Regolazione dell espressione genica EUCARIOTI

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Regolazione dell espressione genica EUCARIOTI"

Transcript

1 Regolazione dell espressione genica EUCARIOTI

2

3

4

5

6

7

8 Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo, proteine del citoscheletro Alcune proteine sono abbondanti solo in cellule specializzate L emoglobina è espressa solamente nei globuli rossi

9 Quanti sono i geni espressi in una cellula? Una cellula esprime 10,000-15,000 15,000 geni dei 30,000 geni di cui dispone

10 Quanti sono i geni espressi in una cellula? Sono espressi tutti allo stesso livello? Popolazioni di molecole di mrna in una tipica cellula di mammifero Classe copie/cell cell di ogni mrna N mrna N totale di molecole di mrna Abbondante Intermedio Scarso Le funzioni housekeeping in una cellula di mammifero sono ~10.000

11 Livelli di regolazione della espressione genica negli eucarioti

12 La regolazione dell espressione espressione genica può avvenire a più livelli: Stato di Condensazione della Cromatina Trascrizione Post-trascrizionetrascrizione Traduzione Post-traduzionaletraduzionale sull attivit attività delle proteine

13 Il primo livello di regolazione riguarda lo stato di condensazione della cromatina nel nucleo

14 Eucromatina e eterocromatina all interno del nucleo.

15 Cromosomi politenici delle ghiandole salivari di Drosophila

16 Puffing cromosomici in ghiandole salivari di Drosofila. Lo svolgimento localizzato della struttura cromosomica indica trascrizione in quella regione Dna è in blu. Rna in violetto

17 A B C D Puffing del crom 3 in ghiandole salivari di Drosofila in stadi diversi del differenziamento 100 hr 115 hr Prepupa 1Prepupa 2

18 In che cosa consistono, a livello molecolare, le modificazioni dello stato di condensazione della cromatina associate alla attivazione trascrizionale?

19 L attivazione trascrizionale di un gene è accompagnata a decondensazione locale della cromatina

20 L attivazione trascrizionale di un gene è accompagnata a decondensazione locale della cromatina La decondensazione locale scopre il DNA. Dissociazione (temporanea) dagli istoni. Accessibilità al macchinario della trascrizione La dimostrazione sperimentale che le regioni trascrivibili della cromatina sono decondensate si ottiene dimostrando che queste regioni sono accessibili a un enzima, i.e. sono sensibili alla digestione con DNAasi I (1)

21 Le regioni trascrivibili della cromatina sono sensibili alla digestione con DNAasi I (1)

22 Le regioni trascrivibili della cromatina sono sensibili alla digestione con DNAasi I (2)

23 L attivazione trascrizionale di un gene si accompagna a decondensazione locale della cromatina La decondensazione locale scopre il DNA. Accessibilità al macchinario della Trascrizione Come viene ottenuta questa decondensazione? Dissociazione (temporanea) dagli istoni

24 Regolazione positiva della trascrizione genica da parte della istone-acetiltransferasi (HAT) che acetila (Ac) gli istoni vicino alla TATA box. Questa modificazione locale degli istoni li dissocia dal DNA, consentendo l accesso della RNApol II che inizia la trascrizione del gene.

25 L attivazione trascrizionale di un gene è accompagnata a decondensazione locale della cromatina Come è ottenuta questa decondensazione? Dissociazione (temporanea) dagli istoni Demetilazione dei promotori.

26 I geni trascrizionalmente attivi hanno promotori ipometilati

27 Sintesi di differenti catene globiniche a determinati stadi di sviluppo embrionale, fetale e post-natale

28 Il livello di metilazione dei promotori correla con l attività dei geni della β-globina durante lo sviluppo gene ε attivo P a 6 settimane P gene γ inattivo P inattivo PP attivo a 12 settimane = promotore ipometilato = promotore metilato

29 La regolazione dell espressione espressione genica può avvenire a più livelli: Stato di Condensazione della Cromatina Trascrizione Post-trascrizionetrascrizione Traduzione Post-traduzionaletraduzionale sull attivit attività delle proteine

30 Il controllo trascrizionale è molto importante

31 Come viene regolata la trascrizione? Sequenze di regolazione sul DNA e proteine di regolazione che si legano a queste sequenze

32

33 Le differenti coppie di basi possono essere riconosciute senza aprire la doppia elica H-bond acceptor H-bond donor

34 Esistono molte proteine di regolazione che legano il DNA (fattori trascrizionali) Appartengono a famiglie e presentano MOTIVI STRUTTURALI COMUNI molto conservati HELIX-TURN-HELIX DITA DI ZINCO CERNIERA DI LEUCINE

35 Il motivo strutturale helix-turn-helix (1)

36 Il motivo strutturale helix-turn-helix (2)

37 Il motivo strutturale a dita di zinco (1)

38 Il motivo strutturale a dita di zinco (2)

39 Motivo strutturale a cerniera di leucine (1) NH2 NH2 Domini che legano il DNA (regioni basiche) Domini a cerniera di leucine COOH COOH

40 Il motivo strutturale a cerniera di leucina (2)

41 Come funzionano i fattori trascrizionali? L inizio della trascrizione negli eucarioti

42 L inizio della trascrizione negli eucarioti RNA Pol II deve associarsi con molti fattori trascrizionali generali (GTF) Ogni gene ha diverse sequenze regolatrici Diversi fattori trascrizionali speifici devono essere presenti per accendere completamente un gene Le sequenze regolatrici possono trovarsi anche molto distanti dal punto di inzio della trascrizione

43 I GTF si assemblano su tutti i promotori

44 L inizio della trascrizione negli eucarioti RNA Pol II deve associarsi con molti fattori trascrizionali generali (GTF) Ogni gene ha diverse sequenze regolatrici Diversi fattori trascrizionali speifici devono essere presenti per accendere completamente un gene Le sequenze regolatrici possono trovarsi anche molto distanti dal punto di inzio della trascrizione

45 Le sequenze di regolazione a cui si legano i fattori trascrizionali sono: Promotori Intensificatori (Enhancer) Silenziatori

46 L inizio della trascrizione negli eucarioti RNA Pol II deve associarsi con molti fattori trascrizionali generali (GTF) Ogni gene ha diverse sequenze regolatrici Diversi fattori trascrizionali specifici devono essere presenti per accendere completamente un gene Le sequenze regolatrici possono trovarsi anche molto distanti dal punto di inzio della trascrizione

47

48 L inizio della trascrizione negli eucarioti RNA Pol II deve associarsi con molti fattori trascrizionali generali (GTF) Ogni gene ha diverse sequenze regolatrici Diversi fattori trascrizionali speifici devono essere presenti per accendere completamente un gene Le sequenze regolatrici possono trovarsi anche molto distanti dal punto di inzio della trascrizione

49 Le sequenze regolatrici possono trovarsi anche molto distanti dal punto di inzio della trascrizione promotore

50 Fattori di attivazione TRASCRIZIONE Fattori silenziatori

51 I silenziatori sono proteine repressori della trascrizione

52 Controllo Combinatorio della trascrizione

53 Chi regola i regolatori??

54 I vantaggi del Controllo Combinatorio: Negli eucarioti i geni non sono organizzati in operoni Con pochi fattori trascrizionali (alcune( centinaia) ) in combinazioni diverse si può controllare l espressione di tutti i geni Geni che devono essere accesi insieme condividono elementi di regolazione e proteine di regolazione Possibilità di regolazione fine del livello di trascrizione

55 L attivazione della trascrizione è risultato dell integrazione di molteplici segnali proteine molteplici provenienti regolatrici siti il da complessi di posizionate su di regolazione

56 La regolazione dell espressione espressione genica può avvenire a più livelli: Stato di Condensazione della Cromatina Trascrizione Post-trascrizionetrascrizione Traduzione Post-traduzionaletraduzionale sull attivit attività delle proteine

57 Il controllo post-trascrizionale trascrizionale: splicing alternativo stabilità del mrna

58 Nell uomo, il numero di geni è molto inferiore all atteso atteso Il genoma umano contiene geni Il trascrittoma: : ~60% dei geni hanno splicing alternativo Il proteoma: : nel ~70% dei casi, lo splicing genera sequenze aa diverse, quindi il proteoma è costituito da membri

59 Splicing differenziale o alternativo

60 Splicing differenziale o alternativo (1): fibronectina nei fibroblasti e negli epatociti

61 Poliadenilazione e splicing alternativi (2): anticorpi di membrana e di secrezione nei linfociti

62 Poliadenilazione e splicing alternativi (3): formazione di prodotti tessuto-specifici del gene umano della calcitonina CALC

63 Controllo positivo e negativo dello splicing

64 Una sorpresa recente: l editing dell RNA Possibilità di modificare la sequenza nucleotidica di un RNA dopo che è stato trascritto Un ulteriore modo per produrre da un unico gene una varietà di proteine correlate Azione delle deaminasi

65 Un ulteriore livello di regolazione post-trascrizionale: la stabilità del mrna Meccanismi che regolano la degradazione del mrna: Accorciamento o distacco della coda di poli-a Perdita del 3 UTR ad opera di endonucleasi specifiche

66 La regolazione dell espressione espressione genica può avvenire a più livelli: Stato di Condensazione della Cromatina Trascrizione Post-trascrizionetrascrizione Traduzione Post-traduzionaletraduzionale sull attivit attività delle proteine

67 Regolazione dell espressione genica a livello della traduzione

68 Regolazione della concentrazione di ferro nel citosol

69 La regolazione dell espressione espressione genica può avvenire a più livelli: Stato di Condensazione della Cromatina Trascrizione Post-trascrizionetrascrizione Traduzione Post-traduzionaletraduzionale sull attivit attività delle proteine

70 Controllo post-traduzionale traduzionale dell attivit attività delle proteine Modificazioni allosteriche Modificazioni covalenti: Livello di fosforilazione Attivazione con tagli proteolitici della proteina precursore Presenza/assenza inibitore Localizzzazione/Compartimentalizzazione Ubiquitinazione e direzionamento al proteasoma

71 Livelli di regolazione della espressione genica negli eucarioti

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

La regolazione nei procarioti

La regolazione nei procarioti La regolazione nei procarioti I geni batterici sono tipicamente raggruppati in operoni, in cui più geni si susseguono l un l altro preceduti da un unico promotore e trascritti insieme in un unico RNA policistronico.

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali Fattori di crescita Recettori di fattori di crescita Membrana citoplasmatica roteine trasduttrici del segnale Nucleo Fattori trascrizionali roteine del ciclo cellulare Ciclo di divisione cellulare Fattori

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti Gli attivatori trascrizionali sono delle proteine modulari domini funzionali sovrapposti DIMOSTRAZIONE SPERIMENTALE DI DOMINI FUNZIONALI SEPARATI NEL TF DI LIEVITO GAL 4! Esperimenti di Ptshane. Cellule

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

21. Regolazione dell espressione genica

21. Regolazione dell espressione genica 21. Regolazione dell espressione genica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le cellule di un organismo pluricellulare

Dettagli

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI Testi di riferimento: Alberts B. et al. Biologia molecolare della cellula - Ed. Zanichelli Gilbert S.F. Biologia dello sviluppo - Ed. Zanichelli COS E UNA CELLULA

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

La Terminazione della Trascrizione

La Terminazione della Trascrizione La Terminazione della Trascrizione I geni batterici possiedono dei terminatori della trascrizione. I Terminatori sono sequenze dell RNA che promuovono il distacco dell RNA polimerasi dal templato Ne esistono

Dettagli