Replicazione del DNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Replicazione del DNA"

Transcript

1 Replicazione del DNA

2

3 La chimica della sintesi del DNA DNA polimerasi III La forca replicativa La fase di inizio della replicazione Selezione delle origini replicative La terminazione della replicazione

4 1953: resoluzione della struttura molecolare del DNA (J. Watson & F. Crick) 1956: la sintesi del DNA e eseguita dalle DNA polimerasi (A. Kornberg) 1958: la replicazione del DNA e semiconservativa (M. Meselsohn & F. Stahl)

5 Tre modelli proposti per la replicazione del DNA Prodotti della 1 o generazione

6 evidenze sperimentali gradiente di densita Meselson & Stahl, 1958

7 evidenze sperimentali DNA pesante DNA ibrido Meselson & Stahl, 1958 x2 DNA ibrido x2 DNA leggero (di nuova sintesi)

8 La doppia elica funge da stampo per la propria replicazione

9 La chimica della sintesi del DNA

10 I substrati necessari per la sintesi del DNA I deossinucleosidi trifosfato (dntp): Deossiadenosina 5 -trifosfato (datp) Deossiguanosina 5 -trifosfato (dgtp) Deossicitidina 5 -trifosfato (dctp) Deossitimidina 5 -trifosfato dttp) Il complesso innesco:stampo (primer : template)

11 In 1956, Arthur Kornberg mostro che il ssdna serve da stampo per la sintesi di nuovi filamenti Scopri la DNA polimerasi I Arthur Kornberg, Premio Nobel, Fisiologia e Medicina 1959

12 Il meccanismo di sintesi del DNA 5 à 3 pirofosfatasi 2P à energia libera

13 La DNA polimerasi si lega al complesso innesco:stampo α-elica α-elica Il dominio palmo contiene gli elementi principali del sito catalitico foglietto-β

14 La DNA pol. utilizza un singolo sito attivo per catalizzare la sintesi del DNA sito di legame al dntp DNA polimerasi L incorporazione del dntp corretto e 10 4 volte piu rapida (selettivita cinetica)

15 dntp rntp La DNA polimerasi puo distinguere fra ribo- e deossinucleosidi trifosfati

16 Due ioni metallici (Mg 2+ ) si legano alla DNA polimerasi e fungono da catalizzatori della polimerizzazione

17 Il dominio dita facilita la catalisi α-elica α-elica foglietto-β

18

19 Il dominio pollice non e direttamente coinvolto nella catalisi Il dominio pollice interagisce con il DNA neosintetizzato per (i) mantenere in corretta posizione l innesco nel sito catalitico, (ii) mantenere il complesso fra la DNA polimerasi ed il substrato (innesco / stampo) L associazione aumenta la capacita della DNA polimerasi di incorporare molti nucleotidi tutte le volte che si lega al complesso innesco / stampo

20 DNA polimerasi: enzima processivo Processivita = numero di dntp polimerizzati in un singolo evento di interazione con stampoinnesco Lega il complesso innesco:stampo (~1 sec) Lega il complesso innesco:stampo (~1 sec) Lo scivolamento dipende da interazioni tra il DNA e la DNA polimerasi (seq. indipendente) Non-processiva: 1 base/sec Processiva: >1000 basi/sec

21 Correzione di errori di sintesi DNA polimerase inserisce 1 dntp errato ogni 10 5 nucleotidi polimerizzati I sistemi di lettura degli errori 1) Esonucleasi* correttore di bozze (proofreading exonuclease): 1 errore ogni ) Meccanismi di riparazione (Mismatch repair): 1 errore ogni *esonucleasi, tagliano all estremita 3 OH *endonucleasi, tagliano all interno del filamento di DNA

22 Proofreading esonucleasi 3 à 5 correggono errori di sintesi Estremita 3 male appaiata riduce la velocita di catalisi e riduce l affinita della polimerasi per il complesso innesco : stampo Aumenta affinita del 3 per il sito esonucleasico dove il dntp errato viene rimosso la sintesi puo continuare L attivita esonucleasica puo solo correggere errori appena inseriti

23 Riassunto La sintesi del DNA procede 5 à 3 attraverso l estensione dell innesco per l aggiunta di nuovi dntp complementari al filamento stampo Nei batteri, la sintesi del DNA e catalizzata da DNA polimerasi III Il dominio a palmo della DNA pol. III contiene gli elementi principali del sito catalitico e un sistema di correzione delle bozze La DNA pol. III e in grado di distinguere il corretto dntp da aggiungere all innesco e di escludere i rntp

24 Replicazione del DNA La chimica della sintesi del DNA DNA polimerasi La forca replicativa La fase di inizio della replicazione Selezione delle origini replicativi La terminazione della replicazione

25 La forca replicativa (leading strand) (lagging strand)

26 RNA primer u u rntp Primasi (RNA polimerasi)

27 Rimozione dell innesco dal DNA neosintetizzato H=hybrid (ibrido RNA:DNA) rimuove l RNA primer rimuove il rntp finale I riempie il gap nick +ATP salda il nick

28 La DNA elicasi apre la doppia elica davanti alla forca replicativa Catalizza l idrolisi di ATP à despiralizza il DNA rompendo i legami idrogeno tra le coppie di basi leading strand lagging strand

29 Le DNA elicasi procariotiche ATP elicasi del batteriofago T7

30 DNA elicasi: enzimi processivi che aprono la doppia elica >1000 coppie di basi / sec)

31 (forcina)

32 Le SSB stabilizzano i singoli filamenti di DNA SSB=single stranded binding protein

33 La pinza scorrevole (sliding clamp) aumenta la processivita della DNA polimerasi RNA primer E. coli E. coli umano

34 Ciclo di caricamento e scaricamento della DNA pol e della pinza sul filamento ritardato

35 Le proteine che agiscono al livello della forca replicativa (replisoma)

36 DNA Pol III oloenzima Centri catalitici: - Pol III core, sintesi del DNA - caricatore della pinza; proteina τ complesso γ, proteina δ

37

38

39

40 A valle della forca replicativa si formano dei superavvolgimenti positivi DNA rilassato = privo di superavvolgimenti DNA superavvolto

41 Il problema di avvolgimento che si verifica durante la replicazione del DNA leading strand lagging strand Ogni ~10 bp replicati = 1 giro dell elica parentale Replicazione di 500 bp / sec = 50 giri / sec

42 Caratteristiche delle topoisomerasi Tipo I Rilassa il DNA superavvolto positivamente o negativamente, taglia un singolo filamento della doppia elica, non richiede ATP Tipo II Rilassa il DNA superavvolto (pos. o neg.), si lega e taglia ambedue i filamenti della doppia elica, richiede ATP. Per entrambi i tipi: Tagliare e risaldare i filamenti a livello dei legami fosfodiesteri Creano un interruzione temporanea che permette lo svolgimento (o avvolgimento) della doppia elica. Ruolo chiave in molti processi cellulari; replicazione del DNA, trascrizione, ricombinazione.

43 Meccanismo di azione della Topoisomerasi I Idrolisi del legame fosfodiestere Formazione del legame fosfotirosina

44 Rotazione = riduzione delle tensioni torsionali Ripristinato il legame fosfodiestere Risultato: la replicazione puo avvenire con la rotazione di un breve tratto di elica - la parte proprio davanti alla forca rep.

45 Nei procarioti, il cromosoma circolare e topologicamente definito perche non puo ruotare

46 Le topoisomerasi sono bersagli di alcuni farmaci anti-cancro I farmaci diretti contro la topoisomerasi II sono usati in circa meta di tutti regimi chemioterapeutici Agiscono come inibitori dell attivita catalitica o come veleni (bloccano il ripristino della doppia elica) Sono diretti preferenzialmente verso le cellule maligne perche esse crescono rapidamente e contengono livelli alti di topoisomerasi rispetto alle cellule normali I farmaci colpiscono anche cellule normali che crescono rapidamente (es. globuli bianchi, cellule epiteliali del tratto gastrointestinale, follicoli piliferi)

47 Replicazione del DNA La chimica della sintesi del DNA DNA polimerasi La forca replicativa La fase di inizio della replicazione Selezione delle origini replicative La terminazione della replicazione

48 L inizio di replicazione nei procarioti (oric o replicatore) La replicazione inizia quando una proteina detta iniziatore (DnaA) si lega al oric in modo sequenza specifica coppie di basi / sec topoisomerasi II E. coli: 4,6 x 10 6 coppie di basi (40 min)

49 Struttura del replicatore (oric) di E. coli sito dove inizia l apertura del DNA (iniziatore) (ricca di AT, facile da aprire) sito dove inizia la replicazione

50 Modello dell inizio della replicazione DnaA: iniziatore che riconosce specifiche sequenze di oric, apre il DNA ~20 bp HU: proteina basica che lega il DNA DnaC: posizionatore dell elicasi DnaB DnaB: elicasi, despiralizza il DNA Funzioni chiave della proteina iniziatrice - legarsi al DNA in modo seq. specifico (oric) - separare i 2 filamenti parentali (~20 bp) - reclutare altre proteine adibite alla replicazione 20 bp

51 L inizio della replicazione e altamente regolato per inibire un inizio ripetuto metiltransferasi dam metiltransferasi dam SeqA ~10 min metiltransferasi dam: aggiunge un gruppo metilico alla A che fa parte della seq. GATC. Normalmente tutte le GATC presenti nel genoma sono metilate SeqA: -riconosce DNA emimetilato in prossimita di oric e previene l associazione della DnaA (iniziatore) su oric e l inizio inappropriato di un nuovo ciclo replicativo

52 L inizio della replicazione negli eucarioti

53 Gli eucarioti replicano e segregano i loro cromosomi in fasi diversi del ciclo cellulare G1: Trascrizione dei geni e sintesi delle proteine S: Replicazione del DNA nucleare G2: sintesi delle proteine dell apparato mitotico (istoni) M: Divisione nucleare (separazione dei cromosomi) e cellulare

54 I cromosomi eucariotici contengono molte origini di replicazione cromosoma con 5 replicatori l attivazione del replicatore parentale determina il blocco dell attivazione dei replicatori sulle molecole di neosintesi fino al ciclo cellulare successivo non tutte le potenziali origini vengono utilizzate

55 La selezione delle origini di replicazione Come fanno le cellule eucariotiche a controllare migliaia di origini di replicazione? - formazione di un complesso pre-replicativo (fase G 1 ) - attivazione dell origine di replicazione (fase S) La successione temporale di questi eventi assicura che ciascun cromosoma venga replicato soltanto una volta durante ciascun ciclo cellulare

56 Formazione del complesso pre-replicativo L iniziatore (ORC) riconosce il replicatore (seq. specifico) ORC = complesso di riconoscimento dell origine ORC recluta due posizionatori dell elicasi, Cdc6 e Cdt1, e l elicasi Mcm2-7 Procar. : Eucar. DnaA: ORC DnaC: Cdc6/Cdt1 DnaB: Mcm2-7 Un complesso Pre-RC si assembla su ciascun replicatore durante la fase G 1, ma rimane inattivo fino a quando la cellula entra in fase S Complesso Pre-RC inattivo

57 Attivazione della replicazione avviene nella fase S ed e regolato dalle chinasi dipendenti da ciclina (Cdk) attivazione di Cdk separazione dei filamenti dell origine reclutamento delle polimerasi inattivazione di Cdk

58 Replicazione del DNA La chimica della sintesi del DNA DNA polimerasi La forca replicativa La fase di inizio della replicazione Selezione delle origini replicative La terminazione della replicazione

59 La terminazione della replicazione cromosoma circolare procariotico cromosoma lineare eucariotico

60 Terminazione della replicazione del cromosoma circolare dei procarioti le proteine che lavorano alla forca replicativa replicano l intera molecola di DNA dopo la replicazione le molecole figlie rimangono concatenate la topoisomerasi II separa i due cromosomi neosintetizzati che vengono segregati in cellule diverse

61 Terminazione della replicazione dei cromosomi lineari eucariotici ssdna non replicato direzione di replicazione leading strand ultimo RNA primer lagging strand ssdna non replicato Il problema della replicazione dei terminali dei cromosomi lineari Una volta rimosso il primer, rimane una corta regione di ssdna non replicata. Se non fosse risolto, questo problema porterebbe ad una perdita di materiale genetico di generazione in generazione

62 I telomeri Costituiti da ripetizioni in tandem di seq. ricche di guanina, nell uomo: TTAGGG Sigillano le estremita dei cromosomi impedendo ai cromosomi di legarsi insieme. L eventuale perdita dei telomeri porta alla fusione dei cromosomi e conseguente morte cellulare struttura ad ansa

63 TTAGGG

64 Telomerasi parte proteica regione telomerico del filamento parentale RNA stampo endogeno La telomerasi allunga il terminale 3 del filamento parentale usando la sua attivita di trascrittasi inversa per sintetizzare DNA complementare all estremita 5 dell RNA stampo estensione del telomero

65 Il problema della replicazione dei terminali dei cromosomi lineari La parte allungata al 3 puo funzionare per la sintesi di un frammento di Okazaki

66 Modello della regolazione dell attivita della telomerasi TRF1: TTAGGG repeat factor 1 POT1: protezione dei telomeri 1 Quando il telomero e lungo abbastanza, i livelli di POT1 sull estremita 3 sono alti, il che impedisce l accesso della telomerasi ai telomeri à attivita telomerasica viene bloccata Quando il telomero e ancora troppo corto, i livelli di POT1 sull estremita 3 sono bassi e la telomerasi si lega all estremita 3 e estende il telomero

67 La sporgenza 3 si ripiega in una struttura ad ansa mediante l invasione del ssdna all interno del doppio filamento. Poiche la telomerasi ha bisogno di un estremita 3, la sua attivita e bloccata dalla struttura ad ansa

68 Senza la telomerasi i cromosomi si accorciano ad ogni ciclo di replicazione, con conseguente e progressiva perdita di materiale genetico

69 Telomerasi, invecchiamento e cancro Tipo cellulare Lunghezza dei telomeri Attivita telomerasica Eucarioti unicellulari Mantenuta + Cellule germinali umane (spermatazoi, oociti) Cellule somatiche umane Cellule cancerose umane Mantenuta + Accorciamento progressivo ( nucleotidi / divisione) Mantenuta + - La maggior parte delle cellule somatiche umane non esprimono abbastanza telomerasi per mantenere una lunghezza costante dei telomeri duranti i cicli di replicazione dei cromosomi

70 L accorciamento dei telomeri: un orologio per l invecchiamento? Le cellule somatiche hanno una capacita limitata di divisione dovuta ad un accorciamento progressivo dei telomeri Un ulteriore accorciamento scatena uno stato irreversibile di senescenza in cui la cellula continua a vivere senza dividersi La correlazione fra senescenza cellulare e attivita telomerasica ha portato all ipotesi dell orologio molecolare La senescenza cellulare puo essere un meccanismo per proteggere gli organismi multicellulari dal cancro

71

72 Assemblaggio dei nucleosomi dopo la replicazione La replicazione richiede il parziale disassemblaggio dei nucleosomi Dopo la replicazione il DNA e rapidamente riorganizzato in cromatina mediante una serie di eventi preordinati Negli eucarioti, la rapida compattazione del DNA e necessaria per il passaggio dalle fase S alle fasi G 2 -M (mitosi). Le informazioni immagazzinate nelle modificazioni istoniche sono trasferite alle molecole figlie

73 Modificazione delle code N-terminali degl istoni I numeri indicano la posizione di residui amminoacidici specifici (lisina, serina, arginina)

74 Modificazioni globali della cromatina Eucromatina: - 90% del genoma - decondensata in interfase - stato permissivo per trascrizione genica Eterocromatina: -10% del genoma - rimane condensata anche in interfase - conc. al centromero e ai telomeri - ospita pochi geni, trascrizionalmente inattiva

75 Modificazioni locali della cromatina

76 La composizione dei nucleosomi del filamento neosintetizzato? meta di nuova sintesi e meta vecchi istoni riciclati? come sono distribuiti? tutti di nuova sintesi? Che succede alle informazioni immagazzinate Nel codice istonico?

77 Ridistribuzione degli istoni dopo la replicazione del DNA I vecchi tetrameri H3-H4 vengono trasferiti casualmente ad entrambi i cromosomi figli. I tetrameri H3-H4 neosintetizzati formano la base di nucleosomi che non hanno ricevuto tetrameri vecchi I vecchi dimeri H2A- H2B vengono rilasciati nel pool solubile di istoni e si mescolano con quelli di neosintesi DISASSEMBLAGGIO (Fattori di rimodellamento della cromatina)

78 L assemblaggio dei nucleosomi richiede dei trasportatori di istoni PCNA recluta il trasportatore di istoni CAF-1 (H3.H4) NAP-1 trasporta i dimeri H2A.H2B

79 Le modificazioni istoniche parentali sono propagate ai cromosomi replicati Le modificazioni reclutano enzimi che determinano le stesse modificazioni dei nuovi istoni adiacenti

80 Sommario Durante la replicazione dei cromosomi i nucleosomi sono temporaneamente disassemblati. I tetrameri H3-H4 vengono casualmente distribuiti sui filamenti neosintetizzati. I dimeri H2A-H2B vengono rilasciati nel pool solubile di istoni e si mescolano con quelli di nuova sintesi. Statisticamente, ciascun filamento neosintetizzato riceve meta dei vecchi e meta dei nuovi istoni. Dopo la replicazione entrambi i cromosomi ereditano istoni modificati che possono funzionare da guida per la modificazione dei nuovi istoni adiacenti

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Ciclo cellulare Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Arthur Kornberg, 1970 Replicazione

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Il modello del Replicone

Il modello del Replicone Il modello del Replicone Il replicone copre l intera regione di DNA replicata a partire da una singola origine di replicazione (es. il genoma di E.coli corrisponde ad un singolo replicone). Il replicone

Dettagli

Interfase. La REPLICAZIONE del DNA

Interfase. La REPLICAZIONE del DNA Interfase La REPLICAZIONE del DNA REPLICAZIONE del DNA Doppia elica parentale Il modello di replicazione del DNA ipotizzato da Watson e Crick è basato sulla complementarietà delle basi dei due filamenti

Dettagli

Biologia Molecolare. CDLM in CTF La Replicazione del DNA

Biologia Molecolare. CDLM in CTF La Replicazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La Replicazione del DNA Prospettiva Storica La replicazione semidiscontinua Differenze tra procarioti ed eucarioti E fondamentale che ad ogni divisione cellulare

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 21 La replicazione del DNA Concetti chiave: La DNA polimerasi necessita di uno stampo e di inneschi (i primer) per sintetizzare

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Mappa del cromosoma di E. coli in cui sono indicate le posizioni dei geni che codificano proteine importanti per il metabolismo del DNA L esperimento di Meselson e Stahl (1957):

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio LEZIONE III DUPLICAZIONE DEL DNA Dott. Paolo Cascio DUPLICAZIONE DEL DNA NEI PROCARIOTI LA DUPLICAZIONE DEL CROMOSOMA BATTERICO CIRCOLARE INIZIA IN UN UNICO PUNTO E PROCEDE BIDIREZIONALMENTE FINO A QUANDO

Dettagli

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti?

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Domande Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Tre modelli di replicazione del DNA Meselson e Stahl 1958 http://www.youtube.com/watch?v=kybdh8vpigk

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin Watson e Crick Rosalind Franklin Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. citochinesi: o citodieresi. Divisione del citoplasma

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

Telomeri e Telomerasi:

Telomeri e Telomerasi: Telomeri e Telomerasi: 1 I cromosomi eucariotici sono molecole lineari, a doppio filamento, che terminano generalmente con un segmento di 10000 coppie di basi, costituito da piccole sequenze nucleotidiche

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito

Dettagli

CAPITOLO 10. La biosintesi degli acidi nucleici: la replicazione. 10.1 Il flusso dell informazione genetica nella cellula

CAPITOLO 10. La biosintesi degli acidi nucleici: la replicazione. 10.1 Il flusso dell informazione genetica nella cellula La biosintesi degli acidi nucleici: la replicazione CAPITL 10 10.1 Il flusso dell informazione genetica nella cellula La sequenza di basi nel DNA codifica l informazione genetica. La duplicazione del DNA,

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

CORSO DI BIOLOGIA - Programma

CORSO DI BIOLOGIA - Programma CORSO DI BIOLOGIA - Programma 1. Nozioni introduttive: Le macromolecole biologiche: proteine, lipidi, carboidrati ed acidi nucleici Organizzazione cellulare in procarioti ed eucarioti 2. Struttura e funzione

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Modelli proposti per la replicazione del DNA Alla fine degli anni 1950 erano stati proposti tre modelli per la replicazione del DNA Modello Conservativo Entrambe le eliche parentali

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi

Dettagli

Flusso dell informazione genetica

Flusso dell informazione genetica Flusso dell informazione genetica 1 Trascrizione dell RNA (1) Topoisomerasi La trascrizione è catalizzata dalla RNA polimerasi diretta dal DNA con un meccanismo molto simile alla DNA polimerasi Differenze

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI La tecnologia del DNA ricombinante è molto complessa dal punto di vista operativo, ma dal punto di vista concettuale si basa su criteri

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Struttura e replicazione del DNA

Struttura e replicazione del DNA Struttura e replicazione del DNA La struttura del DNA e stata chiarita nel 1953 ad opera di Watson e Crick A quel tempo si sapeva che: - I geni erano fattori ereditari (Mendel) - I geni controllano la

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Geni che regolano la divisione cellulare

Geni che regolano la divisione cellulare Geni che regolano la divisione cellulare!geni il cui prodotto proteico promuove un aumento del numero di cellule (oncogeni) Oncogeni = acceleratori!geni il cui prodotto proteico induce una riduzione del

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

Trascrizione. Testi Watson et al. Biologia Molecolare del Gene, Zanichelli Nelson et al, Principi di Biochimica di Lehninger, Zanichelli

Trascrizione. Testi Watson et al. Biologia Molecolare del Gene, Zanichelli Nelson et al, Principi di Biochimica di Lehninger, Zanichelli Trascrizione Testi Watson et al. Biologia Molecolare del Gene, Zanichelli Nelson et al, Principi di Biochimica di Lehninger, Zanichelli Maurizio Crestani I componen) fondamentali del DNA Polimero di nucleo.di

Dettagli

CONTROLLO DELL ESPRESSIONE GENICA NEI PROCARIOTI

CONTROLLO DELL ESPRESSIONE GENICA NEI PROCARIOTI CONTROLLO DELL ESPRESSIONE GENICA NEI PROCARIOTI Unità trascrizionale E. Coli possiede diversi fattori sigma generale shock da calore carenza di azoto sintesi flagellare stress calore e sali Fattori sigma

Dettagli

Adenina Adenine H H N N N N N Z

Adenina Adenine H H N N N N N Z Adenina Adenine Z Guanina O GUAIA Z Citosina CITOSIA Z O Timina Thymine C3 O Z O Siti di attacco elettrofilo 3 Thymine Basi appaiate: Timina-Adenina Adenine C 3 O O 3.ooA Basi appaiate: Citosina-Guanina

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

Il DNA: struttura e replicazione

Il DNA: struttura e replicazione Il DNA: struttura e replicazione «La fortuna favorisce una mente preparata» L. Pasteur Il cancro al testicolo consiste di divisioni rapide e incontrollate delle cellule germinali. Si diffonde ad altri

Dettagli

Discipline biotecnologiche comuni; discipline biologiche CODICE INSEGNAMENTO SETTORI SCIENTIFICO DISCIPLINARI BIO/11 DOCENTE RESPONSABILE

Discipline biotecnologiche comuni; discipline biologiche CODICE INSEGNAMENTO SETTORI SCIENTIFICO DISCIPLINARI BIO/11 DOCENTE RESPONSABILE FACOLTÀ Scienze MM.FF.NN. ANNO ACCADEMICO 2014-2015 CORSO DI LAUREA Biotecnologie (cod.2075) INSEGNAMENTO BIOLOGIA MOLECOLARE TIPO DI ATTIVITÀ Caratterizzante AMBITO DISCIPLINARE Discipline biotecnologiche

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

Lezione 1: Atomi e molecole:

Lezione 1: Atomi e molecole: Lezione 1: Atomi e molecole: La materia è costituita da elementi chimici in forma pura o in combinazioni dette composti. La vita richiede circa 25 elementi chimici. La struttura atomica determina il comportamento

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 20 Geni e cromosomi Concetti chiave: Il DNA superavvolto può essere descritto in termini di numero di legami, avvolgimenti

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente:

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente: Materiale Didattico Titolo modulo: Biologia applicata alla ricerca Biomedica LA TRASCRIZIONE Docente: FLUSSI DI INFORMAZIONE ATTRAVERSO LA CELLULA 1. Accessibilità del genoma 2. Assemblaggio del complesso

Dettagli

Trascrizione negli Eucariotici

Trascrizione negli Eucariotici Trascrizione negli Eucariotici Cytoplasm DNA RNA Transcription RNA Processing mrna G Nucleus AAAAAA Export G AAAAAA CLASSI DI GENI Le unità di trascrizione eucariotiche sono più complesse di quelle procariotiche

Dettagli

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare Università degli Studi del Sannio Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a. 2010-2011 Programma di Biologia Cellulare (Prof Massimo Mallardo, I semestre, I anno) massimo.mallardo@unina.it

Dettagli

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

LA REGOLAZIONE GENICA DEI PROCARIOTI.

LA REGOLAZIONE GENICA DEI PROCARIOTI. LA REGOLAZIONE GENICA DEI PROCARIOTI www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con cui viene

Dettagli

Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da

Dettagli

Telomere terminal transferase: telomerase

Telomere terminal transferase: telomerase Telomere terminal transferase: telomerase UNO DEI MAGGIORI QUESITI DI BIOLOGIA DEGLI ULTIMI 25 ANNI: come i cromosomi possono essere copiati completamente durante le divisioni cellulari e come vengono

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton)

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton) Mutazioni nelle cellule somatiche e genetica del cancro (Teoria Boveri - Sutton) Walter Stanborough Sutton Theodor Boveri Walter S. Sutton: Teoria dell ereditarietà dei cromosomi 1914: Teoria cromosomica

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Premio nobel per la medicina 1962 LA STRUTTURA DEL DNA

Premio nobel per la medicina 1962 LA STRUTTURA DEL DNA Premio nobel per la medicina 1962 LA STRUTTURA DEL DNA STRUTTURA DNA (acido deossiribonucleico) BASI AZOTATE adenina (A) citosina (C) guanina (G) timina (T). Adenina e guanina sono composti eterociclici

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT2 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 IL MATERIALE GENETICO 2 2 Per svolgere il proprio ruolo, il materiale genetico

Dettagli

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

Malattie genetiche. Dott. Giovanni LONGO

Malattie genetiche. Dott. Giovanni LONGO Malattie genetiche Dott. Giovanni LONGO Il ruolo della ricerca scientifica Esistono una quantità quasi infinita di rimedi o cure contro un'altrettanta quantità di malattie. La ricerca scientifica si occupa

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

flusso dell'informazione genetica è monodirezionale

flusso dell'informazione genetica è monodirezionale 5. La Trascrizione contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale dogma centrale della biologia molecolare flusso dell'informazione

Dettagli

27/01/2012. Ciclo Cellulare. Biotecnologie 2011 M.G. Bottone

27/01/2012. Ciclo Cellulare. Biotecnologie 2011 M.G. Bottone Ciclo Cellulare Biotecnologie 2011 M.G. Bottone 1 FASI DEL CICLO CELLULARE INTERFASE (1) Il ciclo di divisione della maggior parte delle cellule eucariotiche è suddiviso in quattro fasi distinte: M, G

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione negli eucarioti I meccanismi della trascrizione Organizzazione generale delle sequenze regolative Il macchinario generale della trascrizione Si

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Relazione sequenza-struttura e funzione

Relazione sequenza-struttura e funzione Biotecnologie applicate alla progettazione e sviluppo di molecole biologicamente attive A.A. 2010-2011 Modulo di Biologia Strutturale Relazione sequenza-struttura e funzione Marco Nardini Dipartimento

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2013-2014 corso A- L Docente: Massimo Gulisano m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza dei legami deboli

Dettagli

CICLO CELLULARE EUCARIOTICO

CICLO CELLULARE EUCARIOTICO CICLO CELLULARE EUCARIOTICO COMPESSO SISTEMA DI CONTROLLO OMEOSTASI ORGANISMO NORMALE G 0 CANCRO DNA marcato con molecole intercalanti fluorescenti Fluorescence Activated Cell Sorting (FACS) Rilevazione

Dettagli

Interazioni DNA-proteina

Interazioni DNA-proteina Interazioni DNA-proteina Leucine Zipper - YouTube [freecorder.com].flv Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione

Dettagli

Lezione 12. Origine degli introni

Lezione 12. Origine degli introni Lezione 12 Origine degli introni Nature Reviews Genetics 2006 Introni di gruppo I batteri, organelli identificati circa 1500 Introni di gruppo II identificati circa 200 Introni con spliceosomi genoma nucleare

Dettagli