Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1"


1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la realizzazione di un organismo.

2 Fibrillina a Sindrome di Marfan (nome inglese Marfan Sindrome) è un alterazione del tessuto connettivo a trasmissione autosomica dominante: L incidenza della patologia è di un soggetto affetto su nati vivi, e va detto anche che un certo numero di pazienti (il 25% circa) è rappresentato da casi sporadici, ossia da soggetti che non hanno storia familiare e quindi sono portatori di una mutazione fresca. Tra gli apparati colpiti dalla sindrome di Marfan vi è anzitutto quello cardiovascolare, con problemi di aneurisma, di disseccazione dell aorta e di prolasso della valvola mitrale. Risultano poi coinvolti anche gli occhi (ectopia della lente, miopia) e lo scheletro (scoliosi, anomalie della gabbia toracica). La malattia può infine interessare anche il sistema nervoso centrale, i polmoni, la pelle e i legamenti. Nel 1992 è stato identificato uno dei geni principali che causano la sindrome di Marfan: si tratta del gene fibrillina 1 (FBN1), localizzato sul cromosoma 15 in posizione 21.1, il quale codifica per un microfilamento che è un importante costituente del tessuto elastico. Tale gene e la proteina che viene da esso codificata- risultano mutati nel 60% dei pazienti con Sindrome di Marfan. Una mancata diagnosi e prevenzione cardiovascolare può portare alla morte improvvisa:. Fibrillina 1 Glicoproteina del tessuto connettivo, che interagisce con le altre proteine della matrice extracellulare; Importante per la normale costituzione della parete dei vasi e dello scheletro. La fibrillina è alla base del difetto molecolare di altre patologie quali: Fenotipo MASS; Ectopia della lente; Aneurisma aorticotoracico familiare; Dissezione aortica toracica familiare. Il gene per la fibrillina 1 è sul cromosoma 15q21.

3 Motori di ricerca dei genomi Ensembl è una banca dati bioinformatica allestita con lo scopo di fornire informazioni aggiornate sui principali genomi eucariotici. Gene fibrillina

4 Genomica Studio del genoma degli organismi viventi Il genoma di un organismo contiene l informazione biologica necessaria per la vita. Il genoma e rappresentato dai cromosomi e dal DNA mitocondriale (negli eucarioti) di una cellula Ciascun cromosoma contiene le unità funzionali del DNA, denominate geni.

5 La biologia nell era post-genomica Bioinformatica Genomica funzionale Genomica comparata Proteomica Trascrittomica Biologia dei sistemi (metabolomica, trasduttomica, interactoma, ecc ) Farmacogenomica

6 Identificazione delle regioni codificanti meantnfmcosarjthyuyifkfmnsbzvcaxqswthyujuk bnpyoitjguryrtefdgvcbxnservejkamnsbegdfvrtty ghjukiolmmlabnvbcvxcsdfergrtbioinformatica?g jyiuoljpgkbidhgrtfydhsn meantnfmcosarjthyuyifkfmnsbzvcaxqswthyujuk bnpyoitjguryrtefdgvcbxnservejkamnsbegdfvrtty ghjukiolmmlabnvbcvxcsdfergrtbioinformatica? gjyiuoljpgkbidhgrtfydhsn

7 Genomica Ogni persona rappresenta la realizzazione di un progetto genomico specifico, condiviso tra gli altri esseri umani. Pur mantenendo costante il numero e la tipologia di geni, il nostro genoma è costituito da una sequenza di nucleotidi diversa da individuo ad individuo. Ciascun individuo è geneticamente unico.

8 Tipologie di sequenze nel genoma umano

9 Bioinformatica e Genomica APPLICAZIONI DELLA BIOINFORMATICA IN BIOMEDICINA Modelli molecolari funzionali Farnacogenomica Progettazione di nuovi farmaci Reti neurali di apprendimento Genomica funzionale: proteomica Modelli interattivi delle vie metaboliche Maria Grazia Romanelli

10 COMPLESSITA BIOLOGICA Gene ? ( ) METODI DI STUDIO DELLA COMPLESSITA BIOLOGICA Progetti Genoma mrna Splicing alternativo?? precursore proteico ?? Taglio della eventuale sequenza segnale Eventuali modificazioni post-traduzionali proteina matura?? (FUNZIONE) Interazioni proteina-proteina Network complessi N.B. Il delicato equilibrio di un organismo dipende da una moltitudine di funzioni finemente organizzate e regolate da una moltitudine di proteine diverse che interagiscono tra loro in network complessi di interazioni reversibili

11 OMICS Genomica: si occupa dello studio del genoma degli organismi viventi. In particolare si occupa della struttura, contenuto, funzione ed evoluzione del genoma. Genomica Genomica funzionale Genomica comparata Trascrittomica si occupa dell'espressione dei geni negli RNA messaggeri di un intero organismo o di un particolare organo, tessuto o cellula in un particolare momento dello sviluppo dell'organismo o in risposta ad un stimolo OMICS Trascittomic a Profili di espressione degli RNAm (microarray) RNAi/miRNA (interferomica/microrna omica Proteomica si occupa dell'insieme di tutte le proteine di un organismo di un tessuto o di una cellula, con l'obbiettivo di determinarne la sequenza, la funzione, la struttura Proteomica Interattomica Epigenomica metabolomica Le tecnologie applicate alle omiche richiedono l analisi bioinformatica tridimensionale e le interazioni 11

12 Linguaggio biologico Lingua italiana Alfabeto: 21 lettere Genoma 4 lettere

13 Libretto di istruzioni biologiche DNA : 3.3 miliardi di nucleotidi distribuiti in 23 cromosomi Le informazioni sono rappresentate da sequenze nucleotidiche in cui si ripetono in numero e ordine diverso 4 tipi di basi azotate Adenina (A), guanina (G) citosina ( C) timina (T)

14 A caccia del gene

15 Specie Genoma Numero di geni Dimensioni del genoma (milioni di basi) Homo sapiens Saccharomyces cerevisiae Drosophila melanogaster N geni teorico in proporzione al genoma umano Paradosso del valore C: non equivalenza tra le dimensioni del genoma e il numero di geni nel confronto tra gli eucarioti.

16 DNA codificante e non % 4.7 Mb 12.1 Mb 100 Mb 3000 Mb

17 Genoma Umano 3000 Mb Geni e sequenze associate 900 Mb DNA extragenico 2100 Mb Non codificante 810 Mb Codificante 90 Mb DNA unico e a basso numero di copie 1680 Mb DNA ripetitivo 420 Mb Introni Pseudogeni Ripetuto in tandem Disperso Regioni di controllo Minisatelliti Satellite Microsatelliti SINE LINE Retroposoni Il DNA spazzatura è veramente tale?

18 Il cariogramma umano Centromero = geni ribosomiali Eterocromatina costitutiva


20 Alberts et al. 2005


22 Sequenza nucleotidica del gene della globina beta dell uomo. Le sequenze geniche si possono scrivere e leggere come un testo. ORF: open reading frame, cornice di lettura del gene. Organizzazione in esoni ed introni

23 I geni degli eucarioti sono interrotti Esoni sono le sequenze tradotte, introni sono le sequenze che interrompono in segmenti di numero variabile il gene.

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze



LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:


Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)



ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso


GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una


Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,


Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia



GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza


Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale





Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione





II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2


Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva


20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra





You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT





Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli ( Vincenza Colonna Inga Prokopenko Morena


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto


Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici


Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento


Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.


-malattie monogeniche o mendeliane:

-malattie monogeniche o mendeliane: Martedì 16 Febbraio è venuta nella nostra classe la dr.ssa Petrelli Maria a spiegarci le malattie sessualmente trasmissibili e ereditarie, sessualità e affettività. Ci ha spiegato la divisione delle cellule


Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune


I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni


Espressione di geni specifici per un determinato tumore

Espressione di geni specifici per un determinato tumore Espressione di geni specifici per un determinato tumore Paziente A: Non ha il cancro Espressione dei geni: Nessuna Biopsia Geni associati al cancro allo stomaco Paziente B: Ha un tumore allo stomaco Bassa


L essenziale di biologia molecolare della cellula

L essenziale di biologia molecolare della cellula Bruce ALBERTS et al. L essenziale di biologia molecolare della cellula Seconda edizione Capitolo 7: Dal DNA alle proteine: come la cellula legge il genoma Alberts et al., L ESSENZIALE DI BIOLOGIA MOLECOLARE


Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per


Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere


Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2 fenotipo Dominante o recessivo? Scala fenotipica fenotipo A 1 A 1 A 2 A 2 fenotipo A 1 A 2 A 1 dominante A 1 e A 2. codominanti A 2 dominante A 1 dominanza incompleta A 2 dominanza incompleta Nei casi


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi


PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita


= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il


Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti



GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel



RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 RIATTIVAZIONE EPIGENETICA DEL GENE FMR1 Pietro Chiurazzi Istituto di Genetica Medica Università Cattolica del Sacro Cuore Sindrome X Fragile (OMIM #300624) La FXS è la causa più comune di ritardo psicomotorio


Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni Anomalie Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni 17 Transcrittasi inversa 18 Codice genetico mitocondriale 19 Codone


Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un


A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina


La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute


Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie


Un nuovo tassello per scoprire il lato oscuro del Genoma

Un nuovo tassello per scoprire il lato oscuro del Genoma Roma, 23 febbraio 2015 COMUNICATO STAMPA Un nuovo tassello per scoprire il lato oscuro del Genoma Un team del dipartimento di Biologia e Biotecnologie "Charles Darwin" della Sapienza, coordinato da Patrizio


Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza


Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC Genetica umana Ramón Lucas Lucas, LC P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:


Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica



LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.





<1%familiare, 99% sporadica Incidenza: 1% tra 65-70anni; 8% > 80anni Durata: variabile (2-20anni) media 4anni

<1%familiare, 99% sporadica Incidenza: 1% tra 65-70anni; 8% > 80anni Durata: variabile (2-20anni) media 4anni Malattia di Alzheimer 80anni Durata: variabile (2-20anni) media 4anni 3-4 milioni di individui affetti da AD in USA Sintomi: Cognitivi: Perdita





Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina





Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule.

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule. Il patrimonio genetico, base della vita Il patrimonio genetico (genoma) è l insieme di tutte le informazioni necessarie per costruire ogni embrione, attraverso complessi meccanismi di moltiplicazione delle


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo






LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 I Ricercatori del Centro di Genomica e Bioinformatica Traslazionale stanno lavorando a linee di ricerca legate a 1. Sclerosi Multipla 2. Tumore della Prostata


Risultati ottenuti e novità nella diagnostica delle sindromi di Ehlers-Danlos in Italia Marina Colombi Sezione di Biologia e Genetica, Laboratorio di

Risultati ottenuti e novità nella diagnostica delle sindromi di Ehlers-Danlos in Italia Marina Colombi Sezione di Biologia e Genetica, Laboratorio di Risultati ottenuti e novità nella diagnostica delle sindromi di Ehlers-Danlos in Italia Marina Colombi Sezione di Biologia e Genetica, Laboratorio di Citogenetica e Genetica Molecolare, Dipartimento di



TEORIA CROMOSOMICA : ALLEGATI TEORIA CROMOSOMICA : ALLEGATI FIG. 2 a pag. 1 FIG. 5 a pag. 3 FIG. 7 a pag. 5 FIG. 9 a pag. 7 FIG. 3 e 4 a pag. 2 FIG. 6 a pag. 4 FIG. 8 a pag. 6 FIG. 10 e 11 a pag. 8 1 FIGURA 2 Perché sono tutti maschi


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche

Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche Il giorno 24.10.2011 alle ore 11,00, presso la sede dell Università degli Studi Parthenope di Napoli, in Via Acton 38, si riunisce


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza


De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente


L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione


Tecniche Periodo Esempi di diagnosi (in settimane) Invasive Amniocentesi 16 anomale cromosomiche,

Tecniche Periodo Esempi di diagnosi (in settimane) Invasive Amniocentesi 16 anomale cromosomiche, Tecniche Periodo Esempi di diagnosi (in settimane) Invasive Amniocentesi 16 anomale cromosomiche, parte cospuscolata malattie metab., difetti mol. parte non corpuscolata difetti del tubo neurale Villocentesi


GENETICA PRETEST 2014. Studenti Per

GENETICA PRETEST 2014. Studenti Per GENETICA PRETEST 2014 Studenti Per LA GENETICA è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui


La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione


Piattaforma per studi su larga scala di eventi molecolari associati a patologie umane: applicazioni per la scoperta di nuovi farmaci

Piattaforma per studi su larga scala di eventi molecolari associati a patologie umane: applicazioni per la scoperta di nuovi farmaci Piattaforma per studi su larga scala di eventi molecolari associati a patologie umane: applicazioni per la scoperta di nuovi farmaci Roberto Ravazzolo Direttore Nicoletta Pedemonte Dirigente Biologo U.O.C.
