Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una"

Transcript

1 Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una Liliacea. Tra le graminacee il frumento ha un genoma di Mbp, l'orzo di 5300 Mbp ed il mais 2500 Mbp, riso ha solo 425 Mbp. Il numero di cromosomi è molto variabile così pure il valore di ploidia.

2 The rare flower has a genome 50 times larger than that of a human. With 150 billion base pairs of DNA per cell, it is the biggest known genome of any living organism; the DNA from a single cell stretched out end-to-end would be taller than 91 m.

3 Difficoltà nello studio di genomi delle piante grandi genomi: Escherichia coli 4.5Mbp (10 6 bp) Lievito 13.5Mbp C.elegans 97Mbp A. thaliana 125Mbp Drosphila 180Mbp Riso 430Mbp Uomo 3200 Mbp= 3.2Gbp (10 9 bp) Frumento (diploide), orzo 6-7Gbp Grano duro (tetraploide) 12-13Gbp (10 10 bp) Grano tenero (esaploide) 16Gbp Liliacee Gbp (10 11 bp) N cromosomi molto variabile: 2n= 4 fino a 600 polipolidia diffusa sequenze non-senso molto abbondanti (non codificanti, ripetute), mappaggio dei cromosomi limitato, molte specie con cromosomi piccoli e numerosi, difficile localizzare geni sui cromosomi con tecniche in situ, per molte specie non si conosce bene il contenuto in DNA ed il numero di cromosomi.

4 Plant Genomes Can Be Larger Than The Human Genome Relative Genome Sizes Moss Rice Sorghum Clover Tomato Soy Canola Potato Lolium Corn Tobacco Key: Arabidopsis Human Wheat

5 Paradosso del valore C: non si nota una correlazione tra dimensioni del genoma e complessità dell'organismo. Negli anni 60 si scoprì che i genomi dei vari taxa variavano in termini di contenuto in GC. I genomi dei procarioti possiedono una limitata distribuzione di valori di GC mentre i grossi genomi degli eucarioti presentano un ampia distribuzione (eterogeneità) di sequenze con una diversa composizione in basi: sono cioè composti da un mosaico di tipi di sequenze con % in GC differente.

6 Esistono poi differenze anche tra monocot e dicot: contenuto in GC negli introni. In generale, le monocot hanno introni con una maggiore % in GC mentre nelle dicot è più marcata la differenza tra esoni ed introni. In generale, i genomi vegetali sono pure un mosaico di regioni geniche e nongeniche. Il confronto tra i vari genomi può essere fatto a diversi livelli caratteristiche dei cromosomi come eterocromatina ed eucromatina distribuzione delle diverse sequenze ripetitive e delle famiglie dei trasposoni organizzazione e distribuzione dei geni introni

7 A small Portion of the Genome Comprises Genes Plant Genome Composition: Junk vs. Genes Arabidopsis Moss Rice Tomato Soy Canola Potato Grass Corn Wheat Human repetitive junk DNA valuable genespace

8 Arabidopsis thaliana è una piccola angiosperma che è utilizzata come pianta modello in biologia vegetale. Arabidopsis fa parte della famiglia delle Brassicaceae, non ha alcuna valore agronomico ma offre molto vantaggi per la ricerca genetica e molecolare: Genoma piccolo (114.5 Mb/125 Mb totali) sequenziato nel 2000, Mappe genetiche e fisiche dettagliate di tutti i 5 cromosomi, Ciclo vitale veloce (6 settimane dalla germinazione alla produzione dei semi), Piccole dimensioni, facilità di crescita in ambiente limitato e massiccia produzione dei semi, Facilmente trasformata con Agrobacterium tumefaciens. Sono disponibili moltissime linee mutanti e banche di cloni.

9 Dal sequenziamento del genoma di Arabidopsis è stato possibile estrapolare una serie di informazioni: più di geni codificanti previsti (maggiore di genomi già sequenziati come Caenorahabditis elegans, o lievito, 13600)(genoma umano geni), molti geni (17%) sono presenti in tandem arrays contenenti fino a 23 geni ciascuno, si stimano circa geni distinti, molto simile a Drosophila o C. elegans. 69% delle sequenze presentano omologie con geni noti (soprattutto geni implicati in sintesi proteine), ma solo il 9% è stato studiato in termini sperimentali. 30% dei geni sono ignoti, senza informazioni sulla funzione

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici

Dettagli

RELAZIONE di BIOLOGIA MOLECOLARE

RELAZIONE di BIOLOGIA MOLECOLARE NOME: Marini Selena MATRICOLA: 592330 RELAZIONE di BIOLOGIA MOLECOLARE CHE ORGANISMO MODELLO È DICTYOSTELIUM? CHE RISORSE BIOINFORMATICHE AGEVOLANO I RICERCATORI CHE LO STUDIANO? Dictyostelium è un genere

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

Info per il futuro. Erasmus a Parigi: Master giornalismo: RIS check giornata su

Info per il futuro. Erasmus a Parigi:  Master giornalismo:  RIS check giornata su Info per il futuro Erasmus a Parigi: www.saggiolab.it Master giornalismo: www.mastersgp.it RIS check giornata su www.mastersgp.it Organizzazione corso Lezioni Esercitazioni bonus (17/12, 19/12, 7/1, 9/1,

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Sommario. Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni

Sommario. Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni Sommario Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni SNP: definizioni Polimorfismo al singolo nucleotide, in genere si intende la sostituzione

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo GENOMA di alcuni organismi viventi raffigurato come libri

Dettagli

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione La mappatura dei geni umani SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione Un grande impulso alla costruzione di mappe genetiche è stato dato da le tecniche della

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Malattie genetiche e progetto genoma: a che punto siamo arrivati?

Malattie genetiche e progetto genoma: a che punto siamo arrivati? Malattie genetiche e progetto genoma: a che punto siamo arrivati? dott. Elena Belloni Gruppo di ricerca IEO: Meccanismi molecolari del cancro e dell invecchiamento (responsabile prof. Pier Giuseppe Pelicci)

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

Andrea Crisanti Università degli Studi di Perugia

Andrea Crisanti Università degli Studi di Perugia Centro di Genomica e Polo di Innovazione GGB: La ricerca genetica e genomica per l innovazione in agricoltura Andrea Crisanti Università degli Studi di Perugia La genomica Punto di incontro tra biologia

Dettagli

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico In Drosophila meta delle mutazioni sono generate da elementi genetici mobili Generalmente le componenti mobili

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale Analisi dell esoma e la medicina predittiva Domenico Coviello Direttore Medico

Dettagli

IL CODICE GENETICO E I CARATTERI EREDITARI

IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Corso di Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Concetti chiave della seconda lezione Il genomadeiplastidie deimitocondrinellepiantesuperiori

Dettagli

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA.

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Il progetto Genoma Umano è iniziato nel 1990. E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Progetto internazionale finanziato da vari paesi, affidato

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI La tecnologia del DNA ricombinante è molto complessa dal punto di vista operativo, ma dal punto di vista concettuale si basa su criteri

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c.

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c. Doutez de tout et surtout de ce que je vais vous dire Bouddha 556-480 a.c. Il punto: -genotipo fenotipo -eredita -gene Esercitazione Bonus: 0-1.5 Presenza obbligatoria -gene malattia -manipolazione del

Dettagli

CAPITOLO 11: Mendel e la genetica classica

CAPITOLO 11: Mendel e la genetica classica PROGRAMMA MATERIA : DI SCIENZE NATURALI,CHIMICA E GEOGRAFIA A.S. : 2015-2016 DOCENTE: FRAU BASILIA CLASSE: 3 SEZ. B CAPITOLO 11: Mendel e la genetica classica 11.1 Nascita della genetica 11.2 La legge

Dettagli

-85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO

-85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO Replication -85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a 20000 geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO QUINDI AMBIGUI I processi epigenetici,tutti

Dettagli

2. Negli Anfibi la circolazione e doppia ma incompleta. Il cuore di una rana ha pertanto:

2. Negli Anfibi la circolazione e doppia ma incompleta. Il cuore di una rana ha pertanto: Test n. 3 Dalle olimpiadi delle Scienze Naturali 2004 1. L uomo, come tutti i vertebrati, possiede un sistema circolatorio chiuso. Nei mammiferi la circolazione è doppia e completa, poiché il sangue ossigenato

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

LA TRASFORMAZIONE GENETICA NELLE PIANTE: PRINCIPI E STATO DEI LAVORI. Michele Morgante

LA TRASFORMAZIONE GENETICA NELLE PIANTE: PRINCIPI E STATO DEI LAVORI. Michele Morgante LA TRASFORMAZIONE GENETICA NELLE PIANTE: PRINCIPI E STATO DEI LAVORI Michele Morgante Per un agricoltura del futuro Produttività Popolazione crescente con bisogni crescenti Scarsità di risorse idriche

Dettagli

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione

Dettagli

Ricevimento Studenti: Lunedì previa prenotazione. Cenci lab

Ricevimento Studenti: Lunedì previa prenotazione. Cenci lab Cenci lab Giovanni Cenci Dip.to Biologia e Biotecnologie C. Darwin Sezione Genetica Piano 2 -Citofono 3/4 0649912-655 (office) 0649912-843 (lab) giovanni.cenci@uniroma1.it Ricevimento Studenti: Lunedì

Dettagli

Trasformazione genetica di cellule vegetali: introduzione ed inserzione nel genoma nucleare di un nuovo gene, senza utilizzare la fecondazione.

Trasformazione genetica di cellule vegetali: introduzione ed inserzione nel genoma nucleare di un nuovo gene, senza utilizzare la fecondazione. Trasformazione genetica di cellule vegetali: introduzione ed inserzione nel genoma nucleare di un nuovo gene, senza utilizzare la fecondazione. Problemi tipici dei vegetali: 1- Presenza della parete vegetale

Dettagli

Relatrice: dott.ssa Ilaria Pegoretti

Relatrice: dott.ssa Ilaria Pegoretti Relatrice: dott.ssa Ilaria Pegoretti IL LABORATORIO DI BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni 26 Novembre 2011 Auditorium Presidio Ospedaliero S.Chiara, Trento Scoperta

Dettagli

Organizzazione del genoma umano

Organizzazione del genoma umano Organizzazione del genoma umano Famiglie di geni o geniche Copie multiple di geni, tutte con sequenza identica o simile. La famiglia multigenica corrisponde a un insieme di geni correlati che si sono evoluti

Dettagli

La metagenomica al servizio dell agricoltura

La metagenomica al servizio dell agricoltura La metagenomica al servizio dell agricoltura Marco Bazzicalupo Department of Biology University of Florence, Firenze, Italy http://www.unifi.it/dblage/mdswitch.html L albero della vita è microbico RNA

Dettagli

Corso di Laurea in Biotecnologie corso di laurea interfacoltà

Corso di Laurea in Biotecnologie corso di laurea interfacoltà Corso di Laurea in Biotecnologie corso di laurea interfacoltà (Agraria, Farmacia, Medicina e Chirurgia, Medicina Veterinaria, Scienze Matematiche, Fisiche e Naturali) Obiettivi formativi generali fornire

Dettagli

Programmi a.s

Programmi a.s Docente BORROMEO ELISABETTA Classi 2 sezione/i E Unità 1 Le basi della vita Unità 2 La genetica Unità 3 Biologia molecolare e biotecnologie Unità 8 Anatomia e fisiologia del corpo umano: L'apparato respiratorio

Dettagli

Elementi di Ingegneria Genetica Piante Geneticamente Modificate

Elementi di Ingegneria Genetica Piante Geneticamente Modificate Elementi di Ingegneria Genetica Piante Geneticamente Modificate Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene LA DEFINIZIONE LEGALE Direttiva

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Arabidopsis thaliana Pianta modello

Arabidopsis thaliana Pianta modello Arabidopsis thaliana Pianta modello Arabidopsis thaliana è stata scoperta da Johannes Thal nel sedicesimo secolo. Proposta come pianta modello già da Laibach nel 1943 e studiata più in dettaglio da Redei

Dettagli

I GENI sono alla base delle Biotecnologie

I GENI sono alla base delle Biotecnologie Corso di BIOTECNOLOGIE VEGETALI Introduzione alle Biotecnologie 2 parte A cura di Pierdomenico Perata & Elena Loreti I GENI sono alla base delle Biotecnologie Trasformazione Metodi principali di cellule

Dettagli

Dal grano Creso alle scienze omiche, nuove applicazioni e strategie future

Dal grano Creso alle scienze omiche, nuove applicazioni e strategie future Dal grano Creso alle scienze omiche, nuove applicazioni e strategie future..non c'è futuro senza passato Patrizia Galeffi, PhD - ENEA Dalla ricerca nucleare alla produzione agro-alimentare: il caso del

Dettagli

LICEO SCIENTIFICO STATALE R. CACCIOPPOLI ANNO SCOLASTICO 2012/13 CLASSE III G PROGRAMMA DI SCIENZE PROF.SSA ANGELOZZI ROBERTA CHIMICA

LICEO SCIENTIFICO STATALE R. CACCIOPPOLI ANNO SCOLASTICO 2012/13 CLASSE III G PROGRAMMA DI SCIENZE PROF.SSA ANGELOZZI ROBERTA CHIMICA LICEO SCIENTIFICO STATALE R. CACCIOPPOLI ANNO SCOLASTICO 2012/13 CLASSE III G PROGRAMMA DI SCIENZE PROF.SSA ANGELOZZI ROBERTA CHIMICA Misure e grandezze: Il Sistema Internazionale di unità di misura Grandezze

Dettagli

Genomica dei Sistemi Modello Vegetali

Genomica dei Sistemi Modello Vegetali Genomica dei Sistemi Modello Vegetali Simone Ferrari Simone.ferrari@uniroma1.it Edificio di Botanica piano terra http://elearning.uniroma1.it/index.php: Genomica Strutturale e Funzionale mod. Genomica

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Mutazione e riparazione del DNA, ed elementi trasponibili

Mutazione e riparazione del DNA, ed elementi trasponibili Mutazione e riparazione del DNA, ed elementi trasponibili Prof. Renato Fani Lab. di Evoluzione Microbica e Molecolare Dip.to di Biologia Evoluzionistica,Via Romana 17-19, Università di Firenze, 50125 Firenze

Dettagli

Biotecnologie vegetali e ricerca spaziale

Biotecnologie vegetali e ricerca spaziale Biotecnologie vegetali e ricerca spaziale Giorgio Morelli Istituto Nazionale di Ricerca per gli Alimenti e la Nutrizione MOF-Fondi 21 maggio 2004 Alcune piante per il sostentamento della vita nello spazio

Dettagli

Come si forma un fiore?

Come si forma un fiore? Come si forma un fiore? Mar0n Kater Dipar&mento di BioScienze Università degli Studi di Milano mar&n.kater@unimi.it UNIMI UNIMI Primavera Inverno Primavera Perchè in Italia la maggior parte delle piante

Dettagli

particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome)

particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome) particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome) i due solchi, maggiore e minore, dell'elica B sono qui sostituiti da un singolo (profondo)

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B1 Da Mendel ai modelli di ereditarietà 3 Mendel, il padre della genetica

Dettagli

Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza. O.G.M. Vegetali

Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza. O.G.M. Vegetali Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza O.G.M. Vegetali Identificazione di un O.G.M. e metodi di analisi del DNA transgenico Marco Nani 5BL Liceo Scientifico Mattei di Fiorenzuola

Dettagli

Marcatori molecolari

Marcatori molecolari Marcatori molecolari Caratteristiche e applicazioni Luca Gianfranceschi e Rosanna Marino 1 I marcatori molecolari Strumento per l analisi genetica Strumento Molecolari Analisi genetica Marcatori non oggetto

Dettagli

LO SVILUPPO DEL FIORE

LO SVILUPPO DEL FIORE LO SVILUPPO DEL FIORE FIORE: complesso apparato di strutture funzionalmente specializzate e radicalmente diverse dall organismo vegetativo sia nella forma che nei tipi cellulari La transizione verso la

Dettagli

Lezione 12. Origine degli introni

Lezione 12. Origine degli introni Lezione 12 Origine degli introni Nature Reviews Genetics 2006 Introni di gruppo I batteri, organelli identificati circa 1500 Introni di gruppo II identificati circa 200 Introni con spliceosomi genoma nucleare

Dettagli

MIGLIORAMENTO GENETICO TRADIZIONALE

MIGLIORAMENTO GENETICO TRADIZIONALE MIGLIORAMENTO GENETICO TRADIZIONALE OGM ORGANISMI GENETICAMENTE MODIFICATI PGM PIANTA GENETICAMENTE MODIFICATA PIANTA TRANSGENICA UNA PIANTA NELLA QUALE, MEDIANTE INGEGNERIA GENETICA, SONO STATE INTRODOTTE

Dettagli

Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2014-2015 corso A- L Docente: Massimo Gulisano Cell 3483391646 Email m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza

Dettagli

caratteristiche dei viventi

caratteristiche dei viventi caratteristiche dei viventi teoria cellulare Teoria cellulare La Teoria Cellulare formulata da Schleiden e Schwann tra il 1838 e il 1839 afferma che Tutti gli organismi viventi sono formati da cellule.

Dettagli

GENOMICA FUNZIONALE:

GENOMICA FUNZIONALE: GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi 9. Funzionamento dei genomi Il genoma dei procarioti Modificazioni della cromatina e l espressione del genoma Il genoma degli eucarioti

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

Parte I I principi fondamentali della clonazione dei geni e dell analisi del DNA

Parte I I principi fondamentali della clonazione dei geni e dell analisi del DNA 6746 BROWN Iniziali I-XIV 13-04-2007 11:57 Pagina VII Indice Parte I I principi fondamentali della clonazione dei geni e dell analisi del DNA Capitolo 1 L importanza della clonazione dei geni e dell analisi

Dettagli

L ORIGINE DELLA VARIAZIONE GENETICA

L ORIGINE DELLA VARIAZIONE GENETICA L ORIGINE DELLA VARIAZIONE GENETICA GENI E GENOMI MUTAZIONI GENICHE ALTERAZIONI DEL CARIOTIPO L ORIGINE DELLA VARIAZIONE GENETICA 2001 Febbraio :Sequenzaa completa genoma umano, prodotta dall Internationall

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU)

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU) http://www 3.unipv.it/webbio/anatcomp/freitas/freitas.html Insegnamento Biologia della Cellula Animale e Vegetale (9 CFU) Unità didattica: Biologia della Cellula Animale (6 CFU) Esempi di Testi da utilizzare

Dettagli

Corso di BioMedicina Molecolare Genomica e dei Sistemi Complessi

Corso di BioMedicina Molecolare Genomica e dei Sistemi Complessi Corso di BioMedicina Molecolare Genomica e dei Sistemi Complessi CFU: 6 Anno accademico 2010-2011 Logica del Corso Il completamento del Progetto Genoma di Homo sapiens e di molti altri organismi e virus

Dettagli

- Uno dei meccanismi biologici più importanti è connesso al controllo della divisione e proliferazione cellulare.

- Uno dei meccanismi biologici più importanti è connesso al controllo della divisione e proliferazione cellulare. - L obiettivo principale della ricerca biomedica consiste nel tentativo di comprendere, a livello molecolare, processi biologici complessi al fine di migliorare la salute ed il benessere dell uomo. - Uno

Dettagli

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Genetica batterica Materiale genetico presente nella cellula batterica Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Nucleoide (morfologia) È costituito da un unica unica molecola

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE. Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO. a.s.

ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE. Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO. a.s. ISTITUTO D ISTRUZIONE SUPERIORE ISTITUTO TECNICO ECONOMICO STATALE Roberto Valturio RELAZIONE FINALE E PROGRAMMA SVOLTO a.s. 2O13-2014 Materia : Chimica e Biologia Classe : II sez. E Rimini,05/06/2014

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Organizzazione del genoma umano I

Organizzazione del genoma umano I Organizzazione del genoma umano I LEZIONE 7 1 Oggi, uno degli obiettivi prioritari è la comprensione dei meccanismi mediante i quali le informazioni contenute nel materiale genetico portano, partendo da

Dettagli

Dopo l invenzione del microscopio è stato possibile scoprire l esistenza delle cellule.

Dopo l invenzione del microscopio è stato possibile scoprire l esistenza delle cellule. CELLULA Dopo l invenzione del microscopio è stato possibile scoprire l esistenza delle cellule. 1. La cellula Definizione di cellula 1. È la più piccola parte di un organismo (pluricellulare). 2. Può costituire

Dettagli

Rapporto tecnico dataset genomica

Rapporto tecnico dataset genomica Rapporto tecnico dataset genomica Indice 1 Introduzione 2 2 Struttura del dataset 2 2.1 GOgraphs............................... 3 2.2 Annotations.............................. 3 2.3 Proles................................

Dettagli

CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE

CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE 1 Questa opera è protetta dalla Legge sul diritto d autore (Legge n. 633/1941: http://www.giustizia.it/cassazione/leggi/l633_41.html). Tutti

Dettagli

Lezione 1 secondo semestre mercoledi 3 Marzo

Lezione 1 secondo semestre mercoledi 3 Marzo Lezione 1 secondo semestre mercoledi 3 Marzo Prof: Marco Tripodi tripodii@bce.uniroma1.it BIOLOGIA e GENETICA a.a.2012-13 Sezione di Genetica Molecolare La cosa più importante di tutto il corso Capire,

Dettagli

Il LIEVITO Saccharomyces cerevisiae. Organismo modello

Il LIEVITO Saccharomyces cerevisiae. Organismo modello Il LIEVITO Saccharomyces cerevisiae Organismo modello Caratteristiche: Il lievito di birra, Saccharomyces cerevisiae, appartenente al regno dei Funghi e al Phylum degli Ascomiceti, è un organismo unicellulare,

Dettagli

Malattie genetiche. Dott. Giovanni LONGO

Malattie genetiche. Dott. Giovanni LONGO Malattie genetiche Dott. Giovanni LONGO Il ruolo della ricerca scientifica Esistono una quantità quasi infinita di rimedi o cure contro un'altrettanta quantità di malattie. La ricerca scientifica si occupa

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi Unità didattica di biologia Proprietà della VITA La CELLULA Classificazione dei viventi Info Per una corretta visualizzazione è necessario attivare le Macro! Premere Esc per Uscire

Dettagli