Dimensioni di Genomi

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Dimensioni di Genomi"

Transcript

1 Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa ,000. reptiles birds mammals

2 IMPACCHETTAMENTO DEL DNA UMANO La lunghezza complessiva del genoma umano e di circa 1,8 metri (molecole di DNA dei 46 cromosomi di una cellula poste in fila). Il genoma e compresso in un nucleo < 10μm

3 Cromosoma di E.coli (1,7mm) e cellula di E.coli (2μm) Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

4 SUPERAVVOLGIMENTO DEL DNA Il DNA cellulare deve essere strettamente compattato per poter essere contenuto all interno della cellula, il che implica un elevato grado di organizzazione strutturale. Il meccanismo di ripiegamento deve anche permettere l accesso all informazione contenuta nel DNA, accesso alle basi (replicazione, trascrizione).

5 SUPERAVVOLGIMENTO avvolgimento di una struttura già avvolta Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

6 Superavvolgimento del DNA Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

7 DNA plasmidici rilassati e superavvolti Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

8 Il superavvolgimento non è casuale ma avviene se il DNA è sottoposto ad una forma di tensione Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed. Superavvolgimento indotto dalla separazione delle catene di una struttura a doppia elica

9 Effetti del parziale disavvolgimento del DNA 84 bp/8 giri 10,5 pb/giro Il DNA presenta un numero di giri di elica minore di quanto ci si attenderebbe per la struttura B. 84 pb/7= 12 pb/giro La tensione viene riequilibrata mediante c o d Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

10 Parziale disavvolgimento del DNA Lo stato parzialmente disavvolto puo essere mantenuto se il DNA e in forma circolare chiusa o se e stabilizzato da interazioni con proteine, in modo che le catene non siano in grado di ruotare su se stesse. DNA superavvolto negativamente Il superavvolgimento negativo può convertirsi nella separazione locale dei due filamenti

11 Numero di legame n di volte in cui un filamento si avvolge attorno all altro in un DNA chiuso circolare Il numero di legame non varia quando il DNA è deformato/piegato fino a che entrambi i filamenti rimangono covalentemente intatti. Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

12 Numero di legame Esempio: DNA circolare chiuso di 2100 coppie di basi 2100/10,5= 200 LK=Lko Lko=numero di legame allo stato rilassato Disavvolgimento del DNA Lk=Lk-Lko= =-2 2/200=1% dei giri di elica è stato rimosso Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed. nei DNA cellulari il 5%-7% dei giri e rimosso

13 Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed. Superavvolgimento negativo Deriva da un parziale disavvolgimento Superavvolgimento positivo Deriva da un iperavvolgimento

14 Il parziale disavvolgimento induce la formazione di strutture cruciformi Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

15 Il parziale disavvolgimento del DNA facilita modificazioni strutturali della molecola del DNA separazione dei filamenti (denaturazione di regioni ricche in A+T) struttura Z (in corrispondenza di regioni di alternanza Pu/Py) strutture cruciformi (in corrispondenza di palindromi)

16 Superavvolgimento del DNA Positivo = DNA superspiralizzato Negativo = DNA sottospiralizzato

17 Le topoisomerasi Aumentano o diminuiscono l avvolgimento del DNA. Catalizzano variazioni del numero di legame. Tagliano una o entrambe le catene Passaggio di un segmento di DNA attraverso l apertura Chiusura dell interruzione Topoisomerasi I: scinde un singolo filamento Topoisomerasi II: scinde entrambi i filamenti

18 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

19 Reazione della topoisomerasi di tipo I Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

20 Attività della Topoisomerasi I Rimozione di superavvolgimenti negativi. Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

21 Topoisomerasi II: introduce superavvolgimenti negativi scinde entrambi i filamenti utilizza ATP Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

22 Le topoisomerasi sono il bersaglio molecolare nel trattamento di malattie Agenti antimicrobici Agenti antitumorali Girasi (topoisomerasi II, batterica) Novobiocina: blocca il legame dell ATP alla girasi Acido nalidixico e ciprofloxacina: interferiscono con la rottura e ricongiungimento delle catene. Impiego: infezioni urinarie ed altre (antrace) Inibitori della topoisomerasi I e II umane Agenti antitumorali

23 Superavvolgimento plectonemico forma che si osserva nei DNA isolati in laboratorio Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 6 ed.

24 SUPERAVVOLGIMENTO A SOLENOIDE e SUPERAVVOLGIMENTO PLECTONEMICO La forma a solenoide, stretti avvolgimenti sinistrorsi, è la forma presente nella cromatina: DNA legato a proteine CROMOSOMI EUCARIOTICI Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 5 ed.

25 CROMATINA La cromatina e costituita da DNA e proteine e una piccola parte di RNA -Istoni -Topoisomerasi - Proteine SMC (structural mantainance of chromosome) coesine condensine altre

26 Interazione DNA e istoni

27

28

29 Nucleosoma

30

31 I NUCLEOSOMI SONO COMPATTATI IN STRUTTURE DI ORDINE VIA VIA SUPERIORE Fibra di 30nm

32 Zanichelli 6 enelson & Cox I principi di Biochimica di Lehninger- Zanichelli 5 edd.

33

34

35 Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 5 ed. Anse di DNA cromosomico attaccate all impalcatura nucleare spesso all interno di anse vi sono gruppi di geni con funzioni correlate

36

37 Modello di compattamento del DNA in un cromosoma eucariotico Nelson & Cox I principi di Biochimica di Lehninger- Zanichelli 5 ed.

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Lunghezza del cromosoma di E.coli (1,7 mm) paragonata alla lunghezza di una tipica cellula di E. coli (2μm) DNA di una cellula

Dettagli

Il superavvolgimento del DNA

Il superavvolgimento del DNA Il superavvolgimento del DNA Superavvolgimento del DNA genomico nei procarioti ed eucarioti Plasmide: DNA extracromosomico batterico (circolare) Figura 2.32 DNA circolare rilassato e superavvolto. Il superavvolgimento:

Dettagli

Alcune sequenze di DNA insolite. Palindromo. Sequenze con una simmetria doppia

Alcune sequenze di DNA insolite. Palindromo. Sequenze con una simmetria doppia Alcune sequenze di DNA insolite Palindromo Sequenze con una simmetria doppia Possono formare: Struttura a croce dette anche anse cruciformi DNA rilassato DNA parzialmente disavvolto DNA cruciforme Struttura

Dettagli

2. I nucleosomi 11/02/16

2. I nucleosomi 11/02/16 2. I nucleosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale u Ordinato e dinamico u Formazione della struttura terziaria

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 20 Geni e cromosomi Concetti chiave: Il DNA superavvolto può essere descritto in termini di numero di legami, avvolgimenti

Dettagli

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc.

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc. estremità 5' 5 3 - P N 5 2 C 3 ponte fosfodiestere P A 1 2 C 5 P 3 G N 1 2 C 5 3 P T N 1 5 2 C 3 etc. DNA C N 1 estremità 3' zucchero N 1 C 3 4 3 timina N adenina N N 1 6 N N 9 N zucchero N zucchero citosina

Dettagli

Il superavvolgimento è negativo quando consiste in una rotazione in senso opposto

Il superavvolgimento è negativo quando consiste in una rotazione in senso opposto Topoisomerasi Il DNA di batteri, mitocondri, plastidi e alcuni virus è costituito da una doppia elica circolare. Consideriamo una molecola di DNA circolare a doppia elica rilassata e chiusa, formata da

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 5. NUCLEOSOMI contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del

Dettagli

Quanto DNA è contenuto in una cellula?...

Quanto DNA è contenuto in una cellula?... Quanto DNA è contenuto in una cellula?... bp = Base Pair (coppie di basi) lungh DNA/lungh struttura ospitante E. coli: 4,6x10 6 bp (1,7 mm) 850 (unica molecola circolare) Cellula umana: 3,2x10 9 bp (~2

Dettagli

Dimensioni dei Genomi Eucariotici

Dimensioni dei Genomi Eucariotici Dimensioni dei Genomi Eucariotici plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Stesso DNA ma cellule diverse

Stesso DNA ma cellule diverse Stesso DNA ma cellule diverse Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico I cromosomi sono in coppia Ogni cromosoma

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

LA GENETICA MOLECOLARE

LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

MODALITA DI REPLICAZIONE

MODALITA DI REPLICAZIONE MODALITA DI REPLICAZIONE In teoria è ipotizzabile che il DNA possa duplicarsi con modalità: 1) semi-conservativa se alla generazione successiva passano due doppie eliche entrambi costituite da un'elica

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze LA TRASCRIZIONE processo nel quale il DNA stampo viene copiato in una molecola di RNA La molecola di RNA è identica in sequenza all elica codificante e complementare a quella stampo. La trascrizione è

Dettagli

DNA e replicazione del DNA

DNA e replicazione del DNA DNA e replicazione del DNA 1928: EXP di Griffith Scoperto il fattore trasformante Struttura elicoidale del DNA Struttura del DNA Subunità nucleotidiche Struttura del DNA Subunità nucleotidiche La replicazione

Dettagli

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali Strutture cellulari comuni tra cellule animali e vegetali: CITOPLASMA CITOSCHELETRO RIBOSOMI RETICOLO ENDOPLASMATICO APPARATO DEL GOLGI MITOCONDRI NUCLEO PEROSSISOMI CITOPLASMA materiale gelatinoso incolore

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

REPLICAZIONE DEI GENOMI A DNA

REPLICAZIONE DEI GENOMI A DNA REPLICAZIONE DEI GENOMI A DNA LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA FIGURA 12.26 GENES VII FIGURA 13.1 GENOMI II FIGURA 13.2 GENOMI II NEL 1958 MESELSON E STAHL DIMOSTRANO CHE

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Metabolismo, crescita e riproduzione batterica

Metabolismo, crescita e riproduzione batterica Metabolismo, crescita e riproduzione batterica 1 Ossigeno (presente o assente) Nutrienti (energia) Temperatura ottimale ph ottimale 2 OSSIGENO 1. Aerobi obbligati 2. Anaerobi obbligati 3. Aerobi/Anaerobi

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Il modello del Replicone

Il modello del Replicone Il modello del Replicone Il replicone copre l intera regione di DNA replicata a partire da una singola origine di replicazione (es. il genoma di E.coli corrisponde ad un singolo replicone). Il replicone

Dettagli

MODELLO SCHEDA INSEGNAMENTO

MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei.

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. DNA e RNA Composizione e proprietà Struttura Analisi 1 STRUTTURA DAGLI ACIDI NUCLEICI Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. I gruppi fosforici hanno pka vicino

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

L esperimento di Griffith sulla trasformazione genetica in pneumococco.

L esperimento di Griffith sulla trasformazione genetica in pneumococco. L esperimento di Griffith sulla trasformazione genetica in pneumococco. La natura chimica del materiale genetico ACIDI NUCLEICI DNA : deposito informazioni RNA: a) espressione informazione (es. sintesi

Dettagli

Adenina Adenine H H N N N N N Z

Adenina Adenine H H N N N N N Z Adenina Adenine Z Guanina O GUAIA Z Citosina CITOSIA Z O Timina Thymine C3 O Z O Siti di attacco elettrofilo 3 Thymine Basi appaiate: Timina-Adenina Adenine C 3 O O 3.ooA Basi appaiate: Citosina-Guanina

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE 1 AMMINOACIDI Gli amminoacidi sono composti organici composti da atomi di carbonio, idrogeno, ossigeno e azoto e in alcuni casi anche da altri elementi come lo zolfo. Gli amminoacidi

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare Principi di Citologia e Istologia. Prof. Pucci, 2003 Il compartimento nucleare Il Compartimento Nucleare Il compartimento nucleare è caratteristica propria degli eucarioti. Il compartimento consiste delle

Dettagli

La Topologia. La topologia è quella branca della matematica che studia le proprietà. delle strutture che non si modificano quando sono sottoposte a

La Topologia. La topologia è quella branca della matematica che studia le proprietà. delle strutture che non si modificano quando sono sottoposte a La Topologia La topologia è quella branca della matematica che studia le proprietà delle strutture che non si modificano quando sono sottoposte a deformazione. Ι - SUPERAVVOLGIMENTO DEL DNA La struttura

Dettagli

Escherichia coli. Applicazioni biotecnologie con microrganismi procarioti. Una delle speci batteriche più biotecnologica è senza dubbio

Escherichia coli. Applicazioni biotecnologie con microrganismi procarioti. Una delle speci batteriche più biotecnologica è senza dubbio Applicazioni biotecnologie con microrganismi procarioti Escherichia coli, Bacillus subtilis con altri batteri appartenenti ai generi Pseudomonas, Rhizobium, Lactobacillus possono essere usati: - piani

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Strutture alternative e strutture superiori degli acidi nucleici

Strutture alternative e strutture superiori degli acidi nucleici Strutture alternative e strutture superiori degli acidi nucleici Strutture alternative La struttura a doppia elica proposta da Crick e Watson, e che abbiamo sopra descritto, è quella ottenuta mediante

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI

METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI SPETTRI UV E QUANTIZZAZIONE SPETTROFOTOMETRICA DEGLI ACIDI NUCLEICI FIGURA 7.6A METODOLOGIA BIOCHIMICA (WILSON) a a = a 1 Assorbimento = a b a 1 b FIGURA

Dettagli

La cellula eucariotica animale

La cellula eucariotica animale Tutte le cellule sono circondate da una membrana plasmatica costituita da fosfolipidi e proteine. Le cellule eucariotiche posseggono organuli rivestiti di membrana. L organulo di dimensioni maggiori è

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Ciclo cellulare Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Arthur Kornberg, 1970 Replicazione

Dettagli

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI IL MATERIALE GENETICO Fino agli anni 40 si credeva che le proteine fossero le molecole della informazione ereditaria. C erano comunque

Dettagli

Caratteristiche strutturali dell RNA Le differenze con DNA sono date dal ribosio, dall uracile e dal fatto che normalmente non è presente nelle

Caratteristiche strutturali dell RNA Le differenze con DNA sono date dal ribosio, dall uracile e dal fatto che normalmente non è presente nelle RNA Caratteristiche strutturali dell RNA Le differenze con DNA sono date dal ribosio, dall uracile e dal fatto che normalmente non è presente nelle cellule come doppia elica. Solo in certi virus, dove

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2013-2014 corso A- L Docente: Massimo Gulisano m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza dei legami deboli

Dettagli

D'Addario - Biologia Molecolare

D'Addario - Biologia Molecolare 2. Struttura del DNA contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale gli acidi nucleici, acido desossiribonucleico (DNA)

Dettagli

LIVELLI DI STRUTTURA DELLE PROTEINE

LIVELLI DI STRUTTURA DELLE PROTEINE FUNZIONI E STRUTTURA DELLE PROTEINE PROF.SSA AUSILIA ELCE Indice 1 INTRODUZIONE -------------------------------------------------------------------------------------------------------------- 3 2 LIVELLI

Dettagli

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi. 8. Funzionamento dei genomi Il genoma dei procarioti

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi. 8. Funzionamento dei genomi Il genoma dei procarioti GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi 8. Funzionamento dei genomi Il genoma dei procarioti Modificazioni della cromatina e l espressione del genoma Il genoma degli eucarioti

Dettagli

Discipline biotecnologiche comuni; discipline biologiche CODICE INSEGNAMENTO SETTORI SCIENTIFICO DISCIPLINARI BIO/11 DOCENTE RESPONSABILE

Discipline biotecnologiche comuni; discipline biologiche CODICE INSEGNAMENTO SETTORI SCIENTIFICO DISCIPLINARI BIO/11 DOCENTE RESPONSABILE FACOLTÀ Scienze MM.FF.NN. ANNO ACCADEMICO 2014-2015 CORSO DI LAUREA Biotecnologie (cod.2075) INSEGNAMENTO BIOLOGIA MOLECOLARE TIPO DI ATTIVITÀ Caratterizzante AMBITO DISCIPLINARE Discipline biotecnologiche

Dettagli

LE BASI AZOTATE PIRIMIDINE PURINE

LE BASI AZOTATE PIRIMIDINE PURINE LE BASI AZTATE PURIE PIRIMIDIE Le basi azotate sono composti eterociclici aromatici con azoti portanti doppietti basici. Possono avere un solo anello (pirimidine) o due (purine). Le basi adenina, guanina

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

Buone regole. -nel dubbio, chiedere! LEGGERE BENE IL PROTOCOLLO PRIMA DI INIZIARE

Buone regole. -nel dubbio, chiedere! LEGGERE BENE IL PROTOCOLLO PRIMA DI INIZIARE Precauzioni da adottare in laboratorio: -non mangiare nè bere -indossare il camice -indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette -nel dubbio, chiedere! Buone regole LEGGERE

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli