Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno"


1 Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento nucleare è costituito dall involucro nucleare: separa il contenuto del nucleo dal citoplasma. E costituito da una doppia membrana perforata dai pori nucleari, in continuità con il RE. L involucro di un nucleo interfasico (vedi figure) contiene: la cromatina (DNA + proteine), uno o più nucleoli, il nucleoplasma, la lamina nucleare. L involucro nucleare è presente solo durante l'interfase (ovvero l insieme di tutte le fasi del ciclo cellulare esclusa la M, fase mitotica)

2 La lamina nucleare è una sottile e densa rete di fibre che tappezza la superficie interna della membrana nucleare interna e che serve da sostegno all involucro nucleare. E costituita dai filamenti intermedi chiamati lamìne. La rete di lamìne sulla superficie interna dell involucro nucleare

3 Il DNA degli eucarioti si suddivide a formare i CROMOSOMI Il genoma degli eucarioti è suddiviso in cromosomi, il cui numero è tipico per ogni specie (23 nella specie umana). Nella maggior parte degli animali il corredo genetico è diploide, cioè ogni cromosoma è presente in due copie omologhe, una di origine paterna e una di origine materna (2n). Nelle cellule somatiche umane sono quindi presenti 23 coppie di cromosomi omologhi.

4 Il nucleolo Nel nucleolo vengono trascritti e maturati gli rrna 18S, 28S e 5.8S (non il 5S) che, insieme alle proteine ribosomali provenienti dal citoplasma, formano le due subunità ribosomali. Queste vengono poi esportate nel citoplasma. L rrna 5S viene trascritto fuori dal nucleolo, da geni presenti in numerose copie su diversi cromosomi. Nel nucleolo vengono sintetizzati e maturati anche altri RNA, come i trna, e assemblate piccole ribonucleoproteine.

5 Tipi di cromatina Il DNA degli eucarioti viene compattato principalmente tramite l associazione con specifiche proteine basiche (gli ISTONI), formando insieme la CROMATINA. Al microscopio elettronico i nuclei interfasici appaiono come strutture eterogenee con aree elettrondense (eterocromatina, porzioni in cui la sintesi di RNA non è attiva) e aree elettron-trasparenti (eucromatina, sintesi attiva di RNA). Eucromatina ed eterocromatina sono distinguibile anche al microscopio ottico, sfruttando opportune colorazioni

6 I nucleosomi sono le unità strutturali di base della cromatina negli eucarioti. Livelli ulteriori di impacchettamento della cromatina portano alla formazione di fibre di cromatina, fino ad arrivare al cromosoma condensato delle cellule in divisione

7 Il cromosoma metafasico (o mitotico) Durante la vita della cellula i cromosomi possono presentarsi in almeno due stati diversi: cromosomi interfasici (non condensati, non sono facilmente distinguibili, li troviamo nel nucleo durante l interfase). cromosomi mitotici (altamente condensati, distinguibili solo durante la mitosi) Il cromosoma mitotico risulta da una replicazione del DNA e dalla condensazione della cromatina: è quindi formato da due copie identiche (i due cromatidi) di un cromosoma, unite a livello del centromero.

8 Il cariotipo Si può arrestare la mitosi in metafase con colchicina e si possono esaminare i singoli cromosomi per classificarli in base a differenze di dimensione e forma (analisi del cariotipo) femmina maschio L analisi del cariotipo permette di evidenziare eventuali anomalie cromosomiche, sia numeriche (quali trisomie, monosomie) che strutturali (traslocazioni, delezioni, inversioni) Cariotipo di cromosomi umani ottenuti da leucociti in coltura

9 Schema della colorazione (bandeggio) dei cromosomi umani ottenuta con il colorante GIEMSA (CROMOSOMI visibili al microscopiio ottico). Le bande evidenziano zone con diversa composizione in basi (abbondanza di coppie G-C) e sono specifiche per ogni coppia di cromosomi

10 Tutte le cellule tra una divisione e l altra hanno bisogno di passare attraverso una serie di stadi definiti, che costituiscono il CICLO CELLULARE La funzione fondamentale del ciclo cellulare è la duplicazione del DNA contenuto nei cromosomi (fase S), e la distribuzione di 1 copia identica nelle 2 cellule figlie (fase M) M = divisione mitotica S = sintesi (replicazione) del DNA G1 = gap 1 = intervallo tra M e S (intervallo pre-sintesi DNA) G2 = gap 2 = intervallo tra S e M (intervallo post-sintesi DNA) Interfase = periodo di tempo del ciclo cellulare che intercorre tra una mitosi e la successiva. Somma di G1 + S + M

11 Il ciclo cellulare è uguale per tutte le cellule? La durata del ciclo cellulare varia a seconda del tipo cellulare. Cellule in attiva proliferazione in coltura hanno un ciclo cellulare di ore. La fase la cui durata varia maggiormente è la G1.

12 Durante tutta l interfase i cromosomi sono dispersi a formare l eterocromatina e l eucromatina (cromosomi interfasici). Il condensamento dei cromosomi avviene esclusivamente in fase M (cromosomi mitotici) Cromosomi condensati

13 Durante l interfase, oltre alle normali attività cellulari, si verificano due eventi indispensabili preliminari per la divisione cellulare: Nella fase S, replicando il DNA, si ottengono due copie dell informazione genetica (due cromatidi per ogni cromosoma). La duplicazione dei centrosomi permette di formare un macchinario microtubulare simmetrico, che trasporterà una copia dell informazione genetica (uno dei due cromatidi fratelli) a ciascuna delle due cellule figlie

14 Le cellule che non si dividono più sono dette quiescenti o in G 0. I neuroni del sistema nervoso centrale sono cellule postmitotiche che rimangono permanentemente in G 0. Altri tipi cellulari possono invece rientrare nel ciclo cellulare e compiere nuove mitosi.



17 Punti di controllo del ciclo cellulare I segnali mitogenici sono fondamentali per superare il punto di controllo in G1

18 La composizione dei cromosomi durante il ciclo cellulare

19 LA MITOSI La fase M del ciclo cellulare è scomponibile in una serie di eventi molto precisi:

20 La fase M (MITOSI) è scatenata principalmente da una cascata di fosforilazioni che inducono vari effetti, tra cui: la condensazione della cromatina l assemblaggio del fuso mitotico e la riorganizzazione del citoscheletro la disgregazione dell involucro nucleare

21 Le sei suddivisioni della mitosi:




La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare



CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa


Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano


Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo



ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui


L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale


La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione


MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione


Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,


La cellula eucariotica animale

La cellula eucariotica animale Tutte le cellule sono circondate da una membrana plasmatica costituita da fosfolipidi e proteine. Le cellule eucariotiche posseggono organuli rivestiti di membrana. L organulo di dimensioni maggiori è


Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA


La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati


1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili


Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e


Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione


Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando


Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.


Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule


L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi



NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla


Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23


Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE


Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante


La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi


Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi


MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte


ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI


Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,


La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il


Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Doppia membrana Pori Matrice


VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la





La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,


La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione


Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,


IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare


Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente



Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad


DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23



GENI, GENOMI E CROMOSOMI GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna


Base cellulare della vita

Base cellulare della vita Base cellulare della vita La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria cellulare (Schleiden e


Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva


Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule


Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione


18_ciclo cellulare_mitosi

18_ciclo cellulare_mitosi Citologia Animale e Vegetale (corso A - I. Perroteau) - ciclo cellulare 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis S per sintesi


Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori


MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA


Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi


Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del





Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento


Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare Principi di Citologia e Istologia. Prof. Pucci, 2003 Il compartimento nucleare Il Compartimento Nucleare Il compartimento nucleare è caratteristica propria degli eucarioti. Il compartimento consiste delle


CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO CORSO DI GENETICA IL CROMOSOMA EILCARIOTIPO Dal DNA ai cromosomi I cromosomi Il materiale ereditario degli eucarioti è organizzato in cromosomi il cui numero e la cui morfologia sono costanti nelle varie


Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Pori Matrice Nucleare


Botanica e Diversità Vegetale. AA canale O-Z

Botanica e Diversità Vegetale. AA canale O-Z Botanica e Diversità Vegetale AA 2016-2017 canale O-Z IL NUCLEO Nelle cellule degli Eucarioti si sono evoluti meccanismi perfezionati di sintesi proteica e di EQUA distribuzione del materiale genetico


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo


VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione



CICLO CELLULARE MITOTICO Cellula Procariotica La divisione cellulare è rapida e semplice. I batteri non hanno un nucleo e contengono un solo cromosoma di DNA circolare attaccato alla membrana plasmatica dove resta mentre si duplica.


La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula


La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti. 1 riproduzione Negli organismi in cui avviene la riproduzione


Allestimento di un cariotipo di cromosomi umani

Allestimento di un cariotipo di cromosomi umani Allestimento di un cariotipo di cromosomi umani The picture that established 46 as the chromosome number in man. Reproduced with permission from Ref. 1 (1956) Mendelian Society of Lund for the Scandinavian



CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso



TEST BIOLOGIA 25/08 GENETICA 1. Il Crossing over avviene durante: A) La profase meiotica B) La metafase meiotica C) La profase mitotica D) La metafase mitotica E) L anafase meiotica TEST BIOLOGIA 25/08 GENETICA 2. La sequenza corretta


Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti


Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del


Biologia generale Prof.ssa Bernardo

Biologia generale Prof.ssa Bernardo Cellula procariotica cellula eucariotica CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica,


Lezione 6. Ultima per Fisioterapia Logopedia Ortottica TRP 1. MITOSI 2.MEIOSI

Lezione 6. Ultima per Fisioterapia Logopedia Ortottica TRP 1. MITOSI 2.MEIOSI 1. MITOSI Lezione 6 Ultima per Fisioterapia Logopedia Ortottica TRP 2.MEIOSI 1. MITOSI 2.MEIOSI Il ciclo cellulare Il ciclo cellulare ha come compito fondamentale la duplicazione accurata del DNA cellulare


L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per:

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per: Nucleo L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: 1. Citoplasma 2. Materiale Genetico 3. Membrana Plasmatica Differiscono tra loro per: Forma Dimensione Funzione



DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione



REGOLAZIONE DEL CICLO CELLULARE REGOLAZIONE DEL CICLO CELLULARE Il sistema di controllo che regola la progressione del ciclo cellulare deve: 1) Garantire che tutti i processi associati con le diverse fasi siano portati a termine al tempo


Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si LA CELLULA Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si nutre, respira, scambia sostanze con l ambiente



2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 2. DUPLICAZIONE DNA 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 1 1. COMPOSIZIONE e STRUTTURA Ma che cos è il DNA? è un contenitore di informazioni... scritte come sequenza di basi azotate 2 Acidi Nucleici:


2. I cromosomi 16/03/15. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

2. I cromosomi 16/03/15. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 2. I cromosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2011 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare


Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione


La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.


Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200


IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm)

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm) Il nucleo IL NUCLEO IL NUCLEO Nelle cellule eucariote c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola


La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per


La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3


MERISTEMI APICALI. Apice del germoglio. Apice radicale

MERISTEMI APICALI. Apice del germoglio. Apice radicale MERISTEMI APICALI Apice del germoglio Apice radicale CICLO CELLULARE CHECK POINT 3 CHECK POINT 2 CHECK POINT 1 Le cellule vegetali differentemente da quelle animali possono abbandonare il ciclo di divisione



MITOSI 09/11/16 CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C 4C MITOSI CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C (il valore C indica la quantità di DNA contenuto delle cellule, dove C è il contenuto aploide della specie). Dopo la replicazione C è raddoppiato


Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico


GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni


Divisione cellulare: processo che dà origine a nuove cellule. Avviene durante lo sviluppo embrionale, nella formazione dell organismo adulto e nella

Divisione cellulare: processo che dà origine a nuove cellule. Avviene durante lo sviluppo embrionale, nella formazione dell organismo adulto e nella Mitosi, Meiosi Divisione cellulare: processo che dà origine a nuove cellule. Avviene durante lo sviluppo embrionale, nella formazione dell organismo adulto e nella vita adulta, dove circa 25 milioni di


CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule.

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. LA CELLULA CELLULA La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. CELLULA La teoria cellulare Le cellule furono


David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi


- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione


Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi!

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Esercizio 1 Di seguito puoi osservare il cariotipo (patrimonio cromosomico)


CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono


Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,


Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria


3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali Strutture cellulari comuni tra cellule animali e vegetali: CITOPLASMA CITOSCHELETRO RIBOSOMI RETICOLO ENDOPLASMATICO APPARATO DEL GOLGI MITOCONDRI NUCLEO PEROSSISOMI CITOPLASMA materiale gelatinoso incolore


Mitosi, ciclo cellulare e sua regolazione.

Mitosi, ciclo cellulare e sua regolazione. Mitosi, ciclo cellulare e sua regolazione La dinamica del DNA nel corso della mitosi Schema delle fasi della mitosi Immagine al microscopio ottico di cellule vegetali in interfase
