Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?"

Transcript

1 Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1

2 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di Jacob e Monod sulla regolazione trascrizionale degli operoni catabolici dei procarioti avevano messo in evidenza che sebbene nella maggior parte dei casi da loro studiati i regolatori trascrizionali trans-agenti fossero delle proteine non si poteva, aprioristicamente, escludere l esistenza di RNA che agissero come regolatori trans-agenti 18 2

3 Nel corso degli anni l esistenza di questi RNA regolatori è stata confermata (ad es.: la regolazione della replicazione del plasmide Tn10; la riduzione dell espressione dei geni coinvolti nel metabolismo generale di E.coli (sigma70 dipendenti) in fase stazionaria (l RNA6S si lega a sigma70 riducendo la trascrizione specifica e permettendo lo switch con sigmas) Negli ultimi anni sono stati evidenziati nei batteri srna (small-rna costituiti da nt) che non derivano da maturazione di precursori a doppia elica (come negli eucarioti) ma da trascrizione specifica a singola elica (complementare al RNA senso) Il meccanismo di azione con cui sono coinvolti gli srna può essere sia di tipo positivo (attivazione) che negativo (repressione) come rappresentato in figura e può determinare degradazione dell RNA bersaglio o mancata traduzione dell RNA bersaglio (se l appaiamento riguarda RBS). Spesso il legame dell srna all RNA bersaglio è aiutato dalla proteina Hfq che funge da chaperone aumentando la stabilità dell appaiamento (nella maggior parte dei casi imperfetto e quindi instabile) 18 3

4 I batteri presentano un ulteriore meccanismo di regolazione dipendente da RNA (questa volta cis-agente cioè elementi regolatori ad RNA presenti all interno della stessa molecola che da essi viene regolata), come ad es. i riboswitch che regolano gli operoni metabolici e l attenuazione che regola gli operoni biosintetici. Una classica struttura di riboswitch è costituita da un aptamero (una struttura secondaria che può assumere configurazioni alternative) e da una piattaforma di espressione. L aptamero è il target di un ligando, che ne determina il cambiamento di struttura secondaria rendendo possibile l interazione con la piattaforma di espressione adiacente 18 4

5 In risposta a questi cambiamenti strutturali viene alterata l espressione genica O bloccando la trascrizione (formazione di un terminatore) O Inibendo la traduzione (mascherando RBS) 18 5

6 Il riboswitch più noto è quello che risponde alla SAM (S Adenosil Metionina) di cui sono riportate le strutture alternative (legato e non legato alla SAM) che utilizza come meccanismo quello della terminazione della trascrizione. 18 6

7 Ma non l unico 18 7

8 Anche negli eucarioti esistono piccoli RNA (21 23 nt) con funzione di regolazione: sirna (piccoli RNA interferenti scoperti inizialmente in Caenorhabditis elegans che reprimono silenziano l espressione di quei geni che presentano regioni di omologia con gli sirna) mirna (micro RNA processati che sono prodotti dalle stesse cellule al cui interno svolgono funzioni regolatrici) In ogni caso sia i sirna che i mirna derivano da un processo di taglio e maturazione (RNAsi III dipendente = Dicer) di molecole di RNA più lunghe che presentano strutture secondarie che contengono quella che verrà liberata come sequenza matura di sirna o mirna. Le modalità di azione di sirna/mirna sono: la degradazione dell mrna del gene bersaglio I inibizione della traduzione Il silenziamento (modifiche strutturali della cromatina) del gene bersaglio 18 8

9 COME VIENE PRODOTTO E MATURATO UN si- o mi-rna? Una volta ottenuto -per taglio di Dicerl RNA a doppia elica la maturazione di sirna/mirna comporta il coinvolgimento del macchinario di maturazione RISC (RNA-induced silencing complex). che recluta sirna o mirna (a doppia elica) prodotti dal taglio dell endonucleasi e contiene la proteina Argonauta. Una volta formato il complesso RISC il primo evento di maturazione è la denaturazione della doppia elica (si ottengono così un RNAss guida ed un RNAss passeggero che generalmente viene eliminato) Il complesso RISC maturo(*) viene diretto sull mrna target (tramite l RNA guida ad esso complementare) che o viene degradato (da Argonauta/Slicer soltanto se l appaiamento guida/target presenta diverse basi non appaiate), o non può essere tradotto 18 9

10 Oltre all inibizione della traduzione o alla degradazione un complesso RISC maturo può anche essere indirizzato al nucleo, al cui interno reclutando modificatori della cromatina è in condizioni di determinare il silenziamento del gene target (identificato sempre dall RNA guida) mediante modifiche degli istoni presenti sul promotore del gene target Una caratteristica del silenziamento sirna dipendente è la sua alta efficienza (cioè bastano piccolissime quantità di sirna per determinare un massiccio silenziamento. Questo dipende dal fatto che un complesso RISC maturo è capace di reclutare una RdRP ( RNApol-RNA dipendente) il che comporta la possibilità di amplificare, con un meccanismo a feedback, il segnale di silenziamento innescato dal sirna iniziale 18 10

11 I mirna e i sirna sono: sintetizzati come porzioni di trascritti più grandi che assumono una struttura secondaria formata da steli ed occhielli. Come già detto il primo mirna (let-7) è stato identificato in Caenorabditis elegans dove è implicato nella regolazione dello sviluppo e nella transizione larva/ adulto. Dalla maturazione di queste strutture secondarie vengono rilasciati i mirna (RNA a ss di circa 20 nt). Prima si ipotizzava il rilascio di un singolo mirna da ognuna di queste strutture secondarie, adesso è noto che ognuna delle due braccia dello stelo da origine a mirna diversi (colori diversi rosso e blue identificano i diversi mirna, chiaramente con targets diversi) 18 11

12 I pre-mirna hanno localizzazione diversa nei diversi trascritti 18 12

13 Da queste strutture secondarie per taglio da parte di endonucleasi si originano i mirna/sirna. Da notare che le endonucleasi riconoscono l organizzazione strutturale secondaria del trascritto e non le specifiche sequenze, e che tagliano vicino ad un ansa 18 13

14 in particolare per quanto riguarda la produzione dei mirna essa comporta un taglio iniziale nel nucleo da parte dell endonucleasi Drosha che ( agendo con altre proteine tra cui Pasha) rilascia un pri-mirna con struttura a gambo ed occhiello di circa 60 nt. sul pri-mi-rna agisce l endonucleasi Dicer (a localizzazione citoplasmatica), che come Drosha riconosce la struttura del primirna e non la sua sequenza. L organizzazzione struttura di Dicer (un accetta il cui manico presenta il dominio di legame PAZ) da conto del riconoscimento e taglio: PAZ serve a riconoscere ed ancorare l estremità 3 del pri-mirna che si alloggia seguendo il folding di Dicer e posizionando i residui che dovranno essere tagliati (i pallini neri presenti sulla struttura dell RNA) a livello dei siti attivi dell enzima (presenti a livello della lama) 18 14

15 Una volta generata la forma attiva dell RNA guida (a ss) essa viene incorporata nel complesso RISC. In RISC è presente Argonauta un complesso con attività RNAsica e che possiede anch esso un dominio PAZ. Una volta che l RNA guida si è appaiato con l RNA target Argonauta (tramite il dominio PAZ e con lo stesso meccanismo già descritto) causa la degradazione dellrna target. In alternativa RISC maturo (RNA guida/rna target reclutati) può essere sequestrato nei P-bodies citoplasmatici dove viene inibita la traduzione dell RNA target O ancora RISC maturo causa destabilizzazione della coda di polya con conseguente mancata traduzione 18 15

16 ESISTE UN ULTERIORE POSSIBILITA RISC maturo nel nucleo può portare a silenziamento del gene target. In particolare è stato dimostrato che i nucleosomi presenti sul promotore dei geni target cui è legato RISC presenta bassi livelli di acetilazione ed alti livelli di metilazione della K9 di H3, una modifica sicuramente ed inequivocabilmente connessa con il silenziamento 18 16

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna.

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. ( RNAi ) RNA Interference Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. E un meccanismo naturale in piante, funghi, insetti e mammiferi. Cronologia:

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

I mirna NEI MECCANISMI ANTIVIRALI

I mirna NEI MECCANISMI ANTIVIRALI Davide Schiavone Biochimica A.A. 2004-2005 I mirna NEI MECCANISMI ANTIVIRALI I processi di difesa antivirale operati da RNA sfruttano diversi meccanismi che sono raggruppati sotto il nome di RNA silencing.

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

RNA interference e sue applicazioni

RNA interference e sue applicazioni RNA interference e sue applicazioni Cosa è l RNA interference Come funziona Funzione biologica nei diversi organismi Come può essere utilizzata per fini applicativi e di genetica funzionale Che cosa è

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

18. L RNA regolatore. Espressione geni è controllata da regolatori che interagiscono con una struttura specifica dell mrna

18. L RNA regolatore. Espressione geni è controllata da regolatori che interagiscono con una struttura specifica dell mrna 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Espressione geni è controllata da regolatori che interagiscono

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

Le proteine sono biologicamente attive solo se ripiegate nella conformazione corretta (Folding)

Le proteine sono biologicamente attive solo se ripiegate nella conformazione corretta (Folding) Livelli di organizzazione delle proteine Le proteine sono biologicamente attive solo se ripiegate nella conformazione corretta (Folding) es. Folding ossidativo Il corretto ripiegamento è aiutato da specifiche

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI

IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI IL RUOLO DELLE MOLECOLE DI RNA ANTISENSO NELLA REGOLAZIONE DELL ESPRESSIONE GENICA IN EUCARIOTI Slide 9 I RIBOZIMI: La scoperta di RNA dotati di attività catalitica ha profondamente cambiato la visione

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

microrna Struttura e Funzione

microrna Struttura e Funzione microrna Struttura e Funzione Cinzia Di Pietro Università degli Studi di Catania Dipartimento di Scienze Biomediche e Biotecnologiche Sezione di Biologia e Genetica G. Sichel I MicroRNAs (mirnas) sono

Dettagli

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui

la struttura tridimensionale può essere ottenuta solo per Un intero dominio in genere da 50 a 300 residui Durante la traduzione l informazione di ripiegamento codificata nella sequenza aminoacidica diventa disponibile in maniera vettoriale la struttura tridimensionale può essere ottenuta solo per Un intero

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

RNA interference. Un interruttore molecolare capace di spegnere i geni come una lampadina

RNA interference. Un interruttore molecolare capace di spegnere i geni come una lampadina RNA interference Un interruttore molecolare capace di spegnere i geni come una lampadina RNA Interference: il processo attraverso il quale un RNA a doppio filamento interferisce con l espressione genica:

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti Dall RNA alle proteine La traduzione nei procarioti e negli eucarioti Codice genetico La sequenza dell mrna viene decodificata a gruppi di tre nucleotidi, e tradotta in una sequenza di amminoacidi 4 x

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli