Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita"

Transcript

1 Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

2 Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule diverse (anche a seguito di fecondazione)

3 cariotipo

4 Chromosome painting (cariotipo)

5

6 In ogni coppia di cromosomi uno e di origine paterna e uno di origine materna I cromosomi sono presenti in coppie nelle cellule somatiche e i membri di una coppia sono i cromosomi omologhi. Se una cellula contiene 2 cromosomi di ogni tipo, cioè due serie di cromosomi, si dice che possiede un corredo cromosomico diploide; se invece è presente un cromosoma di ogni coppia di omologhi, si dice che il corredo è aploide. Nell uomo il numero diploide è 46; il numero aploide è 23

7

8 Variazioni delle caratteristiche dei cromosomi in organismi differenti I cromosomi possono essere lineari o circolari. Le cellule mantengono un numero caratteristico di cromosomi. La maggioranza delle cellule eucariotiche sono diploidi. Le due copie di cromosomi sono dette omologhi.

9 Comparazione della densita genica in genomi di organismi diversi. La dimensione del genoma correla con la complessita dell organismo?

10 Confronto della densita genica in cromosomi di organismi differenti Il genoma di E. colie composto quasi interamente di geni. Organismi piu complessi hanno una ridotta densita genica. I geni rappresentano una piccola porzione del DNA cromosomico in cellule eucariotiche.

11 Dove sono i cromosomi in interfase? (che cos e l interfase?)

12 In interfase i cromosomi sembrano rimanere in specifiche regioni del nucleo

13 Territori cromosomici (in interfase)

14 Vedete la signora che ha perso il tezo bottone del cappotto grigio?

15 Ciclo cellulare

16 MITOSI Processo di divisione cellulare che garantisce la conservazione e la distribuzione dello stesso numero di cromosomi da una cellula madre alle due cellule figlie. Il materiale cromosomico raddoppia unavolta e la cellula si divide una volta. La mitosi produce sempre due cellule geneticamente identiche alla cellula madre.

17 Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi diventano contemporaneamente più corti e più spessi. Ogni cromosoma è stato duplicato durante la precedente fase S e consiste di una coppia di unità identiche chiamate cromatidi fratelli. Ogni cromatide contiene una regione chiamata centromero.

18

19

20 Fasi della Mitosi

21 Dove sono i cromosomi in interfase?

22 Hey Houston we have a problem Homo sapiens: genoma di 3200 Mb = 3.2x10 9 coppie di basi Distanza fra coppie di basi in B-DNA = 3.4A = 0.34 nm Lunghezza del genoma umano: 3.2x10 9 x 0.34 nm = ~1m Lunghezza del DNA in una cellula somatica umana =. Diametro di una tipica cellula eucariotica = 10µm

23

24 Differenti livelli della struttura cromosomica possono essere osservati al microscopio elettronico

25

26 Nucleosomi Rosso = H2A Giallo = H2B Viola = H3 Verde = H4 Il DNA legato al nucleosoma e chiamato core DNA (compie circa 1.65 giri intorno al nucleosoma In questo modo il DNA viene compattato di circa un fattore 6

27 Le code N-terminali degli istoni sono accessibili alle proteasi Trattamento blando con proteasi (es tripsina) che tagliano sequenza proteica a livello di amminoacidi basici possono rimuovere le code istoniche lasciando il core del nucleosoma intatto

28 Plasticita

29 Plasticita

30 Plasticita Muntjac

31 Utilizzo differenziale dell informazione genetica The Histone Code Modificazioni delle code Nter degli istoni alterano la funzione della cromatina David Allis Brian Strahl

32 Mappa di siti noti di modificazioni post-traduzionali a code istoniche; S= serina; K= lisina; R= arginina; P = fosforilazione; Me= metilazione; Ac= acetilazione

33 Effetti indotti dalla modificazione degli istoni

34

35 Nel 1875 Charles Darwin descrisse ereditarieta di una condizione genetica, la diplasia ectodermica ipoidrotica 10 uomini nel corso di 4 generazioni nessuna figlia fu colpita da questa affezione Sebbene le figlie non fossero colpite, esse trasmettevano quella tendenza ai loro figli. Non si conosce esempio di trasmissione di figlio in figlio. (trad. G. Canestrini)

36

37 Mosaicismo

38 A livello cellulare le femmine sono emizigoti dal punto di vista funzionale? Approssimativamente, 50% delle cellule esprimerà un allele, il restante 50% l altro, sebbene non all interno della stessa cellula Cellule non identiche rispetto all espressione geni X ----> mosaico

39 L inattivazionedel chr.x e casuale(un singololocus sux e responsabile della colorazione arancione)

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.

Dettagli

2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI

2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 2. DUPLICAZIONE DNA 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 1 1. COMPOSIZIONE e STRUTTURA Ma che cos è il DNA? è un contenitore di informazioni... scritte come sequenza di basi azotate 2 Acidi Nucleici:

Dettagli

GENI, GENOMI E CROMOSOMI

GENI, GENOMI E CROMOSOMI www.fisiokinesiterapia.biz GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna

Dettagli

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini pallavic@units.it MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

RIPRODUZIONE ED EREDITARIETA

RIPRODUZIONE ED EREDITARIETA RIPRODUZIONE ED EREDITARIETA Tipi di riproduzione La sopravvivenza di ciascuna specie è basata sulla capacità degli individui di riprodursi. Vi sono due forme principali di riproduzione: asessuata e sessuata.

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

Unità 4 - Le cellule e l ereditarietà

Unità 4 - Le cellule e l ereditarietà Unità 4 - Le cellule e l ereditarietà 1 1. La vita delle cellule La produzione di nuove cellule avviene attraverso un processo chiamato divisione cellulare. 2 1. La vita delle cellule La divisione cellulare

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

CICLO CELLULARE MITOSI MEIOSI

CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna GENETICA GENERALE - 1 CFU Modulo Biologia Applicata e Genetica generale CORSO INTEGRATO: SCIENZE BIOLOGICHE - 7 CFU Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata

Dettagli

MITOSI 09/11/16 CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI

MITOSI 09/11/16 CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C 4C MITOSI CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C (il valore C indica la quantità di DNA contenuto delle cellule, dove C è il contenuto aploide della specie). Dopo la replicazione C è raddoppiato

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la

Dettagli

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1.

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Insieme delle caratteristiche contenute nei geni, sia quelle manifeste, sia

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

CICLO CELLULARE MITOTICO

CICLO CELLULARE MITOTICO Cellula Procariotica La divisione cellulare è rapida e semplice. I batteri non hanno un nucleo e contengono un solo cromosoma di DNA circolare attaccato alla membrana plasmatica dove resta mentre si duplica.

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento

Dettagli

La genetica è la scienza dell ereditarietà: Studia la trasmissione delle caratteristiche ereditarie, che distinguono gli individui tra di loro

La genetica è la scienza dell ereditarietà: Studia la trasmissione delle caratteristiche ereditarie, che distinguono gli individui tra di loro La genetica è la scienza dell ereditarietà: Studia la trasmissione delle caratteristiche ereditarie, che distinguono gli individui tra di loro la comprensione di come i geni si trasmettono da genitori

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

Stesso DNA ma cellule diverse

Stesso DNA ma cellule diverse Stesso DNA ma cellule diverse Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico I cromosomi sono in coppia Ogni cromosoma

Dettagli

MERISTEMI APICALI. Apice del germoglio. Apice radicale

MERISTEMI APICALI. Apice del germoglio. Apice radicale MERISTEMI APICALI Apice del germoglio Apice radicale CICLO CELLULARE CHECK POINT 3 CHECK POINT 2 CHECK POINT 1 Le cellule vegetali differentemente da quelle animali possono abbandonare il ciclo di divisione

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti. 1 riproduzione Negli organismi in cui avviene la riproduzione

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura Università di Bari Teoria Cromosomica Alcune caratteristiche fenotipiche di D. melanogaster Incrocio di un maschio white con femmina selvatica in D. melanogaster P SE FOSSE IL SEMPLICE FATTORE MEDELIANO?

Dettagli

Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso

Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso Nel DNA dei cromosomi sono codificati i caratteri specifici per ogni individuo, in settori detti geni un carattere

Dettagli

INATTIVAZIONE DEL CROMOSOMA X

INATTIVAZIONE DEL CROMOSOMA X INATTIVAZIONE DEL CROMOSOMA X Compensazione del dosaggio Nelle specie in cui la femmina ha due X e il maschio un solo X, esistono dei meccanismi di compensazione del dosaggio che rendono equivalente l

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi!

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Esercizio 1 Di seguito puoi osservare il cariotipo (patrimonio cromosomico)

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Cromosomi MITOSI MEIOSI

Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad

Dettagli

Lezione 6. Ultima per Fisioterapia Logopedia Ortottica TRP 1. MITOSI 2.MEIOSI

Lezione 6. Ultima per Fisioterapia Logopedia Ortottica TRP 1. MITOSI 2.MEIOSI 1. MITOSI Lezione 6 Ultima per Fisioterapia Logopedia Ortottica TRP 2.MEIOSI 1. MITOSI 2.MEIOSI Il ciclo cellulare Il ciclo cellulare ha come compito fondamentale la duplicazione accurata del DNA cellulare

Dettagli

LOCALIZZAZIONE CELLULARE DEGLI ACIDI NUCLEICI

LOCALIZZAZIONE CELLULARE DEGLI ACIDI NUCLEICI GLI ACIDI NUCLEICI PROF.SSA AUSILIA ELCE Indice 1 INTRODUZIONE -------------------------------------------------------------------------------------------------------------- 3 2 LOCALIZZAZIONE CELLULARE

Dettagli

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 5. NUCLEOSOMI contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

Dimensioni di Genomi

Dimensioni di Genomi Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa

Dettagli

MITOSI E MEIOSI. Esercizio n.1

MITOSI E MEIOSI. Esercizio n.1 MITOSI E MEIOSI Esercizio n.1 Disegna in modo schematico i cromosomi nei diversi stadi di mitosi di una cellula diploide con un numero di cromosomi n = 1. Indica il cromosoma o il cromatidio con una linea,

Dettagli

Genetica e Biometria

Genetica e Biometria Genetica e Biometria Info utili 1. Corso a frequenza OBBLIGATORIA 2. Tutte le lezioni saranno disponibili sul sito biotech in format pdf dopo essere state tenute dal docente! 3. Sono previste 2 VERIFICHE:

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

GENETICA la scienza dell ereditarietà e della variabilità. 2 incontro Regiroli Giovanni, biologo

GENETICA la scienza dell ereditarietà e della variabilità. 2 incontro Regiroli Giovanni, biologo GENETICA la scienza dell ereditarietà e della variabilità 2 incontro Regiroli Giovanni, biologo Il dogma centrale della biologia molecolare il DNA (acido deossiribonucleico) contiene l informazione genetica

Dettagli

I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA

I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA 2014-2015 1. Il primo livello di compattazione della molecola di DNA eucariotico consiste nell avvolgimento del DNA attorno agli istoni per formare

Dettagli

Programma Didattico Annuale

Programma Didattico Annuale LICEO STATALE SCIENTIFICO - LINGUISTICO - CLASSICO GALILEO GALILEI - LEGNANO PdQ - 7.06 Ediz.: 1 Rev.: 0 Data 02/09/05 Alleg.: D01 PROG. M2 PROCEDURA della QUALITA' Programma Didattico Annuale Anno Scolastico

Dettagli

GENETICA prima parte

GENETICA prima parte GENETICA prima parte Le caratteristiche di ogni persona formano il patrimonio ereditario e sono trasmesse dai genitori ai figli. Gregor Mendel per primo spiegò come si trasmettono questi caratteri. Vissuto

Dettagli

Malattie genetiche e progetto genoma: a che punto siamo arrivati?

Malattie genetiche e progetto genoma: a che punto siamo arrivati? Malattie genetiche e progetto genoma: a che punto siamo arrivati? dott. Elena Belloni Gruppo di ricerca IEO: Meccanismi molecolari del cancro e dell invecchiamento (responsabile prof. Pier Giuseppe Pelicci)

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Il concetto di riproduzione e la divisione cellulare 8.1 Il simile genera (quasi) sempre il simile Negli organismi in cui avviene la

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton)

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton) Mutazioni nelle cellule somatiche e genetica del cancro (Teoria Boveri - Sutton) Walter Stanborough Sutton Theodor Boveri Walter S. Sutton: Teoria dell ereditarietà dei cromosomi 1914: Teoria cromosomica

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti

Dettagli

Nucleo. Contiene il materiale genetico DNA associato a proteine

Nucleo. Contiene il materiale genetico DNA associato a proteine Nucleo Contiene il materiale genetico DNA associato a proteine I cromosomi Sono depositari del materiale genetico. Sono composti da una lunga molecola di DNA, che costituisce il materiale genetico,e da

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del

Dettagli