Legami idrogeno tra le coppie di basi

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Legami idrogeno tra le coppie di basi"

Transcript

1 Legami idrogeno tra le coppie di basi Interazioni elettrostatiche deboli che si stabiliscono tra un atomo elettronegativo (es.ossigeno o azoto) e un atomo di idrogeno legato ad un secondo atomo elettronegativo.

2 Spettri di assorbimento della luce da parte dei più comuni nucleotidi I nucleotidi e gli acidi nucleici assorbono la luce UV intorno a 260 nm

3 Se potessimo entrare dentro il nucleo di una cellula e misurare la lunghezza del filamento di DNA otterremmo: Un filamento lungo 2 metri, nel caso di un DNA umano Un filamento lungo 1.7 millimetri, nel caso di un batterio Se potessimo unire tutti i filamenti di DNA presenti in tutte le cellule umane La lunghezza totale di tutto il DNA sarebbe circa Km Circonferenza della terra Km Distanza terra - sole Km

4 Duplicazione del DNA

5 Allungamento di una catena di DNA

6 Catena leader sintetizzata in modo continuo Catena ritardata sintetizzata in modo discontinuo

7 La duplicazione del DNA necessita di numerosi enzimi e fattori proteici:

8

9

10

11 Riassumendo: Dna A HU Un complesso di circa 20 proteine si lega all ORI C in corrispondenza della serie ripetuta di 9 pb In presenza della tensione torsionale denatura la regione contenente le 3 sequenze ripetute di 13bp: deboli legami H tengono uniti i due filamenti in questa porzione di DNA

12

13 PRIMOSOMA: DNA elicasi DNA primasi

14 Meccanismo d azione della DNA elicasi

15 DNA primasi:

16 Riassumendo:

17 La subunità ß della DNA polimerasi III

18 Frammenti di Okazaki

19

20

21

22

23

24

25

26

27 PROCARIOTI (1 origine) EUCARIOTI (origini multiple) ELEMENTI ARS Velocità di spostamento della forcella di duplicazione 200 origini in Saccharomicies cerevisiae origini nell uomo Autonomously Replicating Sequences ( 50 nt/sec) A questa velocità, se ci fosse una sola origine della duplicazione, un cromosoma umano verrebbe duplicato in più di 500 ore!!

28

29 DNA polimerasi I Attività esonucleasica 5 3

30

31 DNA polimerasi I Sito attivo della DNA polimerasi Sito attivo dell esonucleasi 3 5

32 Enzimi della duplicazione: DNA Polimerasi Polimerasi I: Attività polimerizzante: 5 3 Polimerasi III: Polimerasi I: Attività esonucleasica: Polimerasi III:

33 LE CELLULE EUCARIOTE POSSIEDONO DIVERSI TIPI DI DNA POLIMERASI DNA POLIMERASI EUCARIOTICHE α β γ δ DNA Polimerasi δ DNA Polimerasi α 2 subunità 4 subunità attività primasica ε attività polimerasica Eso 3' 5 attività polimerasica DNA Polimerasi ε Rimuove i primers a RNA DNA Polimerasi γ Presente nei mitocondri DNA Polimerasi β Funzione poco nota; forse partecipa ai processi di riparazione del DNA

34 α (inizia la sintesi 20 nucleotidi) δ(continua la sintesi)

35 TERMINAZIONE DELLA REPLICAZIONE TUS Durante il processo della terminazione una proteina TUS si lega ad uno dei siti Ter La TUS è una controelicasi, cioè impedisce alla doppia elica di DNA di denaturarsi bloccando la progressione della forcella di replicazione

36 α elica Foglietto ß Foglietto ß ß strand controelicasi

37 Eucarioti Telomeri Numero variabile di cromosomi, a seconda dell organismo Sequenze poste all estremità dei cromosomi eucariotici con funzione di stabilizzazione del cromosoma.

38 Arresto permanente del ciclo cellulare MORTE CELLULARE bambino giovane vecchio

39 DUPLICAZIONE NEGLI EUCARIOTI: IL PROBLEMA DELLE ESTREMITA Telomero Centromero Telomero Duplicazione del DNA χ χ Sostituzione dei primer a RNA con DNA χ χ χ la DNA Pol., rimuove il primer dalle estremità, ma non li può sostituire con DNA infatti, la DNA polimerasi per duplicare le estremità avrebbe bisogno di un primer protrudente dal filamento parentale, evento assolutamente irrealizzabile!

40 Al termine della replicazione l estremità 5 dei filamenti neosintetizzati, presenterà una lacuna dovuta alla rimozione dei primers ed il mancato inserimento di nuovi nucleotidi

41 NELLE CELLULE DI TUTTI GLI EUCARIOTI SONO PRESENTI GLI ENZIMI TELOMERASI: Ricostruiscono le porzioni telomeriche man mano che si accorciano Sono sempre attive nelle cellule della linea germinale Sono attive nelle cellule somatiche solo nelle persone giovanissime Sono attive nelle cellule tumorali Telomeri lunghi; Elevata attività telomerasica; Immortalizzazione.

42 Telomeri e telomerasi I telomeri sono porzioni di DNA poste all estremità dei cromosomi. Essi sono costituiti di circa nucleotidi che contengono sequenze ripetute in tandem Le telomerasi sono ribonucleoproteine che fungono da trascrittasi inversa

43

44 FRAMMENTO TELOMERICO NEOSINTETIZZATO

45

46

47

48

49 Telomerasi: ribonucleoproteina Porzione ad RNA Porzione proteica

50 Filamento parentale Filamento neosintetizzato

51

52

53 RIASSUMENDO:

54 Nel DNA si trovano sequenze molto ripetitive o DNA a sequenza semplice chiamato anche DNA satellite, presente nel centromero e nei telomeri Sequenze uniche o ripetute poche volte presenti nei geni del DNA degli eucarioti Sequenze moderatamente ripetitive (forse DNA di scarto) INTRONI o sequenze intercalate PLASMIDI: DNA circolari extracromosomici liberi nel citoplasma

55 Eucarioti Sequenze codificanti (GENI) mrna rrna Traduzione trna snrna funzioni indirettamente collegate alla biosintesi proteica

56 Eucarioti Interposte alle sequenze codificanti, si trovano sequenze di DNA che mancano di funzioni codificanti DNA INTERGENICO (30% circa) ha una composizioni in basi atipica, con sequenze che si ripetono, ripetono che permette la loro distinzione dal resto del DNA

57 5 ACGTACCGGTAGCACTAAGCTTACGTGACATACGCA 3 frammento di DNA con sequenza random 5 ACAAACT ACAAACT ACAAACT ACAAACT ACAAACT 3 frammento di DNA con sequenze ripetute

58 Il DNA ripetitivo può essere suddiviso in due tipologie Ripetizioni intersperse Ripetizioni distribuite in maniera casuale DNA ripetuto in tandem Le unità ripetute sono una accanto all altra

59 DNA ripetuto in tandem Le unità ripetute sono una accanto all altra I frammenti di DNA con ripetizioni in tandem DNA satellite formano bande satelliti quando il DNA genomico viene frazionato mediante centrifugazione in gradiente di densità minisatellite Unità ripetuta lunga fino a 25 bp (si ripetono fino a 1000 volte) microsatellite Qual è la funzione? Unità ripetuta lunga da 2 a 5 bp (si ripetono fino a 100 volte)

60 DNA satellite Utile strumento di indagine per i biologi molecolari (es:in medicina forense) NON ESISTONO DUE PERSONE CON LA STESSA COMBINAZIONE ESATTA DI VARIANTI MICROSATELLITARI DI UGUALE Molti satelliti sono variabili: il numero di unità che si ripetono è differente in diversi membri della stessa specie NUMERO E LUNGHEZZA: ESAMINANDO UN NUMERO SUFFICIENTE DI SATELLITI, SI PUO OTTENERE UN PROFILO GENETICO PER OGNI PERSONA

61 indagato vittima blood blood jeans shirt

62 IL DNA E CONTENUTO NON SOLO NEL NUCLEO, MA ANCHE IN ALCUNI ORGANELLI DELLE CELLULE EUCARIOTE

63 IL DNA EXTRA-NUCLEARE MITOCONDRI contengono una piccola molecola di DNA circolare (cellule animali e vegetali) CLOROPLASTI cellule vegetali

64 Batteri Plasmide Cromosoma

65 Plasmidi SONO MOLTO UTILIZZATI IN INGEGNERIA GENETICA NEGLI ESPERIMENTI DEL DNA RICOMBINANTE

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

DNA e replicazione del DNA

DNA e replicazione del DNA DNA e replicazione del DNA 1928: EXP di Griffith Scoperto il fattore trasformante Struttura elicoidale del DNA Struttura del DNA Subunità nucleotidiche Struttura del DNA Subunità nucleotidiche La replicazione

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

REPLICAZIONE DEI GENOMI A DNA

REPLICAZIONE DEI GENOMI A DNA REPLICAZIONE DEI GENOMI A DNA LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA FIGURA 12.26 GENES VII FIGURA 13.1 GENOMI II FIGURA 13.2 GENOMI II NEL 1958 MESELSON E STAHL DIMOSTRANO CHE

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B2 Il linguaggio della vita 3 Le basi molecolari dell ereditarietà Prima

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi

Dettagli

Telomeri e Telomerasi:

Telomeri e Telomerasi: Telomeri e Telomerasi: 1 I cromosomi eucariotici sono molecole lineari, a doppio filamento, che terminano generalmente con un segmento di 10000 coppie di basi, costituito da piccole sequenze nucleotidiche

Dettagli

Biologia Molecolare. CDLM in CTF La Replicazione del DNA

Biologia Molecolare. CDLM in CTF La Replicazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La Replicazione del DNA Prospettiva Storica La replicazione semidiscontinua Differenze tra procarioti ed eucarioti E fondamentale che ad ogni divisione cellulare

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

Quanto DNA è contenuto in una cellula?...

Quanto DNA è contenuto in una cellula?... Quanto DNA è contenuto in una cellula?... bp = Base Pair (coppie di basi) lungh DNA/lungh struttura ospitante E. coli: 4,6x10 6 bp (1,7 mm) 850 (unica molecola circolare) Cellula umana: 3,2x10 9 bp (~2

Dettagli

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

MODELLO SCHEDA INSEGNAMENTO

MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino

Dettagli

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Ciclo cellulare Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Arthur Kornberg, 1970 Replicazione

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

7. Gruppi genici e sequenza ripetute

7. Gruppi genici e sequenza ripetute 7. Gruppi genici e sequenza ripetute contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale La duplicazione e la delezione di

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio LEZIONE III DUPLICAZIONE DEL DNA Dott. Paolo Cascio DUPLICAZIONE DEL DNA NEI PROCARIOTI LA DUPLICAZIONE DEL CROMOSOMA BATTERICO CIRCOLARE INIZIA IN UN UNICO PUNTO E PROCEDE BIDIREZIONALMENTE FINO A QUANDO

Dettagli

Interfase. La REPLICAZIONE del DNA

Interfase. La REPLICAZIONE del DNA Interfase La REPLICAZIONE del DNA REPLICAZIONE del DNA Doppia elica parentale Il modello di replicazione del DNA ipotizzato da Watson e Crick è basato sulla complementarietà delle basi dei due filamenti

Dettagli

Il modello del Replicone

Il modello del Replicone Il modello del Replicone Il replicone copre l intera regione di DNA replicata a partire da una singola origine di replicazione (es. il genoma di E.coli corrisponde ad un singolo replicone). Il replicone

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Importanza della genetica dei microrganismi

Importanza della genetica dei microrganismi Importanza della genetica dei microrganismi 1.I microrganismi rappresentano un mezzo essenziale per comprendere la genetica di tutti gli organismi. 2.Vengono usati per isolare e duplicare specifici geni

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare.

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Nelle cellule in proliferazione le 4 fasi impiegano dalle 10 20 ore in dipendenza

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

MODALITA DI REPLICAZIONE

MODALITA DI REPLICAZIONE MODALITA DI REPLICAZIONE In teoria è ipotizzabile che il DNA possa duplicarsi con modalità: 1) semi-conservativa se alla generazione successiva passano due doppie eliche entrambi costituite da un'elica

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin Watson e Crick Rosalind Franklin Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. citochinesi: o citodieresi. Divisione del citoplasma

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 21 La replicazione del DNA Concetti chiave: La DNA polimerasi necessita di uno stampo e di inneschi (i primer) per sintetizzare

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Mappa del cromosoma di E. coli in cui sono indicate le posizioni dei geni che codificano proteine importanti per il metabolismo del DNA L esperimento di Meselson e Stahl (1957):

Dettagli

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici T.A. Brown Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici Chapter 2_Genome Anatomies http://www.ncbi.nlm.nih.gov/books/nbk21112/ Copyright Garland Science 2007 Capitolo 8: Genomi

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE BIOLOGIA MOLECOLARE DEGLI EUCARIOTI Roberto Giacominelli Stuffler 1. I geni ed il DNA degli eucarioti 2. La replicazione, la trascrizione e la

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich.

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich. I cromosomi I cromosomi 1400 nm Modello di Saitoh and Laemmli Anse di cromatina piccole o lunghe G loops R loops G loops R loops Protein scaffold SARs AT-rich Scaffold AT-queue Chromatid fibers Anse piccole

Dettagli

Lezione 1: Atomi e molecole:

Lezione 1: Atomi e molecole: Lezione 1: Atomi e molecole: La materia è costituita da elementi chimici in forma pura o in combinazioni dette composti. La vita richiede circa 25 elementi chimici. La struttura atomica determina il comportamento

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

Replicazione e ricombinazione del DNA

Replicazione e ricombinazione del DNA DNA Replication DNA Replication II Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del DNA La replicazione è semiconservativa: ogni frammento

Dettagli

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA 2. Trasmissione dell informazione genetica dal gene alla proteina LA TRASCRIZIONE NEI PROCARIOTI E NEGLI EUCARIOTI PROCARIOTI EUCARIOTI LA TRASCRIZIONE

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2013-2014 corso A- L Docente: Massimo Gulisano m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza dei legami deboli

Dettagli

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina DNA e CROMOSOMI Come il DNA si replica, si ripara e ricombina Nel 1928 venne dimostrato che il DNA è il materiale genetico dei batteri (Griffith) Alcune proprietà dei batteri S morti possono trasformare

Dettagli

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2014-2015 corso A- L Docente: Massimo Gulisano Cell 3483391646 Email m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- odice genetico- Traduzione dl Infermieristica aa. 2011/12 Prof.ssa Frabetti ESPRESSIONE

Dettagli

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010 Le biotecnologie 1 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi viventi o da loro derivati.

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

SINTESI DELLE PROTEINE

SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati

Dettagli

Biologia Molecolare. CDLM in CTF La Genomica ed il Dogma Centrale della Biologia

Biologia Molecolare. CDLM in CTF La Genomica ed il Dogma Centrale della Biologia Biologia Molecolare CDLM in CTF 2010-2011 La Genomica ed il Dogma Centrale della Biologia Il Genoma I Geni Il Dogma centrale della Biologia Il genoma è l'insieme di tutte le informazioni biologiche necessarie

Dettagli

IL CODICE GENETICO E I CARATTERI EREDITARI

IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

A_Test di valutazione di Biologia Generale:

A_Test di valutazione di Biologia Generale: COGNOME NOME... C.I./Patente n... MATRICOLA NO SI, n:... Prova di accertamento per la determinazione di eventuali debiti formativi Iscritti 2011-2012 A_Test di valutazione di Biologia Generale: Il ciclo

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli