea) 2 bonariensis, Galinsoga spp., Cavolo rapa Polygonum lapathifolium, (B. oleracea var. gongyloides) 3 Portulaca oleracea, Senecio Cicoria (Cichorium spp.) 1 vulgaris, Solanum nigrum, Cocomero, melone, anguria e altre Sonchus spp., Stellaria media, Cucurbitaceae 1 Taraxacum officinale 1 Costa (Beta vulgaris var cicla) 2 Cardamine sp., Poa annua, Urtica Fava (Vicia faba) 1 sp., Veronica sp. 2 Formentino Artemisia vulgaris, Capsella (Valerianella locusta syn V. olitoria) 2 bursa-pastoris, Chenopodium Lattuga (Lactuca sativa) 1 album, Cirsium arvense, Melanzana (Solanum melongena) 1 Convolvulus arvense, Galium Patata (Solanum tuberosum) 1 aparine, Rumex sp. 3 Peperone (Capsicum annuum) 1 Lamium sp., Trifolium sp. 4 Pomodoro (Lycopersicon esculentum) 1 Tabacco (Nicotiana tabacum) 1 Piante ornamentali Alstroemeria, Anemone, Antirrhinum, Araceae, Aster, Begonia, Bouvardia, Calceolaria, Callistephus, Celosia, Cestrum, Columnea, Cyclamen, Dahlia, Dendranthema x grandiflorum, Eustoma, Fatsia japonica, Gazania, Gerbera, Gladiolus, Hydrangea, Impatiens, Iris, Kalanchoe, Leucanthemum, Limonium, Pelargonium, Ranunculus, Saintpaulia, Senecio cruentus, Sinningia, Tagetes, Verbena, Vinca, Zinnia 1 1 EPPO, Marchoux et al., Mertelík et al., Chatzivassiliou et al.,

14 1.7. SINTOMATOLOGIA I sintomi manifestati dalle numerose specie sensibili a TSWV sono estremamente vari e diversificati e possono essere facilmente confusi con quelli provocati da funghi, batteri o da fitotossicità. I sintomi consistono in nanismo, decolorazioni e mosaicature fogliari, anulature spesso concentriche con necrosi su foglie e frutti, deformazioni e decolorazioni dei petali, maculature necrotiche, malformazioni ed anulature concentriche sui frutti. Le alterazioni descritte sono influenzate dal momento in cui avviene l infezione, dalla specie interessata e da fattori ambientali, in particolare dalla temperatura (Vicchi, 1999). Anche l isolato virale e lo stadio di sviluppo della pianta al momento dell infezione condizionano il decorso della malattia (Rosselló, 1996). La necrosi inizia, spesso sulle foglie più giovani, sottoforma di piccolissime punteggiature che, allargandosi e confluendo, interessano parti consistenti della foglia (Gallitelli, 1998) SINTOMI SU POMODORO (Lycopersicon esculentum) Su pomodoro la progressiva confluenza delle aree necrotiche porta alla formazione del caratteristico sintomo definito bronzatura (Gallitelli, 1998) (Fig. 5). I sintomi, che interessano foglie e frutti con relativa perdita della produzione, compaiono sulla parte apicale della pianta con conseguente arresto di crescita ed accartocciamento, verso l alto o verso il basso, della foglia. Le più giovani assumono un tipico colore bronzeo mentre su quelle basali appaiono tacche necrotiche. Se la pianta è giovane si assiste alla sua morte precoce; se invece è più vecchia rimane avvizzita (Vicchi, 1999). A B C Fig. 5: A: Aree decolorate su frutti maturi. B e C: Sintomi di bronzatura su foglie di pomodoro (Fonti: A e B: Servizio fitosanitario cantonale, C: 13

15 SINTOMI SU MELANZANA (Solanum melongena) I principali sintomi su melanzana sono delle macchie clorotiche sulla foglia e una forte alterazione della crescita (Marchoux et al., 2000). I frutti appaiono malformati da escrescenze di forma rotondeggiante, spesso circondate da aloni necrotici (Gallitelli & Davino, 1998) SINTOMI SU LATTUGA (Lactuca sativa) La lattuga ed altre composite (indivia, cicoria, scarola, carciofo) presentano necrosi più o meno estese sulla vegetazione giovane (Fig. 6). Le infezioni precoci uccidono la pianta in poche settimane mentre quelle tardive, pur consentendo la crescita della pianta, portano a produzioni di scarso valore commerciale (Gallitelli & Davino, 1998). Fig. 6: Necrosi su foglie di lattuga SINTOMI SU MALERBE Contrariamente alle specie coltivate, la maggior parte delle specie spontanee presenta pochi sintomi o ne è totalmente priva (Marchoux et al., 2000; Chatzivassiliou et al., 2001). Stellaria media reagisce all infezione di TSWV con leggere clorosi o mosaici, mentre Galinsoga parviflora mostra importanti clorosi, necrosi e crescita ritardata (Mertelík et al., 1998). 14

16 1.8. TRASMISSIONE DEL VIRUS INSETTI VETTORI La trasmissione del virus tramite tripidi (famiglia Thripidae, ordine Thysanoptera) fu scoperta nel 1927 da Pittmann. In seguito molte ricerche hanno dimostrato il ruolo di diverse specie di Thysanoptera quali vettori di TSWV. Nove specie sono state identificate come capaci di trasmettere il virus; si tratta di Frankliniella occidentalis Pergande, F. schultzei Trybom, F. fusca Hinds, F. tenuicornis Uzel, F. intonsa Trybom, Thrips tabaci Linderman, T. palmi Karny, T. setosus Moulton e Scirtotrips dorsalis Hood (Rossellò, 1996). I tripidi sono insetti che producono molte generazioni in un anno ed essendo favoriti da temperature relativamente elevate si sviluppano bene nelle serre: il ciclo biologico è continuo ed ogni stadio può venir trovato durante tutto l anno. Questi insetti vivono sulle parti tenere della pianta, e per nutrirsi lacerano fiori, foglie e frutti, iniettando saliva e succhiando il contenuto delle cellule. (30-45 giorni) (2-5 giorni) (4-11 giorni) (4-9 giorni) (1 giorno) (2-3 giorni) Fig. 7: Ciclo biologico dei tripidi vettori di TSWV (durata dei singoli stadi in giorni) (modificato da Rettangolo punteggiato: stadio in cui l insetto acquisisce il virus. Rettangolo nero: stadi in cui l insetto può trasmettere il virus. Prepupa e pupa si trovano nel suolo. Il virus è acquisito dai tripidi solamente allo stato larvale (neanide) e le pupe, che maturano nel suolo, conservano il virus (Fig. 7). Gli adulti sono i principali responsabili della trasmissione e diffusione del virus, potendosi facilmente spostare da una foglia 15

17 all altra o da pianta a pianta, saltando o volando sospinti da correnti d aria; possono anche essere trasportati involontariamente dai coltivatori all interno delle serre. Le larve invece, non essendo dotate di grande mobilità, vivono quasi esclusivamente sulle foglie dove sono nate. Gli adulti rimangono infettivi per tutta la loro vita (della durata di alcune settimane) mentre le uova deposte nei tessuti vegetali danno origine a larve sane (Vicchi, 1999). T. tabaci era ritenuto in passato il principale vettore di TSWV. Attualmente è F. occidentalis ad essere considerato il vettore più importante (Rossellò, 1996); ciò è dovuto alla sua dispersione a livello mondiale avvenuta a partire dal F. OCCIDENTALIS PERGANDE Originaria del Nord America, F. occidentalis è presente dal livello del mare fino alle zone sub-alpine. Questo insetto si è diffuso dalla California verso le isole Canarie, l Europa, le Hawaii, la Nuova Zelanda, l isola Réunion e le zone settentrionali del Sud America (Waterhouse and Norris, 1989). Dal monitoraggio dei tripidi vettori di TSWV svolto nel 2001 in Ticino, è emerso che F. occidentalis era presente nella maggior parte delle aziende controllate (14 su 20), sia nel Sopraceneri sia nel Sottoceneri (Besomi, 2001). Il ciclo biologico del tripide conta sei stadi che vanno dall uovo all adulto. I tempi di sviluppo variano secondo la temperatura, come indicato in Tab. 4. Tab. 4: Durata in giorni di diversi stadi di sviluppo di F. occidentalis su cetriolo, in relazione alla temperatura (Nick, 1993). Temperatura ( C) Uovo (gg) Larva (gg) Da uovo a adulto(gg) I maschi adulti misurano 0,9-1,1 mm di lunghezza, le femmine 1,3-1,4 mm. Il loro colore varia dal giallo-rossastro al marrone (Fig. 8). Fig. 8: Adulto di F. occidentalis Pergande (Pinot Y. / INRA Montpellier) 16

18 F. occidentalis è una specie polifaga, segnalata su oltre 250 piante ospiti; attacca alberi da frutto, piante ortive, floricole e numerose piante erbacee infestanti (Pollini, 1998). Le piccole uova sono opache e reniformi; vengono normalmente deposte singolarmente, ma a volte si possono trovare posate in fila lungo una vena della foglia (Lewis, 1973). Le uova, molto sensibili al disseccamento, si schiudono dopo 4-11 giorni. L insetto si nutre attivamente solo durante gli stadi larvali e da adulto. Le larve del primo stadio sono bianche o trasparenti e si colorano in seguito di giallo-arancione. Questo stadio dura 2-5 giorni. Durante il secondo stadio, le larve hanno un colore giallo pallido e dopo 4-9 giorni sono pronte per mutare allo stadio ninfale (o pupa). Durante i due stadi tra la larva e l adulto (prepupa e pupa) gli individui non si nutrono (Nick, 1993). La riproduzione avviene normalmente senza fecondazione (partenogenesi); i maschi sono rari (Waterhouse and Norris, 1989). Se la femmina è stata fecondata, le uova daranno origine ad altre femmine. Una femmina produce circa 40 uova durante la sua vita. La lunghezza della vita di un adulto varia secondo il clima ed è di giorni. L acquisizione del virus avviene durante il primo stadio larvale con l alimentazione su piante infette (Wijkamp et al., 1996). L insetto diventa vettore del virus dopo un periodo di latenza durante il quale raggiunge il secondo stadio larvale; in questo periodo il virus si moltiplica nelle cellule dell epitelio del canale alimentare, nei muscoli che lo circondano e nelle ghiandole salivari (Bandla et al., 1998). Nei due stadi che seguono (prepupa e pupa) l insetto si trova nel suolo e non trasmette il virus. L adulto non lo può acquisire neanche nutrendosi di piante infette, data una particolare conformazione del canale alimentare; può trasmettere il virus unicamente se lo ha acquisito durante il primo stadio larvale T. TABACI LINDERMAN T. tabaci, originario della regione Mediterranea, è un insetto diffuso mondialmente che attacca piante appartenenti a 25 famiglie, tra cui cavoli, cipolle, melanzane, patate, pomodori, peperoni, porri e tabacco. Il ciclo biologico di quest insetto è molto simile a quello di F. occidentalis: conta sei stadi dall uovo all adulto. Il ciclo di sviluppo, da adulto ad adulto, richiede in genere giorni. La riproduzione avviene quasi esclusivamente per partenogenesi (Pollini, 1998) ALTRI MODI DI TRASMISSIONE Il virus può essere trasmesso attraverso la propagazione di parti di pianta (bulbi, tuberi, talee). Non molto rilevante dovrebbe invece essere la trasmissione tramite strumenti di lavoro (Pedrinis, 2001). I risultati di un esperimento di Antignus et al. (1997) indicano che i semi raccolti da piante contaminate con TSWV non sono infetti. La trasmissione di TSWV tramite seme è considerata possibile da alcuni autori (Gebre-Selassie et al., 1989; Marchoux et al., 2000), mentre viene esclusa da altri (Reddy, 1988). Pottorff und Newman (2001) segnalano la possibilità che TSWV venga trasmesso tramite seme di Petunia x hybrida e Lycopersicon esulentum. 17

19 Molti fattori, tra cui il ceppo virale, la specie ospite e la varietà, come pure le condizioni ambientali durante la produzione dei semi, influenzano l eventuale trasmissione tramite seme. Questo potrebbe spiegare i risultati contradditori ottenuti dai diversi ricercatori (Antignus et al., 1997) METODI DI LOTTA I possibili metodi per controllare TSWV sono: la riduzione dell inoculo, il controllo dei vettori tramite lotta fisica, chimica e biologica, e l utilizzo di varietà resistenti o tolleranti RIDUZIONE DELL INOCULO Le seguenti misure possono essere adottate per ridurre l inoculo: - controllo del trasporto di materiale vegetale, per evitare la diffusione del focolaio di infezione, nonché l introduzione di piante infette in un campo sano; - utilizzo di piantine da trapianto esenti da virus; - eliminazione di piante infestanti che possono fungere da serbatoio per il virus; - eliminazione dei residui della coltura precedente; - controllo protettivo della coltura e rimozione immediata delle prime piante infette; - rimozione dell intera coltura se l incidenza della malattia è molto elevata (Rosselló et al., 1996) CONTROLLO DEI VETTORI Il controllo della trasmissione tramite tripidi vettori, può essere effettuato con metodi fisici, chimici e biologici. I metodi fisici consistono nell uso di reti a maglie molto fini su porte e finestre nel caso di colture in serra, oppure nell utilizzo di pacciamatura riflettente per ridurre l immigrazione degli insetti. Questo metodo perde la sua efficacia a partire dal momento in cui la coltura copre interamente il suolo. Infine l uso di trappole cromotropiche blu o gialle per attestare preventivamente la presenza degli insetti, si rivela molto utile e permette l adozione immediata di misure di controllo (Rosselló et al., 1996). L impiego di insetticidi è consigliabile, anche se diverse popolazioni di F. occidentalis hanno già acquisito elevati livelli di resistenza contro alcuni principi attivi (Rosselló et al., 1996). A questo problema si aggiunge quello del particolare comportamento dei tripidi sulle piante; essi generalmente si riparano in profondità nei fiori o nelle gemme ed inoltre gli stadi quiescenti di uovo e di pupa non hanno possibilità di ingerire l insetticida (Gallitelli & Davino, 1998). La difesa chimica va dunque utilizzata non per eliminare i tripidi, bensì per controllarne la diffusione. La lotta biologica sfrutta antagonisti naturali, quali acari predatori (Amblyseius spp.) e cimici predatrici (Orius spp.). Le cimici predano i tripidi in ogni stadio dello sviluppo, mentre gli acari non attaccano gli adulti e sono inefficaci contro le larve del secondo stadio (Rosselló et al., 1996). Per un controllo adeguato bisogna introdurre un numero 18

20 elevato di predatori; bisogna inoltre rilasciare gli agenti di controllo prima che la popolazione di tripidi raggiunga proporzioni elevate (Besomi, 2001) PIANTE RESISTENTI A TSWV Il metodo più efficace per proteggere le colture dalla malattia è la selezione di piante resistenti; molti sforzi sono stati fatti per sviluppare varietà resistenti al virus (Brommonschenkel et al., 2000). La prima resistenza transgenica a TSWV è stata ottenuta con l introduzione in Nicotiana tabacum (tabacco) del gene N; sono seguite l introduzione dello stesso gene in lattuga, pomodoro e crisantemo (Hoffmann et al., 2001). In seguito sono stati identificati sette geni per la resistenza a TSWV in diverse specie del genere Lycopersicon. Il gene Sw-5, individuato in Lycopersicon peruvianum (Spassova et al., 2001), conferisce ad individui omozigoti un elevato livello di resistenza nel caso di inoculazioni meccaniche effettuate con alcuni isolati di TSWV ed anche con altri Tospovirus (GRSV, TCSV, GBNV). La resistenza non è però buona nel caso di trasmissione tramite tripidi vettori (Roselló et al., 2001). Su pomodori appartenenti a varietà resistenti ed infettati tramite tripidi, sono stati osservati sintomi di TSWV; probabilmente la presenza del gene Sw-5 causa una risposta ipersensitiva insufficiente (Aramburu et al., 2000) EVOLUZIONE DEI VIRUS I virus RNA presentano un enorme variabilità genetica, se paragonati a tutti gli altri organismi viventi. I meccanismi responsabili delle variazioni nei virus sono essenzialmente gli stessi che agiscono nell evoluzione di tutti gli organismi: mutazioni, riassortimenti e ricombinazioni (Moyer,?). Le mutazioni sono generate da errori commessi dall enzima polimerase durante la replicazione, che risultano in sostituzioni, delezioni o addizioni (Astier, 2001). A causa dell assenza di un meccanismo di riparazione di questi errori, i virus RNA presentano il tasso di mutazione più elevato di tutti gli esseri viventi (Moya et al., 2000); questo tasso di mutazione è stato stimato a circa 10-4 mutazioni per nucleotide e per replicazione (Astier, 2001). I virus RNA con genoma segmentato sono soggetti anche al riassortimento, ossia allo scambio di segmenti di genoma fra individui (Moyer,?). La ricombinazione, infine, determina la formazione di molecole di acido nucleico da materiale genetico proveniente da segmenti diversi di DNA o RNA, producendo così nuove strutture (Astier, 2001). 19

21 1.11. EVOLUZIONE DI TSWV Il genoma tripartito dei virus della famiglia Bunyaviridae permette lo scambio di informazioni genetiche fra individui, grazie al meccanismo di riassortimento (Qiu et al., 1998). La capacità di TSWV di replicarsi sia nella pianta sia nell insetto vettore e la presenza di ceppi virali o di Tospovirus diversi in infezione mista nella stessa pianta o in replicazione nello stesso vettore, possono facilmente favorire la comparsa proprio di riassortanti o di ricombinanti (Gallitello & Davino, 1998) ANALISI FILOGENETICHE Analizzando le diversità a livello delle sequenze di acidi nucleici è possibile paragonare e differenziare più organismi fra loro. Un unica base mutata in un intero genoma basta come elemento distintivo. Esistono diversi tipi di marcatori molecolari con cui sondare le differenze genomiche, ad esempio RFLP (Restriction Fragment Length Polymorphism), AFLP (Amplified Fragment-Length Polymorphism), RAPD (Random Amplification of Polymorphic DNA), SSR (Simple Sequence Repeats) oppure si può sequenziare una parte di un gene, come è il caso in questa ricerca. La distanza genetica esprime la divergenza tra unità tassonomiche (operational taxonomic unit, OTU). Le distanze tra OTU sono rappresentate graficamente sottoforma di alberi filogenetici o dendogrammi. I nodi rappresentano le unità tassonomiche e i rami che li connettono ne riassumono il percorso evolutivo. Un albero è in scala quando la lunghezza dei rami è proporzionale alla distanza genetica. Le distanze tra OTU possono essere calcolate con diversi algoritmi, in grado anche di rappresentare gli alberi. Questi algoritmi possono essere classificati in distance methods (Neighbor Joining, UPGMA) e discrete-character methods (Maximum Parsimony, Maximum likelihood). L algoritmo Neighbor Joining è basato sul principio di minimum evolution, il quale assume che l albero migliore sia quello con la minor somma della lunghezza dei rami. Neighbor Joining non esamina tutte le possibili topologie, ma ad ogni stadio del cladeing applica il principio di minimum evolution (Nei & Kumar, 2000). Una tipologia è definita come l insieme degli elementi che definiscono la struttura di un dendogramma (posizione dei nodi, lunghezza dei rami, ). L algoritmo Maximum Parsimony assume che ogni OTU evolve indipendentemente e calcola il minor numero di sostituzioni che spiegano l intero processo evolutivo; la topologia che richiede il minor numero di sostituzioni è poi mantenuta come migliore albero. Vi sono due classi di metodi di ricerca per ottenere gli alberi migliori: metodi esatti (branch and bound search) e metodi euristici (heuristic search). Con un numero di OTU maggiore di nove è consigliabile utilizzare il metodo euristico per evitare tempi di calcolo troppo elevati. Non è garantito che l albero corretto sia effettivamente generato, poiché unicamente una piccola parte degli alberi possibili è esaminata. Felsenstein (1985) ha sviluppato l algoritmo bootstrap per accordare una sicurezza statistica all ipotesi di relazione (Nei & Kumar, 2000). Il programma MEGA esegue una campionatura dei dati iniziali e genera una serie di replicati casuali che inserisce nelle sequenze originali, generandone un nuovo set che è utilizzato per creare un nuovo albero. La topologia dell albero così ottenuto è paragonata 20

22 a quello iniziale. Ad ogni ramo che coincide è assegnato il valore 1 (identity value) mentre agli altri è assegnato il valore 0. Questo processo è ripetuto più volte (generalmente 1000). In seguito è calcolata la percentuale dei casi in cui il ramo ha valore 1: questo valore è indicato come bootstrap confidence value o semplicemente bootstrap value. Un clade, definito come gruppo comprendente un antenato comune (rappresentato dal nodo da cui dipartono i rami) e tutti i suoi discendenti, è generalmente considerato significativo quando il valore bootstrap è superiore a 50% SCOPI DEL LAVORO La malattia causata da TSWV provoca ingenti danni alle numerose colture orticole ospiti del virus. In Ticino è divenuto un grave problema nel corso degli ultimi anni. In una ricerca precedente (Matasci, 2002) è stato testato un metodo (RT-PCR) che ha permesso di diagnosticare la presenza di TSWV su piante di pomodoro e di lattuga senza sintomi. Era stata inoltre segnalata la possibile funzione delle piante infestanti presenti nei tunnel come serbatoio per il virus tra una coltura e la successiva, ed era infine stata ipotizzata la possibile origine degli aplotipi presenti in Ticino. Per sviluppare una strategia di lotta è importante conoscere ancora meglio il modo di diffusione del virus, sapere in quali colture è presente, come viene importato e dove sverna. Gli scopi di questo lavoro sono di stabilire l incidenza di TSWV in varie colture orticole, di testarne la presenza in una coltura messa a dimora durante l inverno, di analizzare l importanza delle malerbe come serbatoio del virus e di valutare l evoluzione di TSWV in Ticino, determinando tramite sequenziamento quanti e quali aplotipi del virus sono presenti. 21

23 2. MATERIALE E METODI 2.1. PRELIEVO DEI CAMPIONI Il materiale analizzato è stato raccolto presso l Azienda orticola All Orto di Muzzano. In quest azienda era già stata accertata la presenza del virus nel 2000, nel 2001 e nella prima parte del Nelle serre non è stata eseguita alcuna sterilizzazione del suolo e al momento della prima, della seconda e della terza campionatura si notava una forte presenza di malerbe e piantine di pomodoro infestanti, nate da semi restati nel terreno. Sono state eseguite cinque campionature ad intervalli mensili. I campioni raccolti sono stati posti singolarmente in sacchetti di plastica e conservati a -80 C. Una visione generale delle colture presenti nell azienda e della raccolta dei campioni è presentata in Tab. 5. La prima campionatura è stata realizzata da Mauro Jermini il 18 ed il Sono stati raccolti 40 campioni ciascuno di nove colture, cercando di averne, dove possibile, 20 con sintomi e 20 senza sintomi. Le colture erano: lattuga foglia di quercia verde e lattuga foglia di quercia rossa, lattuga cappuccio, lattughino lollo rosso e lattughino lollo verde, lattuga batavia, melanzane, formentino e cavolo rapa. Il lattughino lollo verde non è stato analizzato. Al momento della campionatura erano presenti sull azienda anche rapanelli e cicoria verde. Non sono stati raccolti campioni di rapanelli poiché non sono state trovate informazioni riguardo alla sensibilità di questa coltura al virus; la cicoria invece era coltivata su una piccola superficie ed era in parte già stata raccolta. La seconda campionatura è stata eseguita il Sono stati raccolti alcuni campioni di piante infestanti (Galinsoga sp., Stellaria media e semenzali spontanei di pomodoro) e 40 campioni di coste. Il sono stati raccolti 20 campioni di S. media ed è stata fatta una valutazione della situazione riguardante le malerbe. A causa della loro abbondanza ci si è limitati a determinare le piante infestanti presenti, senza valutazione quantitativa. Il sono stati prelevati 48 campioni da piantine di lattuga foglia di quercia verde e rossa, appena trapiantate in serra. Le piantine da cui sono stati raccolti i campioni sono state contrassegnate in modo da poterle ritrovare. Lo stesso giorno sono stati raccolti otto campioni (due campioni ciascuno per quattro varietà) da piantine di lattuga non ancora trapiantate, appena arrivate sull Azienda. Il è stata eseguita la quinta ed ultima campionatura dalle stesse 48 piantine di lattuga foglia di quercia del mese precedente. 22

24 Tab. 5: Colture presenti presso l Azienda All Orto di Muzzano tra il e il , sensibilità a TSWV, data di raccolta dei campioni (numero di campioni prelevati) ed osservazioni. Coltura Ospite di TSWV Campioni raccolti Osservazioni Cavolo rapa (CR) si (40) senza sintomi Cicoria verde 1 si no piccola superficie Coste (CO) si (40) sintomi alla raccolta Formentino (FO) si (40) senza sintomi Lattuga batavia (LB) si (40) sintomi non sempre tipici Lattuga cappuccio (LC) si (40) sintomi alla raccolta Lattuga foglia di quercia rossa (LQ) si (40) sintomi non sempre tipici (24) senza sintomi (24) senza sintomi Lattuga foglia di quercia verde (LQ) si (40) sintomi non sempre tipici (24) senza sintomi (24) senza sintomi Lattuga (4 varietà) 2 si (2X4) non ancora trapiantata Lattughino lollo rosso (LR) si (40) senza sintomi Lattughino lollo verde si (40) sintomi alla raccolta Melanzana (ME) si (40) senza sintomi Rapanelli 3? no Malerbe 4 Galinsoga sp. (GA) si (17) sintomi alla raccolta Stellaria media (SM) si (2) senza sintomi (21) senza sintomi Lycopersicon esculentum (TO) si (12) sintomi alla raccolta 1 Non sono stati raccolti campioni di cicoria verde, poiché coltivata su una piccola superficie 2 Lattuga appena arrivata nell azienda e non ancora trapiantata in serra 3 Non sono state trovate informazioni sulla suscettibilità dei rapanelli a TSWV 4 Sono stati raccolti campioni delle malerbe ritenute determinanti come possibile serbatoio per il virus? Informazioni mancanti 23

25 2.2. ESTRAZIONE DI RNA Per estrarre RNA è stato utilizzato il Kit NucleoSpin Multi-96 Plant (Macherey Nagel, Oensingen, Svizzera). È stato seguito il protocollo annesso applicando alcune modifiche: 1. Polverizzare in un omogeneizzatore 50 mg di foglia contenuti in un eppendorf da 2 ml con biglie di vetro di 2,5 mm (Biospec). Aggiungere 400 µl di lysis buffer. Centrifugare per 30 sec a 1500 g (5415 D Eppendorf). Incubare a 56 C per 30 min. Non aggiungere RNase. 2. Centrifugare per 10 min a 6000 g (5415 D Eppendorf). 3. Trasferire 300 µl di supernatante in eppendorf da 1,5 ml e aggiungere 300 µl di buffer C4 e 200 µl di etanolo. Mescolare pipettando e centrifugare per 30 sec a 1500 g (5415 D Eppendorf). 4. Trasferire i campioni in una piastra NucleoSpin Multi-96 Plant. Chiudere la piastra con un foglio PE autoadesivo. 5. Sistemare la piastra NucleoSpin Multi-96 Plant su uno Square-well block e centrifugare per 2 min a 6000g (Sigma 4-15 C Qiagen). 6. Togliere il foglio PE autoadesivo e aggiungere 500 µl di wash buffer. Richiudere la piastra con un nuovo foglio PE autoadesivo e centrifugare nuovamente per 2 min a 6000g. Togliere il foglio PE autoadesivo e aggiungere 900 µl di buffer C5. Centrifugare per 5 min a 6000g. 7. Sistemare la piastra NucleoSpin Multi-96 Plant su un Round-well block. Aggiungere 100 µl di elution buffer, anticipatamente riscaldato a 70 C, direttamente sulla membrana. Incubare a temperatura ambiente per 2-3 min e centrifugare per 2 min a 6000g. Al fine di ridurre il pericolo di contaminazioni, sono stati utilizzati puntali con filtri (Eppendorf) per l estrazione di RNA, la sintesi di cdna e le amplificazioni PCR e nested PCR. 24

26 2.3. SINTESI DI cdna Per la sintesi di cdna è stata utilizzata la retrotrascrittasi derivata da Avian Myeloblastisis Virus (AMV) (Roche, Mannheim, Germania). Sono stati aggiunti al mix di reazione (Tab. 6) 5 µl di RNA totale. La sintesi è stata effettuata in un termocycler Gene Amp 9600 PCR System (Perkin Elmer Cetus), alle condizioni descritte in Tab. 7. È stato utilizzato il primer NP rev indicato in Tab. 8. Tab. 6: Mix di reazione per sintesi di cdna con primer NP. Reagenti Mix 5x Incubation Buffer 4 µl dntp Mix 10 µl Primer NP rev (10 µm) 0,5 µl AMV Reverse Transcriptase (5u/µl) 0,5 µl RNA totale 5 µl Volume totale 20 µl Tab. 7: Condizioni per la sintesi di cdna (1 ciclo) (Dewey et al., 1996). Temperatura Durata Sintesi di cdna 42 C 60 min AMV RT inactivation 94 C 2,5 min Tab. 8: Primers specifici per il gene NP di TSWV (sintetizzati da Mycrosynth, Belgach, Svizzera). Primer Coordinate 1 Sequenza Referenza NP for ATGTCTAAGGTTAAGCTC - 3 Jain et al., 1998 NP rev TTAAGCAAGTTCTGTGAG - 3 Jain et al., Coordinate sulla mappa dei nucleotidi dell isolato BR-01 (De Haan et al., 1991) 25

27 2.4. AMPLIFICAZIONE SPECIFICA TRAMITE PCR Per l amplificazione tramite PCR sono stati aggiunti 5 µl di soluzione di sintesi di cdna al mix di reazione (Tab. 9). L amplificazione è stata eseguita in un termocycler Gene Amp 9600 PCR System (Perkin Elmer Cetus) alle condizioni descritte in Tab. 10. Tab. 9: Mix di reazione per PCR specifica. Reagenti Mix Concentrazione finale ddh 2 O 6,94 µl 10 x Buffer 1,50 µl dntp Mix 0,75 µl 0,10 mm Primer NP for (10 µm) 0,30 µl 0,20 µm Primer NP rev (10 µm) 0,30 µl 0,20 µm Taq 0,21 µl 0,07 U/µl cdna 5 µl Volume totale 15 µl Tab. 10: Condizioni per PCR specifica (40 cicli). Temperatura Durata Denaturazione 94 C 30 s Annealing 53 C 30 s Estensione 72 C 1 min Estensione finale 72 C 7 min 26

28 2.5. NESTED PCR Per effettuare l amplificazione tramite nested PCR sono stati aggiunti 2 µl di prodotto PCR della prima amplificazione al mix di reazione (Tab. 11). L amplificazione è stata eseguita in un termocycler Gene Amp 9600 PCR System (Perkin Elmer Cetus) alle condizioni descritte in Tab. 12. Sono stati utilizzati i primers NPnest sviluppati da Matasci, 2002 (Tab. 13). Tab. 11: Mix di reazione per PCR specifica. Reagenti Mix Concentrazione finale ddh 2 O 21,88 µl 10 x Buffer 3,00 µl dntp Mix 1,50 µl 0,10 mm Primer NPnest for (10 µm) 0,60 µl 0,20 µm Primer NPnest rev (10 µm) 0,60 µl 0,20 µm Taq 0,42 µl 0,07 U/µl Template DNA 2 µl Volume totale 30 µl Tab. 12: Condizioni per PCR specifica (35 cicli). Temperatura Durata Denaturazione 94 C 30 s Annealing 55 C 30 s Estensione 72 C 1 min Estensione finale 72 C 7 min Tab. 13: Primers per nested PCR (sintetizzati da Mycrosynth, Belgach, Svizzera). Primer Coordinate 1 Sequenza Referenza NPnest for CCTTGAGTTTGAGGAAGATCAGA - 3 Matasci, 2002 NPnest rev CCTTTAGCATTAGGATTGCTGG - 3 Matasci, Coordinate sulla mappa dei nucleotidi dell isolato BR-01 (De Haan et al., 1991) 2.6. GEL ELETTROFORESI DEL PRODOTTO PCR Per verificare la presenza di TSWV nei campioni, 5 µl di prodotto nested PCR, a cui è stato aggiunto 1 µl di blue juice, sono stati separati su gel di agarosio 0,8% (Gibco) in 0,5xTBE contenente tracce di bromuro di etidio. 27

29 2.7. PURIFICAZIONE DEL PRODOTTO PCR Per la purificazione è stato utilizzato il QIAquick PCR Purification Kit (Qiagen, Hilden, Germania) seguendo il protocollo annesso ed applicando la seguente modifica: - punto 6: I campioni sono stati centrifugati alla massima velocità durante 2 minuti invece di 1 minuto QUANTIFICAZIONE DEL PRODOTTO PCR La stima della quantità di DNA purificato è stata effettuata confrontando la luminosità delle bande di DNA con le bande degli standard 5 ng, 25 ng e 50 ng su gel di agarosio 0,8% (Gibco) in 0,5xTBE contenente tracce di bromuro di etidio CYCLE SEQUENCING Per determinare le sequenze dei prodotti nested PCR è stato utilizzato ABI PRISM Big Dye TM Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, 2001). Ogni amplicone è stato sequenziato nelle due direzioni utilizzando i primers NPnest for e NPnest rev (Tab. 13). Le reazioni di sequenziamento sono state eseguite in un termocycler Gene Amp 9600 PCR System (Perkin Elmer Cetus) come descritto in Tab. 14, alle condizioni descritte in Tab. 15. Tab. 14: Mix di reazione per cycle sequencing. Mix Big dye 1 µl 5x rxn buffer 1 1,5 µl Primer NPnest for o NPnest rev o L1 o L2 (1,6 µμ) 1 µl ddh 2 O Y DNA (5-20 ng per NP; 3-10 ng per L) X Volume totale 10 µl 1 5x rxn buffer: 400 mm Tris HCl, 10mM MgCl 2, ph 9,0 Tab. 15: Condizioni per cycle sequencing (35 cicli). Temperatura Durata Denaturazione 96 C 10 s Annealing 50 C 5 s Estensione 60 C 4 min 28

30 2.10. PURIFICAZIONE DEI PRODOTTI DI CYCLE SEQUENCING Con questa procedura si eliminano sali, primers, ddntps e dntp non integrati. 1. Aggiungere 290 µl di ddh 2 O ad un volume di 45 µl di DNA Grade Sephadex G-50 Fine (Amersham Pharmacia Biotech), in una piastra per filtrazione MAHVN 45 (ABI PRISM). Lasciar equilibrare per 3 ore a temperatura ambiente oppure più a lungo in frigorifero. Le piastre equilibrate possono venir sigillate con una pellicola per alimenti (Saran) e conservate a 4 C in frigorifero per diverse settimane. 2. Porre la piastra per filtrazione su una piastra per titolazione (microtiter plate) e centrifugare a 900 g per 5 min (Sigma 4-15 C Qiagen). Gettare il tampone raccolto nella piastra per titolazione. 3. Aggiungere 145 µl di ddh 2 O per purificare il Sephadex e centrifugare a 900 g per 5 min (Sigma 4-15 C Qiagen). 4. Aggiungere 10 µl di acqua e 2 µl di SDS 2,2% al prodotto di reazione. Incubare in un termocycler durante 5 minuti a 98 C e durante 10 minuti a 25 C. Pipettare il tutto nella colonna di Sephadex. 5. Porre la piastra per filtrazione su una piastra (MicroAmp, Reaction Plate) e centrifugare a 900 g per 5 min (Sigma 4-15 C Qiagen). 6. Ricoprire il prodotto purificato con 20 µl di olio minerale SEQUENZIAMENTO Il sequenziamento del prodotto PCR è stato eseguito con il sequenziatore 3100 Genetic Analyzer (ABI PRISM) secondo i parametri descritti in Tab. 16. Tab. 16: Parametri di lettura delle sequenze. Lunghezza dei capillari 50 mm Run 6500 s Run temperature 50 C Run voltage 12,2 kv Injection 15 s Injection voltage 1,5 kv ELABORAZIONE DEGLI ELETTROFEROGRAMMI Per ogni campione sono state ottenute le sequenze forward e reverse. Sono stati utilizzati i programmi Sequencher 4.1 e Chromas per allineare le sequenze della matrice e quella del suo complementare. Dal confronto delle sequenze forward e reverse viene creata la sequenza consensus, dopo aver apportato eventuali correzioni ad incongruenze risaltate grazie al confronto delle stesse. 29

31 2.13. ALLINEAMENTO DELLE SEQUENZE Le sequenze sono state allineate utilizzando il programma Clustal W (Thompson et al., 1994) messo a disposizione sul sito ANALISI FILOGENETICHE Le analisi filogenetiche sono state eseguite con il programma MEGA (Molecular Evolutionary Genetics Analysis), versione 2.1 (Kumar et al., 2001). I dendogrammi sono stati generati con l algoritmo Neighbour Joining (NJ). Per le sequenze di 513 nucleotidi è stato scelto il modello Jukes-Cantor mentre per le sequenze di 171 aminoacidi è stato utilizzato il modello Gamma Distance. Per l analisi statistica bootstrap sono state effettuate 1000 ripetizioni. Le biforcazioni con valore bootstrap inferiore a 50 % sono state eliminate poiché non significative e i rami sono stati fusi. Le analisi di distanza sono state eseguite con Compute Pairwise, modello Nucleotide, N of differences. Il numero di sostituzioni sinonime e non sinonime è stato calcolato con il metodo di Nei-Gojobori, N of differences. Sono state eseguite analisi su tre livelli: sono state dapprima considerate unicamente le sequenze trovate durante questa ricerca, in seguito sono state prese in considerazione tutte le sequenze ticinesi (comprese quindi quelle rilevate da Matasci, 2002) ed infine è stato effettuato un confronto delle sequenze trovate in Ticino con quelle pubblicate in GenBank. 30

32 3. RISULTATI 3.1. INCIDENZA DI TSWV IN OTTO COLTURE ORTICOLE Per stabilire l incidenza di TSWV sono stati analizzati 176 campioni prelevati da otto colture presso l Azienda All Orto di Muzzano, durante l autunno Sono state presi in considerazione: cavolo rapa, coste, formentino, lattuga batavia, lattuga cappuccio, lattuga foglia di quercia verde e rossa, lattughino lollo rosso e melanzane. Quattro di queste colture (cavolo rapa, formentino, lattughino lollo rosso e melanzane) non presentavano sintomi al momento della raccolta dei campioni. Per le altre colture sono stati prelevati campioni da piante apparentemente sane e da piante con sintomi, distribuite omogeneamente nelle campate. Le colture lattuga batavia e lattuga foglia di quercia presentavano dei sintomi non attribuibili con certezza a TSWV. Le restanti colture (coste e lattuga cappuccio) mostravano invece dei sintomi evidenti della presenza del virus. Il 68,2 % dei campioni analizzati, scelti casualmente tra quelli raccolti, si è rivelato essere infetto, vale a dire che 120 campioni sono risultati positivi all analisi molecolare (nested RT-PCR) (Tab. 17). Tab. 17: Incidenza di TSWV in otto colture orticole. Campioni raccolti presso l Azienda All Orto di Muzzano in ottobre-novembre Coltura CR FO LR ME LB FQ CO LC Totale Presenza di sintomi 1 no no no no?? si si Campioni analizzati (di cui con sintomi) 24 (0) 16 (0) 24 (0) 24 (0) 16 (7) 24 (5) 24 (6) 24 (16) 176 (34) Campioni infetti (di cui con sintomi) 6 (0) 9 (0) 16 (0) 13 (0) 13 (6) 23 (5) 16 (5) 24 (16) 120 (32) Campioni infetti (%) CR: cavolo rapa; FO: formentino; LR: lattughino lollo rosso; ME: melanzane; LB: lattuga batavia; FQ: lattuga foglia di quercia; CO: coste; LC: lattuga cappuccio. 1 no: nessun sintomo visibile;?: sintomi non attribuibili con certezza a TSWV; si: sintomi evidenti della presenza di TSWV. In tutte le colture analizzate è stata rilevata la presenza del virus. La distribuzione delle piante infette nelle campate è rappresentata in appendice in Fig. 1A. 34 campioni analizzati (su 176) presentavano sintomi al momento del prelievo. 32 di questi sono risultati effettivamente infetti. Un campione di lattuga batavia e un campione di coste che presentavano sintomi non sono risultati positivi all analisi (Tab. 17). Le colture che mostravano in una parte delle piante dei sintomi evidenti della presenza di TSWV, presentano la percentuale maggiore di campioni risultati infetti (66,7 % nel caso delle coste e 100 % nel caso di lattuga cappuccio). Le colture su cui non erano visibili tracce del virus, hanno una percentuale di campioni infetti che varia dal 25 % (cavoli rapa) al 66,7 % (lattughino lollo rosso). Le due colture con sintomi non tipici si situano in 31

33 una posizione intermedia tra i due gruppi precedenti, con percentuali di 81,3 % (lattuga batavia) e di 95,8 % (lattuga foglia di quercia) (Fig. 9). Campioni senza sintomi Sintomi non certi Con sintomi Percentuale di campioni infetti CR FO LR ME LB FQ CO LC Coltura Fig. 9: Percentuale di campioni infetti da TSWV nelle diverse colture. Campioni raccolti presso l Azienda All Orto di Muzzano in ottobre-novembre CR: cavolo rapa; FO: formentino; LR: lattughino lollo rosso; ME: melanzane; LB: lattuga batavia; FQ: lattuga foglia di quercia; CO: coste; LC: lattuga cappuccio. 32

34 3.2. INCIDENZA DI TSWV IN UNA COLTURA INVERNALE Per testare l eventuale presenza di TSWV in una coltura messa a dimora e coltivata durante il periodo in cui i tripidi vettori del virus non sono attivi o sono attivi in misura ridotta, sono stati analizzati 41 campioni di lattuga foglia di quercia, prelevati il 24 febbraio 2003 nell azienda orticola di Muzzano. Le piante erano state messe a dimora il 15 gennaio. La coltura non presentava sintomi al momento del prelievo e non ne ha mostrati fino alla raccolta ( ). Il 19,5 % dei campioni è risultato positivo all analisi tramite nested RT-PCR (Tab. 18). Per mancanza di tempo non è stato possibile analizzare i campioni prelevati dalle stesse piante il Tab. 18: Incidenza di TSWV in una coltura invernale. Campioni raccolti presso l Azienda All Orto di Muzzano in febbraio Coltura Lattuga foglia di quercia Presenza di sintomi nessun sintomo visibile Campioni analizzati 41 Campioni infetti 8 Campioni infetti (%) 19.5 La distribuzione delle piante infette nelle campate è rappresentata in appendice in Fig. 2A. 33

35 3.3. PIANTE INFESTANTI Data l importanza, indicata nella letteratura, delle piante infestanti presenti nei tunnel quale serbatoio per TSWV, è stata fatta una valutazione della situazione riguardante le malerbe nell azienda orticola di Muzzano dove sono stati raccolti i campioni per gli esperimenti descritti precedentemente (vedi 3.1 e 3.2). Nei settori della serra presi in considerazione, il terreno era quasi totalmente coperto da Galinsoga sp. e S. media (Fig. 10). A B C Fig. 10: Azienda all Orto, Muzzano: tunnel coltivato con lattughino lollo verde (situazione al ). A: Terreno quasi totalmente coperto da malerbe. B: Stellaria media. C: Galinsoga sp. Data l abbondanza di malerbe non è stato possibile eseguire una valutazione quantitativa e ci si è limitati a determinare le piante infestanti presenti (Tab. 19). Sono considerate malerbe anche i pomodori ed i formentini presenti in campate coltivate con altre specie. 34

36 Tab. 19: Piante infestanti presenti presso l Azienda All Orto di Muzzano il e loro suscettibilità a TSWV. 1 presenti come malerbe in altre colture? informazioni mancanti Nome Ospite di TSWV Fragaria sp.? Galinsoga sp. si Galium sp. si Lycopersicon esculentum 1 si Oxalis acetosella si Polygonum sp. si Potentilla reptans? Rumex sp. si Stellaria media si Urtica dioica si Valerianella locusta syn V. olitoria 1 si Veronica filiformis si Quasi tutte le malerbe presenti sono ospiti di TSWV e potrebbero quindi effettivamente fungere da serbatoio per il virus. Per confermare quest ipotesi sono stati analizzati 46 campioni prelevati durante l autunno 2002 dai tre ospiti di TSWV presenti in quantità maggiore e quindi particolarmente importanti come potenziali serbatoi. S. media non mostrava sintomi al momento del prelievo; Galinsoga sp. e le piantine di pomodoro presentavano delle leggere necrosi. L 82,6 % dei campioni analizzati sono risultati positivi all analisi molecolare (Tab. 20). Tab. 20: Incidenza di TSWV nelle piante infestanti. Campioni raccolti presso l Azienda All Orto di Muzzano in novembre-dicembre Ospite S. media Galinsoga sp. Pomodoro Totale Presenza di sintomi 1 no?? Campioni analizzati Campioni infetti Campioni infetti (%) no: nessun sintomo visibile;?: sintomi non attribuibili con certezza a TSWV. In tutte le specie è stata osservata la presenza del virus. Per Galinsoga sp. e pomodoro l incidenza di TSWV era del 100 %; per S. media del 63,6 % (Fig. 11). 35

37 Campioni senza sintomi Sintomi non certi Percentuale di campioni infetti S. media Galinsoga sp. Pomodoro Ospite Fig. 11: Percentuale di campioni infetti da TSWV nelle diverse piante infestanti. Campioni raccolti presso l Azienda All Orto di Muzzano in novembre-dicembre SEQUENZE DEI CAMPIONI ANALIZZATI Tramite sequenziamento dei prodotti PCR, sono state ottenute le sequenze nucleotidiche di 154 campioni, così ripartiti: 112 campioni prelevati da otto colture per stabilire l incidenza di TSWV (3.1.), sei campioni raccolti dalla coltura invernale (3.2.) e 36 campioni di piante infestanti (3.3.) (Tab. 21). Tab. 21: Numero di sequenze nucleotidiche di TSWV ottenute per i diversi ospiti del virus. Ospite CR FO LR ME LB FQ CO LC SM GA TO Totale Sequenze ottenute CR: cavolo rapa; FO: formentino; LR: lattughino lollo rosso; ME: melanzane; LB: lattuga batavia; FQ: lattuga foglia di quercia; CO: coste; LC: lattuga cappuccio; SM: S. media; GA: Galinsoga sp.; TO: pomodoro. In totale 166 campioni su 263 analizzati erano risultati infetti dal virus (120 campioni prelevati dalle otto colture, otto campioni della coltura invernale e 38 di piante infestanti). I 12 campioni di cui non si hanno a disposizione le sequenze nucleotidiche sono i seguenti: quattro campioni che presentano su gel bande doppie e otto campioni le cui sequenze non sono risultate leggibili, pur avendo ripetuto il sequenziamento. Per i campioni con bande doppie è stata fatta un estrazione da gel per il sequenziamento che non ha dato risultati soddisfacenti; per mancanza di tempo non si è potuto ripetere l esperimento. 36

38 Le sequenze ottenute dai campioni analizzati hanno una lunghezza comune di 513 nucleotidi, che corrisponde al 66 % del gene NP (777nt). Due sequenze hanno lunghezze ridotte di 431 (TI01ME03), rispettivamente 196 nucleotidi (TI02LR21) (Fig. 12). M TO01 ME03 CR05 LR21 FQ29 M Fig. 12: Gel elettroforesi di prodotti nested PCR di TSWV, sintetizzati da RNA estratto da campioni di foglia, prelevati il presso l Azienda All Orto di Muzzano. M: 100 bp ladder. TO01, ME03, CR05, LR21, FQ29: campioni di pomodoro, melanzana, cavolo rapa, lattughino lollo rosso e lattuga foglia di quercia APLOTIPI Sui campioni di foglia prelevati dalle undici specie ospiti di TSWV sono stati trovati 30 diversi aplotipi del virus. I nomi da assegnare agli aplotipi sono stati composti sull esempio di quanto fatto da Matasci (2002): si compongono della sigla del canton Ticino (TI), dell anno in cui è stato rinvenuto la prima volta l aplotipo, di un abbreviazione relativa alla coltura su cui è stato trovato per la prima volta e, diversamente da Matasci che assegnava delle lettere, di un numero a due cifre (da 01 fino a 30). Le abbreviazioni relative alla coltura sono: CR: cavolo rapa; FO: formentino; LR: lattughino lollo rosso; ME: melanzane; LB: lattuga batavia; FQ: lattuga foglia di quercia; CO: coste; LC: lattuga cappuccio; SM: S. media; GA: Galinsoga sp.; TO: pomodoro. 29 dei 30 aplotipi risultano nuovi; uno (il più frequente) è invece identico agli aplotipi TI01TOA e TI01TOD indicati da Matasci (2002). Questi due aplotipi si differenziavano nel confronto delle sequenze di 638 nucleotidi, ottenute con primers NP, mentre risultavano identici confrontando le sequenze più corte ottenute con nested primers NP. Agli aplotipi in questione è stato assegnato in questo studio un nome comune (TI01TO01) per poter seguire un ordine crescente nei nomi da assegnare ai diversi aplotipi. In Tab. 22 sono elencati i 30 aplotipi, il numero di campioni in cui sono stati trovati in ogni specie, il totale di campioni per ogni aplotipo, il totale di campioni per specie e il totale di aplotipi per specie. Non avendo a disposizione lo stesso numero di campioni per ogni ospite e per poterne comunque paragonare i dati, è stato calcolato il rapporto aplotipi/campione, che informa sulla variabilità genetica incontrata nelle diverse specie. 37

39 Tab. 22: Specie ospiti di TSWV: totale di campioni per ogni aplotipo, di campioni per specie, di aplotipi per specie, e rapporto aplotipi/campioni. Campioni raccolti presso l Azienda All Orto di Muzzano nel 2002 e nel Specie Aplotipo CR FO LR ME LB FQ CO LC SM GA TO Campioni/aplotipo TI01TO TI02ME TI02ME TI02ME TI02CR TI02CR TI02CR TI02FO TI02FO TI02FO TI02SM TI02CO TI02CO TI02CO TI02CO TI02CO TI02LR TI02LR TI02LR TI02LR TI02LR TI02LR TI02LB TI02FQ TI02FQ TI02FQ TI02FQ TI02LC TI02FQ TI02FQ Campioni/specie Aplotipi/specie Aplotipi/campioni* CR: cavolo rapa; FO: formentino; LR: lattughino lollo rosso; ME: melanzane; LB: lattuga batavia; FQ: lattuga foglia di quercia; CO: coste; LC: lattuga cappuccio; SM: S. media; GA: Galinsoga sp.; TO: pomodoro. * Aplotipi/campioni=(Aplotipi/specie)/(Campioni/specie); informa sulla variabilità genetica. Tre aplotipi sono stati rinvenuti in più di un campione: TI01TO01, TI02ME02 e TI02FO08. L aplotipo TI01TO01 è il più frequente: è stato trovato più volte in tutte le colture analizzate, per un totale di 122 campioni. L aplotipo TI02ME02 è stato rilevato in tre campioni di foglie di melanzana. L aplotipo TI02FO08 è presente in un campione di formentino ed in uno di Galinsoga sp. Gli altri 27 aplotipi sono stati trovati una volta 38

40 sola. In appendice sono elencati i nomi dei campioni in cui sono stati trovati i diversi aplotipi (Tab. 1A e 2A). I valori più alti del rapporto aplotipi/campioni sono quelli di cavolo rapa e formentino, che sono quindi le colture che presentano una maggiore variabilità: in entrambi i casi sono stati rinvenuti quattro aplotipi in sei campioni, per un rapporto di 0,67 aplotipi/campione. Nelle colture lattughino lollo rosso e lattuga foglia di quercia sono stati trovati sette aplotipi in 15 rispettivamente 28 campioni; si ottengono rapporti di 0,47 rispettivamente 0,25 aplotipi/campione. Seguono le colture coste e melanzane con sei aplotipi in 14 campioni (0,43 aplotipi/campione), rispettivamente quattro aplotipi in 13 campioni (0,31 aplotipi/campione). Sono stati trovati due aplotipi in ognuna delle specie seguenti: S. media (12 campioni, ossia 0,17 aplotipi/campione), lattuga batavia (13 campioni, 0,15 aplotipi/campione), Galinsoga sp. (16 campioni, 0,13 aplotipi/campione) e lattuga cappuccio (23 campioni, 0,09 aplotipi/campione). Infine i pomodori, con un solo aplotipo in otto campioni, hanno un rapporto di 0,13 aplotipi/campione. Il valore più basso è quello della coltura lattuga cappuccio che presenta la minor variabilità genetica. Il totale di 30 aplotipi in 154 campioni sequenziati dà un valore di 0,19 aplotipi/campione. 39

41 3.6. ANALISI FILOGENETICHE Per svolgere le analisi considerando tutte le sequenze trovate in Ticino (comprese quelle rilevate da Matasci, 2002) è stata verificata l esistenza degli aplotipi TI02LEL e TI02LEM. La loro presenza non era ritenuta certa a causa di mutazioni dubbie (vedi 1.3.). Ripetendo il sequenziamento del prodotto purificato si è potuta dimostrare l esistenza di queste sostituzioni. Il collocamento delle sequenze ticinesi a livello mondiale è stato effettuato tenendo conto di 30 sequenze depositate in GenBank (Tab. 23). Tab. 23: Sequenze del gene NP di TSWV depositate in GenBank (modificato da Matasci, 2002). Nome Nazione Ceppo Isolato Ospite Referenza Accession number LE Germania TSWV LE 98/527 Lysimachia Heinze et al., 2001 AJ TSWVBL Hawaii TSWVBL Lattuga Jain et al., 1998 L20953 TSWV10W Hawaii TSWV10W? Jain et al., 1998 L20887 TSWVH Hawaii? Gubba, AF TSWVHI 2 Hawaii L? Jain et al., 1998 X61799 TSWVIT Italia Italy T304 Pomodoro Vaira et al., 1995 Z Spain 3 Spagna LC? Guerra-Sanz 1 X94550 TSWV10 USA 4 TSWV10 Arachide Qiu et al., 1998 AF TSWVGACC Georgia CC Tabacco Pappu et al,1998 AF TSWVGAPP Georgia - Peperone Jain et al., 1998 AF TSWVGAWC Georgia WC Tabacco Pappu et al,1998 AF TSWVGAGC Georgia GC Tabacco Pappu et al,1998 AF TSWVGAMC Georgia MC Tabacco Pappu et al,1998 AF TSWVGAPT Georgia - Arachide Jain et al., 1998 AF TSWVGATC Georgia TC Tabacco Pappu et al,1998 AF TSWVGAAC Georgia AC Tabacco Pappu et al,1998 AF TSWVGATO Georgia - Pomodoro Jain et al., 1998 AF TSWVBR01 Brasile CPNH9 Tabacco de Haan et al., 1991 D de Haan 1989, 1990 TSWVD Olanda TSWVD Dalia Qiu et al., 1998 AF C27084 Cechia C27084 Zantdeschia Adam et al., 1996 AJ Heinze et al., 2001 TOSPOG Taiwan TOSPOG? Kato, AB TOSPOC Taiwan TOSPOC? Kato, AB JAP Giappone -? Tsuda et al., 1994 AB Hip9612 Bulgaria 8Hip Hippeastrum Heinze et al., 2001 AJ Da961 Bulgaria 20 Da 96/1 Dalia Heinze et al., 2001 AJ TSWVL3 Bulgaria Tabacco Maiss et al., 1991 D de Haan et al.,1990 GD98 Bulgaria TSWV GD98 Tabacco Heinze et al., 2001 AJ Bulg97 5 Bulgaria 97 Pomodoro Heinze et al., 2001 AJ BS97 Bulgaria TSWV BS97 Tabacco Heinze et al., 2001 AJ Sud Africa 98 / 0472 Patata Heinze et al., 2001 AJ Non pubblicato 2 Citato anche come hil e TSWVL 3 Anonimo in GenBank 4 Nessuna indicazione ulteriore 5 Citato anche come 97To97? Dati mancanti 40

42 Le analisi filogenetiche sono state effettuate senza prendere in considerazione gli aplotipi TI02ME03 e TI02LR21, considerevolmente più corti (Fig. 12), poiché rendono meno visibili le differenze fra gli altri aplotipi. In appendice sono rappresentati i dendogrammi basati sulle sequenze nucleotidiche e aminoacidiche di tutti gli aplotipi ticinesi, compresi TI02ME03 e TI02LR21e di 30 sequenze pubblicate in GenBank (Fig. 3A e Fig. 4A). La sequenza TI02LC28 contiene una N alla 60esima base della sequenza forward, rispettivamente base numero 502 della sequenza reverse, a causa della presenza di due segnali sovrapposti (Fig. 13). Per mancanza di tempo non è stato possibile risequenziare il prodotto per stabilire quale delle due basi (C o T) è effettivamente presente o per eventualmente confermare l esistenza di un infezione mista nell isolato in questione. Se ci fosse solo la base T, l aplotipo sarebbe identico a TI01TO01; se ci fosse invece solo la base C, l aplotipo non sarebbe identico a nessuno di quelli trovati finora. Il programma MEGA considera uguali le sequenze TI02LC28 e TI01TO01 a causa della presenza di questa N e non segnala quindi nessuna differenze fra le due sequenze (Tab. 24 e Tab. 27). Fig. 13: Cromatogramma della sequenza reverse di TSWV dell aplotipo TI02LC28, rilevato in un campione di lattuga cappuccio prelevato a Muzzano nel N indica la presenza di due segnali sovrapposti (C e T) VARIABILITÀ DELLE SEQUENZE SEQUENZE TROVATE DURANTE QUESTA RICERCA Paragonando fra loro i 28 aplotipi trovati nel 2002 e 2003 si arriva ad un massimo di sette nucleotidi diversi (Tab. 24) e di cinque aminoacidi diversi (Tab. 25). La sequenza TI02LC28 risulta identica a TI01TO01 a causa della presenza di una N (vedi 3.6.). La maggior parte delle sostituzioni sono sinonime; non portano quindi ad un cambiamento dell aminoacido codificato (Tab. 26). 41

Le malattie virali economicamente rilevanti per la qualità dell orticoltura protetta della Sicilia

Le malattie virali economicamente rilevanti per la qualità dell orticoltura protetta della Sicilia Convegno: Strategie per il Miglioramento dell Orticoltura Protetta in Sicilia - Vittoria (RG), 25-26 Novembre 2005 Le malattie virali economicamente rilevanti per la qualità dell orticoltura protetta della

Dettagli

Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi

Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi Lavoro di diploma Caterina Matasci Febbraio Giugno Swiss Federal Institute

Dettagli

VIROSI DEL PEPERONE E DEL POMODORO

VIROSI DEL PEPERONE E DEL POMODORO VIROSI DEL PEPERONE E DEL POMODORO I virus che più comunemente colpiscono queste colture, e che negli ultimi anni hanno causato gravi perdite di prodotto commerciale, sono il virus del mosaico del cetriolo

Dettagli

NUOVE VIROSI DEL POMODORO

NUOVE VIROSI DEL POMODORO NUOVE VIROSI DEL POMODORO Monitoraggio e uso sostenibile dei prodotti fitosanitari: le attività del servizio fitosanitario, 29 Maggio 2014 Andrea Taddei e Francesca Gaffuri Servizio fitosanitario regionale

Dettagli

L emergenza virosi nelle coltivazioni intensive

L emergenza virosi nelle coltivazioni intensive Centro di ricerca per la Patologia Vegetale - Roma L emergenza virosi nelle coltivazioni intensive Marina Barba CREA-PAV A. Ciufalo, B. Giuliano, F. Miracolo Rete Agronomica Anicav Il filo rosso del pomodoro

Dettagli

Il virus del mosaico del pepino su pomodoro in Svizzera. Olivier Schumpp

Il virus del mosaico del pepino su pomodoro in Svizzera. Olivier Schumpp Il virus del mosaico del pepino su pomodoro in Svizzera Struttura della presentazione 1. Epidemiologia & diagnostica 2. Metodi diagnostici 3. Situazione del PepMV in Svizzera 4. La protezione incrociata

Dettagli

I nematodi a cisti della patata. Alba Cotroneo

I nematodi a cisti della patata. Alba Cotroneo I nematodi a cisti della patata Alba Cotroneo Globodera spp È uno dei principali parassiti delle regioni temperate e fredde Larva STORIA G. rostochiensis e G. pallida sono originari delle montagne andine;

Dettagli

Marcatori molecolari

Marcatori molecolari Marcatori molecolari Caratteristiche e applicazioni Luca Gianfranceschi e Rosanna Marino 1 I marcatori molecolari Strumento per l analisi genetica Strumento Molecolari Analisi genetica Marcatori non oggetto

Dettagli

PROGRAMMAZIONE DI GEOGRAFIA CLASSE SECONDA A.S

PROGRAMMAZIONE DI GEOGRAFIA CLASSE SECONDA A.S 1. L EUROPA E L UNIONE EUROPEA: la formazione dell Europa, la società europea, l unione europea (vol. I) 2. L EUROPA FISICA E POLITICA IN GENERALE (ripasso) 2. L EUROPA MEDITERRANEA: Spagna, Andorra, Principato

Dettagli

IL PROBLEMA DELLA VIROSI DA GPGV IN VITICOLTURA. Alessandro Raiola

IL PROBLEMA DELLA VIROSI DA GPGV IN VITICOLTURA. Alessandro Raiola IL PROBLEMA DELLA VIROSI DA GPGV IN VITICOLTURA Alessandro Raiola LA SCOPERTA DI UN NUOVO VIRUS DELLA VITE 2012 GPGV: Grapevine pinot gris virus Il GPGV, Virus del Pinot Grigio, è stato identificato per

Dettagli

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

16 11 Virus e viroidi 45%

16 11 Virus e viroidi 45% Le avversità del pomodoro sono circa 200 16 11 Virus e viroidi 45% 45 Funghi 28% 28 Abiotiche 16% Batteri e fitoplasmi 11% Assieme a nematodi e fitofagi, le malattie del pomodoro portano a perdite produttive

Dettagli

Microbiologia clinica

Microbiologia clinica Microbiologia clinica Docente : Prof. Ubaldo Scardellato Testo: MICROBIOLOGIA CLINICA Eudes Lanciotti Cea ed. 2001 Temi cardine del programma 1. Lo sviluppo della microbiologia come scienza. 2. La natura

Dettagli

Epidemiologia alternariosi del pomodoro

Epidemiologia alternariosi del pomodoro M. COLLINA R. BUGIANI Centro di Fitofarmacia Servizio Fitosanitario Dipartimento di Scienze Agrarie Regione Emilia - Romagna Epidemiologia alternariosi del pomodoro Incontro tecnico: Difesa da peronospora

Dettagli

IMPATTO DELLA PHTHORIMEA OPERCULELLA SULLA COLTURA DELLA PATATA

IMPATTO DELLA PHTHORIMEA OPERCULELLA SULLA COLTURA DELLA PATATA IMPATTO DELLA PHTHORIMEA OPERCULELLA SULLA COLTURA DELLA PATATA BOLOGNA 22-10- 2013 Dr. D. D Ascenzo Servizio Fitosanitario Abruzzo Per poter inquadrare correttamente la problematica della tignola è importante

Dettagli

Incontro tecnico la frutticoltura: PSA-Batteriosi dell actinidia: sintomi, diagnosi e situazione in provincia di Brescia Martedì 17 Dicembre 2013

Incontro tecnico la frutticoltura: PSA-Batteriosi dell actinidia: sintomi, diagnosi e situazione in provincia di Brescia Martedì 17 Dicembre 2013 Incontro tecnico la frutticoltura: PSA-Batteriosi dell actinidia: sintomi, diagnosi e situazione in provincia di Brescia Martedì 17 Dicembre 2013 Francesca Gaffuri-Laboratorio Fitopatologico Regione Lombardia-

Dettagli

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DEL COMELICO SAPPADA: ANNI

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DEL COMELICO SAPPADA: ANNI I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DEL COMELICO SAPPADA: ANNI 2005-2015 Premessa In queste pagine viene presentato l'approfondimento per comprensorio turistico della precedente

Dettagli

Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza. O.G.M. Vegetali

Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza. O.G.M. Vegetali Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza O.G.M. Vegetali Identificazione di un O.G.M. e metodi di analisi del DNA transgenico Marco Nani 5BL Liceo Scientifico Mattei di Fiorenzuola

Dettagli

9 dicembre 2015 Villanova di Castenaso STRATEGIE DI DIFESA. della patata. Massimo Bariselli Servizio Fitosanitario Emilia Romagna

9 dicembre 2015 Villanova di Castenaso STRATEGIE DI DIFESA. della patata. Massimo Bariselli Servizio Fitosanitario Emilia Romagna STRATEGIE DI DIFESA della patata Massimo Bariselli Servizio Fitosanitario Emilia Romagna La patata come tutte le solanacee, è originaria del continente americano Alcune fra le principali avversità della

Dettagli

Principali problematiche fitosanitarie nell orticoltura piemontese.

Principali problematiche fitosanitarie nell orticoltura piemontese. Principali problematiche fitosanitarie nell orticoltura piemontese. Giovanna Gilardi, M.L.Gullino, Angelo Garibaldi Boves, 9-10 dicembre 2010 Uso sostenibile dei fumiganti per il contenimento dei patogeni

Dettagli

L attività diagnostica delle malattie virali sulla coltura della rapa: risultati dei rilievi eseguiti nel 2009

L attività diagnostica delle malattie virali sulla coltura della rapa: risultati dei rilievi eseguiti nel 2009 Villa Chiozza, 11 marzo 2010 L attività diagnostica delle malattie virali sulla coltura della rapa: risultati dei rilievi eseguiti nel 2009 a cura di: Peressini Silvano Laboratorio di Fitovirologia Servizio

Dettagli

Capitolo 8. Turismo Comune di Lecce - Ufficio Statistica di Lecce - Ufficio Statistica 127

Capitolo 8. Turismo Comune di Lecce - Ufficio Statistica di Lecce - Ufficio Statistica 127 Capitolo 8. Turismo Comune di Lecce - Ufficio Statistica 127 8. Turismo L'analisi delle strutture ricettive e del loro utilizzo evidenzia che nel 2008 nella categoria esercizi alberghieri gli alberghi

Dettagli

Cinipide del Castagno in Campania

Cinipide del Castagno in Campania Cinipide del Castagno in Campania Dryocosmus kuriphilus Yasumatsu 28 Maggio 2008 Montoro sup.- AV Castagno : Superficie -Superficie Nazionale a castagneto da Frutto coltivato 150 000 Ha -Superficie in

Dettagli

CRIMEAN-CONGO HAEMORRHAGIC FEVER

CRIMEAN-CONGO HAEMORRHAGIC FEVER CRIMEAN-CONGO HAEMORRHAGIC FEVER Crimean-Congo haemorrhagic fever Riconosciuta per la prima volta in Crimea nel 1944, poi più tardi in Congo nel 1969. Infezione virale di ruminanti ed erbivori domestici

Dettagli

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CORTINA D'AMPEZZO: ANNI

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CORTINA D'AMPEZZO: ANNI Premessa I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CORTINA D'AMPEZZO: ANNI 2005-2015 In queste pagine viene presentato l'approfondimento per comprensorio turistico della precedente

Dettagli

SCHEDA TECNICA PER IL RICONOSCIMENTO DEGLI ORGANISMI NOCIVI DA QUARANTENA (DIRETTIVA CEE 77/93)

SCHEDA TECNICA PER IL RICONOSCIMENTO DEGLI ORGANISMI NOCIVI DA QUARANTENA (DIRETTIVA CEE 77/93) SCHEDA TECNICA PER IL RICONOSCIMENTO DEGLI ORGANISMI NOCIVI DA QUARANTENA (DIRETTIVA CEE 77/93) Avversità: avvizzimento batterico o marciume bruno Organismo nocivo: Pseudomonas solanacearum (Rastonia solanacearum)

Dettagli

Informazioni Statistiche

Informazioni Statistiche Informazioni Statistiche Settore Sistema Informativo di supporto alle decisioni. Ufficio Regionale di Statistica Maggio 20 L'utilizzo del Cloud Computing nelle imprese con almeno 10 addetti L Istat realizza

Dettagli

Il turismo nella Provincia di Forlì-Cesena - Anno 2014

Il turismo nella Provincia di Forlì-Cesena - Anno 2014 Il turismo nella Provincia di Forlì-Cesena - Anno 2014 Assessorato al Turismo della Provincia di Forlì-Cesena CAPACITÀ RICETTIVA 2014 Complessivamente 2.807 strutture ricettive con un offerta di 70.458

Dettagli

Fitoplasmi e fitoplasmosi

Fitoplasmi e fitoplasmosi Fitoplasmi e fitoplasmosi Ripresa vegetativa anticipata Scopazzi Malformazioni al frutto Sintomi causati da fitoplasmi Fillomania Virescenza Ingrossamento stipole FITOPLASMI IN CELLULE DEL FLOEMA AL TEM

Dettagli

Sintesi statistiche sul turismo. Estratto di Sardegna in cifre

Sintesi statistiche sul turismo. Estratto di Sardegna in cifre Sintesi statistiche sul turismo Estratto di Sardegna in cifre 2015 1. Sommario Le fonti dei dati e degli indicatori..... 3 1.1 - Capacità degli esercizi alberghieri e extra-alberghieri - Sardegna e Italia...

Dettagli

Credito ai Consumatori in Europa a fine 2012

Credito ai Consumatori in Europa a fine 2012 Credito ai Consumatori in Europa a fine 2012 Introduzione Crédit Agricole Consumer Finance ha pubblicato, per il sesto anno consecutivo, la propria ricerca annuale sul mercato del credito ai consumatori

Dettagli

CONSIGLIO NAZIONALE DELLE RICERCHE ISTITUTO DI BIOLOGIA AGROAMBIENTALE E FORESTALE

CONSIGLIO NAZIONALE DELLE RICERCHE ISTITUTO DI BIOLOGIA AGROAMBIENTALE E FORESTALE Istituto di Biologia Agro-Ambientale e Forestale (IBAF) Unità Operativa di Supporto di Legnaro Borsa relativa al bando n IBAF.BS.01/2013.PD Borsista: Penelope Zanolli RELAZIONE DI FINE ANNO DI BORSA DI

Dettagli

Diserbo cipolla 2014

Diserbo cipolla 2014 Diserbo cipolla 2014 Renato Danielis Costantino Cattivello ERSA - Servizio Fitosanitario e Chimico, Ricerca, Sperimentazione e assistenza tecnica -Via Sabbatini 5 33050 Pozzuolo del Friuli- Tel. 0432 529221

Dettagli

TRASFORMAZIONE GENETICA DI SPINACIO (SPINACIA OLERACEA L.) MEDIATA DA AGROBACTERIUM TUMEFACIENS

TRASFORMAZIONE GENETICA DI SPINACIO (SPINACIA OLERACEA L.) MEDIATA DA AGROBACTERIUM TUMEFACIENS LABORATORIO DI BIOTECNOLOGIE VEGETALI (Prof. Alma Balestrazzi) TRASFORMAZIONE GENETICA DI SPINACIO (SPINACIA OLERACEA L.) MEDIATA DA AGROBACTERIUM TUMEFACIENS CHE COSA SONO LE PIANTE TRANSGENICHE? Le piante

Dettagli

TRIESTE TURISTICA I NUMERI DELLA CRESCITA

TRIESTE TURISTICA I NUMERI DELLA CRESCITA COMUNE DI TRIESTE AREA SVILUPPO ECONOMICO E TURISMO DIREZIONE ATTIVITA PROMOZIONE TURISTICA TRIESTE TURISTICA I NUMERI DELLA CRESCITA luglio 2009 Anno ARRIVI DI TURISTI variazione su anno precedente ARRIVI

Dettagli

La fiscalità e la spesa pubblica: un confronto internazionale

La fiscalità e la spesa pubblica: un confronto internazionale La fiscalità e la spesa pubblica: un confronto internazionale 1. L analisi dei livelli di prelievo fiscale nei principali Paesi costituisce uno degli elementi maggiormente significativi al fine di valutare

Dettagli

VALUTAZIONE DELLA BIODIVERSITÀ MICROBICA MEDIANTE L UTILIZZO DI TECNICHE MOLECOLARI

VALUTAZIONE DELLA BIODIVERSITÀ MICROBICA MEDIANTE L UTILIZZO DI TECNICHE MOLECOLARI VALUTAZIONE DELLA BIODIVERSITÀ MICROBICA MEDIANTE L UTILIZZO DI TECNICHE MOLECOLARI Laboratorio di Genetica dei Microrganismi (Responsabile attività: Prof. Giovanni Salzano; Tutor: Dr.ssa Maria Grazia

Dettagli

FINGERPRINTING DI PIANTE E FIORI: UTILE STRUMENTO PER LA CERTIFICAZIONE GENETICA DEL MATERIALE PROPAGATO DAI VIVAISTI

FINGERPRINTING DI PIANTE E FIORI: UTILE STRUMENTO PER LA CERTIFICAZIONE GENETICA DEL MATERIALE PROPAGATO DAI VIVAISTI FINGERPRINTING DI PIANTE E FIORI: UTILE STRUMENTO PER LA CERTIFICAZIONE GENETICA DEL MATERIALE PROPAGATO DAI VIVAISTI Il termine fingerprinting (impronta genetica) viene correntemente utilizzato per indicare

Dettagli

IAT SIRMIONE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT SIRMIONE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 9.993 226.892 136.283 465.751

Dettagli

Regione Toscana - Laboratorio di diagnostica fitopatologica e di biologia molecolare del Servizio Fitosanitario Regionale.

Regione Toscana - Laboratorio di diagnostica fitopatologica e di biologia molecolare del Servizio Fitosanitario Regionale. Viroide dell affusolamento dei tuberi della patata (Potato spindle tuber viroid, PSTVd) S. Vanarelli 1, D. Rizzo 1, L. Stefani 1, M. Paoli 1 G. Gilli 2 1 Regione Toscana - Laboratorio di diagnostica fitopatologica

Dettagli

Biodiversità e salute. Flavia Caretta

Biodiversità e salute. Flavia Caretta Biodiversità e salute Flavia Caretta Biodiversità e salute salute degli ecosistemi salute umana Effetti della perdita di biodiversità sulla salute umana Ricerca epidemiologica Rivolta a fattori singoli

Dettagli

Recenti acquisizioni su Cancro Batterico dell'actindia

Recenti acquisizioni su Cancro Batterico dell'actindia Recenti acquisizioni su Cancro Batterico dell'actindia Categories : Anno 2011, N. 135-1 dicembre 2011 Proseguono a tutto campo, e a ritmo serrato, i differenti studi condotti da Balestra e collaboratori

Dettagli

29.3.2014 Gazzetta ufficiale dell Unione europea L 95/39

29.3.2014 Gazzetta ufficiale dell Unione europea L 95/39 29.3.2014 Gazzetta ufficiale dell Unione europea L 95/39 DECISIONE DI ESECUZIONE DELLA COMMISSIONE del 27 marzo 2014 concernente un contributo finanziario dell Unione a favore di un piano coordinato di

Dettagli

IAT EDOLO FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT EDOLO FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 3.75 8.669 1.111 1.597 4.186

Dettagli

IAT DARFO BOARIO TERME FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT DARFO BOARIO TERME FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 29.668 112.816 4.581 27.373

Dettagli

8 - TURISMO. Capitolo 8 - Turismo

8 - TURISMO. Capitolo 8 - Turismo 8 - TURISMO Nel corso del 2007 le presenze turistiche sul nostro territorio si sono ridotte del 4,9% rispetto al 2006, portandosi a quota 219.504. Questo trend negativo si può in parte spiegare osservando

Dettagli

Il cancro batterico dell actinidia in Veneto

Il cancro batterico dell actinidia in Veneto Unità Periferica per i Servizi Fitosanitari Il cancro batterico dell actinidia in Veneto Giovanni Zanini Tiziano Visigalli Fiorenzo Girardi Sommacampagna 26 gennaio 2012 Unità Periferica per i Servizi

Dettagli

IAT GARDONE RIVIERA FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT GARDONE RIVIERA FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 12.315 28.567 37.352 16.61

Dettagli

In Italia la percentuale di persone con un lavoro regolare è in media del 60%, con un evidente gradiente nord-sud [figura 1].

In Italia la percentuale di persone con un lavoro regolare è in media del 60%, con un evidente gradiente nord-sud [figura 1]. Il lavoro Il lavoro e il tempo libero dovrebbero essere una fonte di salute per le persone. Il modo in cui la società organizza il lavoro dovrebbe contribuire a creare una società sana. La promozione della

Dettagli

Metodi di Distanza. G.Allegrucci riproduzione vietata

Metodi di Distanza. G.Allegrucci riproduzione vietata Metodi di Distanza La misura più semplice della distanza tra due sequenze nucleotidiche è contare il numero di siti nucleotidici che differiscono tra le due sequenze Quando confrontiamo siti omologhi in

Dettagli

Boschi indeboliti. Pinete

Boschi indeboliti. Pinete Boschi indeboliti - situazione favorevole per la colonizzazione di numerose specie di insetti - gli insetti riconoscono sostanze emesse dalle piante in condizioni di stress - le piante in tali condizioni

Dettagli

Elementi di Ingegneria Genetica Piante Geneticamente Modificate

Elementi di Ingegneria Genetica Piante Geneticamente Modificate Elementi di Ingegneria Genetica Piante Geneticamente Modificate Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene LA DEFINIZIONE LEGALE Direttiva

Dettagli

artus EBV QS-RGQ Kit Prestazioni caratteristiche Maggio 2012 Sample & Assay Technologies Sensibilità analitica plasma

artus EBV QS-RGQ Kit Prestazioni caratteristiche Maggio 2012 Sample & Assay Technologies Sensibilità analitica plasma artus EBV QS-RGQ Kit Prestazioni caratteristiche artus EBV QS-RGQ Kit, Version 1, 4501363 Check availability of new electronic labeling revisions at www.qiagen.com/products/artusebvpcrkitce.aspx before

Dettagli

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione La mappatura dei geni umani SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione Un grande impulso alla costruzione di mappe genetiche è stato dato da le tecniche della

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

ESA PRODUCT SPECIFICATION S PER LE SEM ENTI ORTIVE DI PRECISIONE

ESA PRODUCT SPECIFICATION S PER LE SEM ENTI ORTIVE DI PRECISIONE European Seed Association 19.01.2011 ESA_11.0086.3 IT ESA PRODUCT SPECIFICATION S PER LE SEM ENTI ORTIVE DI PRECISIONE Le presenti product specifications (specifiche di prodotto) riguardanti la germinazione,

Dettagli

RICHIESTE DI COMPETENZA E TRASFERIMENTI DI RICHIEDENTI PROTEZIONE INTERNAZIONALE DA E PER L ITALIA

RICHIESTE DI COMPETENZA E TRASFERIMENTI DI RICHIEDENTI PROTEZIONE INTERNAZIONALE DA E PER L ITALIA Cod. ISTAT INT00058 Settore di interesse: Popolazione e famiglia; condizioni di vita e partecipazione sociale RICHIESTE DI COMPETENZA E TRASFERIMENTI DI RICHIEDENTI PROTEZIONE INTERNAZIONALE DA E PER L

Dettagli

REGIONI TOTALE ITALIANI TOTALE GENERALE

REGIONI TOTALE ITALIANI TOTALE GENERALE AZIENDA AUTONOMA U.O.B. -STATISTICA E GESTIONE DEL PORTALE GENNAIO 2005 GENNAIO 2006 DIFFERENZA FEBBRAIO 2005 FEBBRAIO 2006 DIFFERENZA MARZO 2005 MARZO 2006 DIFFERENZA Esercizi 16 Esercizi 19 Esercizi

Dettagli

Le malattie delle piante. Classificazione e riconoscimento

Le malattie delle piante. Classificazione e riconoscimento Le malattie delle piante Classificazione e riconoscimento MALATTIA: è una deviazione, uno sconvolgimento, delle normali funzioni vitali (di ricambio o di sviluppo) dell organismo; può essere causata da

Dettagli

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico In Drosophila meta delle mutazioni sono generate da elementi genetici mobili Generalmente le componenti mobili

Dettagli

Bio-Control nella difesa dai parassiti delle piante. Davide Mondino Cuneo, Lunedì 21/01/2013

Bio-Control nella difesa dai parassiti delle piante. Davide Mondino Cuneo, Lunedì 21/01/2013 Bio-Control nella difesa dai parassiti delle piante Davide Mondino Cuneo, Lunedì 21/01/2013 BioControl (controllo biologico) Per controllo biologico si intende l'utilizzo di tutti quei mezzi efficaci per

Dettagli

LA PRODUZIONE, LA RACCOLTA E LA CONSERVAZIONE DELLE SEMENTI IN ORTICOLTURA SEMENTI DAL PROPRIO ORTO

LA PRODUZIONE, LA RACCOLTA E LA CONSERVAZIONE DELLE SEMENTI IN ORTICOLTURA SEMENTI DAL PROPRIO ORTO LA PRODUZIONE, LA RACCOLTA E LA CONSERVAZIONE DELLE SEMENTI IN ORTICOLTURA SEMENTI DAL PROPRIO ORTO La concezione ghoethiana della metamorfosi della pianta tra contrazione ed espansione Le nostre piante,

Dettagli

Capitolo 8 Turismo 8. TURISMO

Capitolo 8 Turismo 8. TURISMO 8. TURISMO Il 2008 ha visto un considerevole aumento di turisti nella nostra provincia: gli arrivi (persone che hanno pernottato per almeno una notte in una struttura ricettiva) sono risultati 75.880 (+2,8%

Dettagli

Statistica sulla domanda di turismo alberghiero in Ticino NOVEMBRE 2013

Statistica sulla domanda di turismo alberghiero in Ticino NOVEMBRE 2013 Statistica sulla domanda di turismo alberghiero in Ticino NOVEMBRE 2013 LUGANO, 16.01.2014 Ticino, positivo l andamento della domanda turistica a novembre Le statistiche provvisorie fornite dall Ufficio

Dettagli

Reg. (CE) 2073, punto 24 delle considerazioni preliminari

Reg. (CE) 2073, punto 24 delle considerazioni preliminari I risultati delle analisi dipendono dal metodo analitico utilizzato; pertanto occorre associare ad ogni criterio microbiologico un metodo di riferimento specifico. Tuttavia, gli operatori del settore alimentare

Dettagli

INDICE. - Sintesi - Grafici

INDICE. - Sintesi - Grafici Statistica INDICE - Sintesi - Grafici Tav. 1 - Strutture ricettive e posti letto al 31.12.2013. Comune di Pordenone Tav. 2 - Arrivi e presenze negli esercizi alberghieri e complementari. 2008-2013 Tav.

Dettagli

Presentazione Indagine internazionale 2015 OCSE PISA PRINCIPALI RISULTATI ITALIA

Presentazione Indagine internazionale 2015 OCSE PISA PRINCIPALI RISULTATI ITALIA Presentazione Indagine internazionale 2015 OCSE PISA PRINCIPALI RISULTATI ITALIA Roma, 6 dicembre 2016 L indagine PISA PISA, acronimo di Programme for International Student Assessment, è un'indagine internazionale

Dettagli

aderente a I dati sono suddivisi tra Città di Milano e Comuni appartenenti alla Città Metropolitana (provincia).

aderente a I dati sono suddivisi tra Città di Milano e Comuni appartenenti alla Città Metropolitana (provincia). aderente a Albergatori Città Metropolitana di Milano CITTA METROPOLITANA MILANO LORO INDIRIZZI Milano, 13/09/16 Dati ufficiali - movimenti e flussi anno 2015 Milano e Città Metropolitana Caro Albergatore,

Dettagli

LA POPOLAZIONE STRANIERA RESIDENTE AL 1 GENNAIO 2007 IN ITALIA ED A FAENZA UN CONFRONTO

LA POPOLAZIONE STRANIERA RESIDENTE AL 1 GENNAIO 2007 IN ITALIA ED A FAENZA UN CONFRONTO COMUNE DI FAENZA SETTORE SVILUPPO ECONOMICO Servizio Aziende e Partecipazioni comunali LA POPOLAZIONE STRANIERA RESIDENTE AL 1 GENNAIO 2007 IN ITALIA ED A FAENZA UN CONFRONTO Edizione 1/ST/st/01.12.2007

Dettagli

HIV/AIDS DIRITTI E RESPONSABILITÀ INTRODUZIONE

HIV/AIDS DIRITTI E RESPONSABILITÀ INTRODUZIONE HIV/AIDS DIRITTI E RESPONSABILITÀ INTRODUZIONE 1 Aids in Italia e in Europa 2 HIV/AIDS DIRITTI E RESPONSABILITÀ AIDS IN ITALIA E IN EUROPA Giovanni Rezza Centro Operativo Aids - Istituto Superiore di Sanità

Dettagli

Gli stranieri al 15 Censimento della popolazione

Gli stranieri al 15 Censimento della popolazione 23 dicembre 2013 Gli stranieri al 15 Censimento della popolazione L Istat diffonde oggi nuovi dati sulle caratteristiche della popolazione straniera censita in Italia. Tutte le informazioni, disaggregate

Dettagli

Struttura delle aziende agricole / Novembre 2015

Struttura delle aziende agricole / Novembre 2015 206/2015-26 Novembre 2015 Struttura delle aziende agricole 2013 Mentre la superficie agricola utilizzata è rimasta invariata, più di 1 azienda agricola su 4 è scomparsa tra il 2003 e il 2013 nell UE. Quasi

Dettagli

Corso STEM Il papilloma virus (Prof.ssa Gabriella Di Cola)

Corso STEM Il papilloma virus (Prof.ssa Gabriella Di Cola) Corso STEM Il papilloma virus (Prof.ssa Gabriella Di Cola) Il papilloma virus (HPV) interessa maggiormente le donne intorno ai 25 anni di età; esso intacca la zona genitale, in particolare le cellule dell

Dettagli

Blue Tongue situazione epidemiologica in Italia e aspetti normativi. Treviso 30 aprile 2008

Blue Tongue situazione epidemiologica in Italia e aspetti normativi. Treviso 30 aprile 2008 Blue Tongue situazione epidemiologica in Italia e aspetti normativi Treviso 30 aprile 2008 Situazione epidemiologica Analisi del rischio introduzione e circolazione 1 Flussi animali da zone a rischio Consistenza

Dettagli

PRESENZA DI MYCOBACTERIUM AVIUM SUBSP. PARATUBERCULOSIS NEL SUD ITALIA: PREVALENZA E CONTAMINAZIONE DEL LATTE

PRESENZA DI MYCOBACTERIUM AVIUM SUBSP. PARATUBERCULOSIS NEL SUD ITALIA: PREVALENZA E CONTAMINAZIONE DEL LATTE PRESENZA DI MYCOBACTERIUM AVIUM SUBSP. PARATUBERCULOSIS NEL SUD ITALIA: PREVALENZA E CONTAMINAZIONE DEL LATTE Andrea Serraino, Giacomo Marchetti, Federica Giacometti Dipartimento di Scienze Mediche Veterinarie

Dettagli

Marina Barba Centro di ricerca per la Patologia Vegetale - Roma F. Campanile, B. Giuliano, F. Miracolo, A. Pentangelo, M.

Marina Barba Centro di ricerca per la Patologia Vegetale - Roma F. Campanile, B. Giuliano, F. Miracolo, A. Pentangelo, M. Campagna 2014: Problematiche fitosanitarie del pomodoro Marina Barba Centro di ricerca per la Patologia Vegetale - Roma F. Campanile, B. Giuliano, F. Miracolo, A. Pentangelo, M. Tridentino Il 2014 è stato

Dettagli

Parla Facile 14,90 tariffe in vigore dal 01/12/2012. Sezione 1 - Costo complessivo di una chiamata (Valori in cent, IVA inclusa) Fonia vocale Locale

Parla Facile 14,90 tariffe in vigore dal 01/12/2012. Sezione 1 - Costo complessivo di una chiamata (Valori in cent, IVA inclusa) Fonia vocale Locale Parla Facile 14,90 tariffe in vigore dal 01/12/2012 Sezione 1 - Costo complessivo di una chiamata (Valori in cent, IVA inclusa) Fonia vocale Locale Nazionale Verso mobile - TIM Verso mobile - VODAFONE

Dettagli

I flussi migratori in Europa

I flussi migratori in Europa I flussi migratori in Europa PROF. RICCARDO FIORENTINI DIPARTIMENTO DI SCIENZE ECONOMICHE UNIVERSITÀ DI VERONA Migrazioni: un fenomeno complesso Motivi alla base delle migrazioni: Motivi economici Ricongiungimenti

Dettagli

Resta vivace il ciclo delle esportazioni modenesi nel 2 trimestre del 2006 I quantitativi esportati settore per settore ed i mercati di destinazione

Resta vivace il ciclo delle esportazioni modenesi nel 2 trimestre del 2006 I quantitativi esportati settore per settore ed i mercati di destinazione Modena, 26 settembre 2006 Prot. 20/06 Agli Organi di informazione COMUNICATO STAMPA Resta vivace il ciclo delle esportazioni modenesi nel 2 trimestre del 2006 I quantitativi esportati settore per settore

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

A.P.T. della Provincia di Venezia - Ufficio Studi & Statistica

A.P.T. della Provincia di Venezia - Ufficio Studi & Statistica RELAZIONE flussi turistici gennaio-luglio 2013/2012 1. ARRIVI / PRESENZE 2. COMPARTO alberghiero ed extraalberghiero 3. PROVENIENZE 4. RICETTIVO 5. FOCUS: LUGLIO 2013 1 ARRIVI / PRESENZE Il flusso turistico

Dettagli

«Coltivare il benessere»

«Coltivare il benessere» «Coltivare il benessere» Lezione 1 COSA COLTIVARE: Scelta delle varietà, differenze fra linee pure, ibridi, varietà; Consociazioni; Salvare le sementi: raccolta e conservazione di semi Cosa coltivare Scelta

Dettagli

Quantificare la variabilità dei processi ecologici

Quantificare la variabilità dei processi ecologici Scopo ecologia Quantificare la variabilità dei processi ecologici Comprensione dei meccanismi fondamentale per identificare gli effetti del disturbo antropico e per prevenire alterazioni su scala globale

Dettagli

1. IL QUADRO INTERNAZIONALE

1. IL QUADRO INTERNAZIONALE 1. IL QUADRO INTERNAZIONALE L eterogeneità e la parzialità delle rilevazioni statistiche disponibili non consentono di descrivere con completezza e precisione le caratteristiche della floricoltura a livello

Dettagli

Alcuni dati sul portafoglio brevetti dell'università degli Studi di Udine

Alcuni dati sul portafoglio brevetti dell'università degli Studi di Udine Università degli Studi di Udine Alcuni dati sul portafoglio brevetti dell'università degli Studi di Udine Aggiornamento: giugno 25 A cura di: 2/7 1. Andamento dei depositi delle domande di tutela e intensità

Dettagli

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione

Dettagli

DGGE/TTGE. Le differenze nel punto di denaturazione, chimica o termica, dipendono dalla sequenza nucleotidica

DGGE/TTGE. Le differenze nel punto di denaturazione, chimica o termica, dipendono dalla sequenza nucleotidica DGGE/TTGE Lungo gradiente di sostanze denaturanti (es. Urea) - DGGE Separazione degli amplimeri con elettroforesi Lungo gradiente temporale di temperatura (TTGE) Le differenze nel punto di denaturazione,

Dettagli

REGIONE LAZIO Direzione Regionale Agricoltura Area Servizi Tecnici e Scientifici, Servizio Fitosanitario Regionale Le Batteriosi dell Actinidia

REGIONE LAZIO Direzione Regionale Agricoltura Area Servizi Tecnici e Scientifici, Servizio Fitosanitario Regionale Le Batteriosi dell Actinidia REGIONE LAZIO Direzione Regionale Agricoltura Area Servizi Tecnici e Scientifici, Servizio Fitosanitario Regionale Le Batteriosi dell Actinidia Il cancro batterico dell actinidia è stato segnalato per

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI La tecnologia del DNA ricombinante è molto complessa dal punto di vista operativo, ma dal punto di vista concettuale si basa su criteri

Dettagli

Importanza della diagnosi su seme di pomodoro per l identificazione di alcuni agenti infettivi seed-borne

Importanza della diagnosi su seme di pomodoro per l identificazione di alcuni agenti infettivi seed-borne Falcoltà di Agraria dell Università Politecnica di Ancona - 29 Marzo 2012 " IMPORTANZA DELLA DIAGNOSI SU SEME DI POMODORO PER L IDENTIFICAZIONE DI ALCUNI AGENTI INFETTIVI SEED-BORNE Importanza della diagnosi

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Statistica sulla domanda di turismo alberghiero in Ticino SETTEMBRE 2014

Statistica sulla domanda di turismo alberghiero in Ticino SETTEMBRE 2014 Statistica sulla domanda di turismo alberghiero in Ticino SETTEMBRE 2014 LUGANO, 04.11.2014 Ticino, a settembre il quinto calo di fila della domanda turistica Le statistiche provvisorie fornite dall Ufficio

Dettagli

Attività dell acibenzolar S-metil nel contenimento della.

Attività dell acibenzolar S-metil nel contenimento della. Attività dell acibenzolar S-metil nel contenimento della Flavescenza dorata della vite Ci Cristina i Marzachì, D. Miliordos, L. Galetto, D. Bosco Cristina.marzachi@ipsp.cnr.it Attività dell acibenzolar

Dettagli

APAT Agenzia per la protezione dell ambiente e per i servizi tecnici. Dipartimento Tutela delle Acque Interne e Marine Servizio Difesa delle Coste

APAT Agenzia per la protezione dell ambiente e per i servizi tecnici. Dipartimento Tutela delle Acque Interne e Marine Servizio Difesa delle Coste APAT Agenzia per la protezione dell ambiente e per i servizi tecnici Dipartimento Tutela delle Acque Interne e Marine Servizio Difesa delle Coste CAPITOLO 3 IL CLIMA ONDOSO A LARGO DELLE COSTE ITALIANE

Dettagli

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo GENOMA di alcuni organismi viventi raffigurato come libri

Dettagli

CORSI DI EDUCAZIONE DEGLI ADULTI PROGRAMMAZIONE

CORSI DI EDUCAZIONE DEGLI ADULTI PROGRAMMAZIONE I.P.S.S.A.R.T.C. BONALDO STRINGHER CORSI DI EDUCAZIONE DEGLI ADULTI Anno scolastico 2011/2012 PROGRAMMAZIONE Disciplina: GEOGRAFIA Docente: STEFANO MEROI Classe: 4 TURISTICO Udine, 24 Novembre 2011 1.

Dettagli

NUOVO CONTINENTE: UN SUPPORTO ALL ITALIA DIGITALE. La situazione attuale: infrastrutture, alfabetizzazione digitale, e-commerce

NUOVO CONTINENTE: UN SUPPORTO ALL ITALIA DIGITALE. La situazione attuale: infrastrutture, alfabetizzazione digitale, e-commerce NUOVO CONTINENTE: UN SUPPORTO ALL ITALIA DIGITALE La situazione attuale: infrastrutture, alfabetizzazione digitale, e-commerce LE INFRASTRUTTURE DIGITALI UNA DOTAZIONE DIFFUSA, MA CON ALCUNI LIMITI TERRITORIALI

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

L incidenza delle malattie croniche e delle malattie professionali

L incidenza delle malattie croniche e delle malattie professionali @bollettinoadapt, 8 gennaio 2015 L incidenza delle malattie croniche e delle malattie professionali di Francesca Pastorelli Tag: #malattiecroniche #autopercezione #istruzione #malattieprofessionali Le

Dettagli