Research Collection. Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Research Collection. Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi"

Transcript

1 Research Collection Master Thesis Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi Author(s): Matasci, Caterina Publication Date: Permanent Link: Rights / License: In Copyright NonCommercial Use Permitted This page was generated automatically upon download from the ETH Zurich Research Collection For more information please consult the Terms of use ETH Library

2 Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi Lavoro di diploma Caterina Matasci Febbraio Giugno Swiss Federal Institute of Technology Institute of Plant Sciences Plant Pathology group Referente: Dr Cesare Gessler Supervisore scientifico: Dr Andrea Patocchi

3 INDICE RIASSUNTO ABSTRACT INTRODUZIONE Storia della dispersione della malattia La situazione in Ticino Diffusione geografica Impatto economico Sintomatologia Sintomi su pomodoro (Lycopersicon esculentum Mill) Sintomi su lattuga (Lactuca sativa L var capitata L) Il virus Tassonomia Biologia Piante ospiti 8 Gli insetti vettori 9 F occidentalis Pergande 9 Biologia 9 8 Altri modi di trasmissione 8 Trasmissione tramite seme 8 Trasmissione tramite attrezzi di lavoro 9 Diagnosi Controllo della malattia Misure per ridurre l inoculo Misure di controllo del vettore Miglioramento genetico Evoluzione dei virus RNA Evoluzione di TSWV Analisi fiolgenetiche Scopo della ricerca MATERIALE E METODI Provenienza dei campioni Provenienza dei campioni Prelievo dei campioni di lattuga e pomodoro per diagnosi precoce Campioni di lattuga (Lactuca sativa L var capitata L) Campioni di pomodoro (Lycopersicon esculentum Mill) Estrazione di RNA Estrazione con il kit Nucleospin Multi9 Plant (MacheryNagel) Estrazione con RNeasy Plant Mini Kit (Qiagen) Estrazione con SV Total RNA Isolation System (Promega) Estrazione con il procedimento descritto da Jones et al, 998 Gel elettroforesi del prodotto estratto (RNA) 8 Sintesi di cdna ed amplificazione tramite PCR (RTPCR) 8 RTPCR con Access RTPCR Introductory System (Promega) 8 RTPCR con Reverse Transcriptase AMV (Roche) 9 i

4 Sintesi del cdna 9 Amplificazione specifica tramite PCR Nested PCR RTPCR con One Step RTPCR Kit (Qiagen) RTPCR con Robust II RTPCR Kit (Finnzymes) Gel elettroforesi del prodotto RTPCR Purificazione del prodotto RTPCR Quantificazione del DNA Efficacia della RTPCR come metodo di diagnosi della presenza di TSWV 8 Analisi dei campioni di lattuga e pomodoro per diagnosi precoce 9 Cycle sequencing 9 Purificazione dei prodotti della cycle sequencing Sequenziamento Elaborazione degli elettroferogrammi Ricerca di sequenze Allineamento delle sequenze Analisi filogenetiche RISULTATI Efficacia della RTPCR come metodo di diagnosi della presenza di TSWV Efficacia dei metodi di estrazione di RNA 8 Efficacia dei metodi di sintesi di cdna ed amplificazione tramite PCR (RTPCR) 8 Diagnosi precoce ed epidemiologia 8 Lattuga 9 Pomodoro Evoluzione del numero di piante di pomodoro e lattuga con TSWV (riassunto) Monitoraggio degli insetti vettori (dati gentilmente messi a disposizione da M Jermini) Temperatura ed umidità Sequenze degli isolati ticinesi Aplotipi Analisi filogenetiche 9 Variabilità delle sequenze 9 Dendogrammi basati sulle sequenze nucleotidiche 9 Dendogrammi basati sulle sequenze aminoacidiche Sequenze mondiali del gene NP Analisi filogenetiche Variabilità delle sequenze Dendogrammi basati sulle sequenze nucleotidiche Dendogrammi basati sulle sequenze aminoacidiche ii

5 DISCUSSIONE Metodologia Diagnosi precoce ed epidemiologia 8 TSWV in Ticino TSWV nel mondo Outlook Campioni Analisi del gene L Monitoraggio con piante spia Piante spia e trattamenti insetticidi Analisi dei tripidi vettori Analisi di piante infestanti che svernano nei tunnel RINGRAZIAMENTI LETTERATURA APPENDICE GLOSSARIO iii

6 RIASSUNTO Tomato spotted wilt virus (TSWV) è stato rilevato la prima volta in Ticino nel 99 ed è divenuto nel corso degli ultimi tre anni un grave problema nelle colture orticole ticinesi Al fine di sviluppare una strategia per contenere i danni arrecati da questa malattia è importante conoscere il modo in cui il virus viene importato nella coltura, sapere come si diffonde, dove sverna, se una pianta che non mostra sintomi è sicuramente sana e di individuare la variabilità genetica in Ticino Lo scopo di questo lavoro è determinare se è possibile diagnosticare precocemente il virus in piante di lattuga e pomodoro che non presentano i sintomi dell infezione e la variabilità genetica dei ceppi dei virus presenti in Ticino ed il loro collocamento a livello mondiale Per la diagnosi precoce di TSWV in piante che non presentano sintomi si è proceduto all analisi dei campioni di lattuga e pomodoro provenienti da un tunnel fortemente colpito dalla malattia nel È stato dapprima estratto l RNA totale da campioni di foglia e successivamente, il gene virale codificante per la proteina nucleocapsidica (NP) è stato amplificato tramite RTPCR Al fine di determinare la diversità genetica del virus presente in Ticino si è proceduto al sequenziamento di prodotti RTPCR di questi campioni e di piante di pomodoro presentanti i sintomi classici della malattia raccolti nel corso del Il metodo utilizzato ha permesso di diagnosticare la presenza di TSWV in foglie di lattuga e pomodoro senza sintomi Un numero relativamente alto di piante infette è stato riscontrato in entrambe le colture distribuite casualmente nella parcella, è quindi stato ipotizzato che i singoli focolai fossero dovuti ad un infezione primaria probabilmente imputabile a tripidi vettori provenienti dall esterno La presenza di materiale in apparenza sano, ma tuttavia infetto può rappresentare un importante fonte di diffusione del virus nelle colture circostanti e successive È stata inoltre notata la possibile funzione di piante infestanti presenti nel tunnel che potrebbero fungere da serbatoio per tripidi e virus tra una coltura e la successiva Il sequenziamento dei prodotti RTPCR ha permesso di osservare che in Ticino, malgrado il virus sia presente da soli anni, esiste una notevole diversità genetica Confrontando gli aplotipi rilevati nel con quelli del sono stati individuati casi in cui era presente completa identità tra gli aplotipi ed altri in cui essi erano diversi, ma con un numero molto ridotto di sostituzioni nucleotidiche ed aminoacidiche Ciò può indicare che gli aplotipi diversi sono potenzialmente nuovi e derivano da mutazioni degli aplotipi precedenti, indicando un evoluzione Tuttavia è possibile che essi fossero già stati presenti nel e non siano stati rilevati, oppure che essi siano stati importati in Ticino con l acquisto delle piante ed abbiano subito mutazioni nei luoghi d origine Nel contesto mondiale gli aplotipi ticinesi si suddividono in parte nel clade che comprende l isolato italiano ed in parte nel clade che raggruppa gli isolati dall Olanda, dalla Germania e dalla Repubblica Ceca Ciò indica che è possibile ipotizzare una correlazione tra la provenienza delle piante acquistate (Italia ed Olanda) e l aplotipo di TSWV infettante Questa ipotesi è consolidata dall osservazione di un aplotipo ticinese, identico all isolato olandese, riscontrato più volte in un azienda le cui piante di pomodoro sono state acquistate in Olanda Lo stesso vale per un azienda con piante di pomodoro provenienti dall Italia in cui è stato rilevato un aplotipo con una sola mutazione nucleotidica dall isolato italiano pubblicato

7 ABSTRACT Tomato spotted wilt virus (TSWV) was detected in Ticino for the first time in 99 and has become in the last three years an important problem in horticultural cultures To develop a strategy to control the damages caused by this virus it s important to know how the virus arrived in Ticino, how it spreads, were it overwinters, if a plant without symptoms is surely healthy and its genetic variability in Ticino and worldwide The aim of this study was to determine if it s possible to detect the virus in lettuce and tomato plants in absence of symptoms of TSWV infection, to detect the genetic variability of the virus haplotypes present in Ticino and to determine how they are situated worldwide For the detection in plants without symptoms, lettuce and tomato leafs were sampled in a plastic tunnel, strongly infected in Total RNA was extracted from leaf samples and successively the viral gene coding for the nucleocapsid protein (NP) was amplified by RT PCR with specific primers To define the genetic diversity of the virus present in Ticino, the RTPCR products of those samples and of those collected from tomato plants with classical TSWV symptoms in were sequenced The method used allowed the detection of TSWV in lettuce and tomato leafs without symptoms A quite large number of plants were detected in both cultures randomly distributed in the field It is therefore hypotized that this single centres of infection were produced by a primary infection probably by vector insects coming from outside The presence of plants in appearance healthy, but infected can represent an important source of virus spread in the surrounding or following cultures It was also noted that infesting weeds in the tunnel could act as reservoir for insect and viruses within a culture and the following one Although the virus is present in Ticino since only years the sequencing of the RTPCR product has demonstrated the presence of a great genetic diversity By the comparison of the haplotypes detected in and those of, identical haplotypes and haplotypes presenting strong similarities were identified The similar haplotypes could have been generated by mutation from the haplotype which was previously present Another hypothesis is that the haplotype was already present in but was not detected A third hypothesis is that the similar haplotypes were imported in Ticino by plant purchasing and were already mutated At worldwide context the haplotypes from Ticino split part in the clade with the Italian haplotype and in the clade with the isolates from The Netherlands, Germany and Czech Republic Because most of the plants grown in Ticino were buy in Italy or in the Netherlands it is possible to hypothise a correlation between plant origin (Italy and The Netherlands) and infecting haplotype

8 INTRODUZIONE STORIA DELLA DISPERSIONE DELLA MALATTIA Sintomi causati dal virus della bronzatura del pomodoro (sinonimi: virus dell avvizzimento maculato del pomodoro, tomato spotted wilt virus, TSWV) furono osservati la prima volta nel 9 su pomodoro in Australia (Brittlebank, 99) Negli anni il virus fu riscontrato negli Stati Uniti In Europa esso fu osservato nel 9 in Gran Bretagna (Smith, 9) e nel 9 in Francia su pomodoro in pieno campo Dopo la seconda guerra mondiale, l importanza della malattia divenne secondaria in Europa, essa non riapparve fino al 98, anno in cui fu osservata in Francia su peperone (Gebre Selassie et al, 989) e nei Paesi Bassi su pomodoro (Stijger et al, 989) Successivamente fu segnalata in Inghilterra (Barker, 989), Italia (Bellardi & Vicchi, 99), Portogallo (Louro, 99), Spagna (Jordá & Osca, 99) ed in altre nazioni europee in colture diverse La prima osservazione in Svizzera avvenne nel 99 nel canton Vaud (OCVCM, 99) La diffusione di massa di questo virus in Europa è da ricondurre all'introduzione dall America, nel 98, del tripide Frankliniella occidentalis Pergande uno dei maggiori vettori LA SITUAZIONE IN TICINO Il primo ritrovamento di TSWV in Ticino è avvenuto nel 99 in un tunnel a Tenero (Fig ) su pomodoro innestato di provenienza olandese (Pedrinis, 998) Nel 998 non sono state segnalate colture colpite, mentre nel 999 sintomi simili a quelli causati dal virus sono stati osservati in un azienda orticola di Coldrerio (Fig ) su insalata di provenienza italiana L'anno seguente () il virus della bronzatura del pomodoro è stato nuovamente riscontrato nell azienda di Coldrerio colpita nel 999, su lattuga e pomodoro di provenienza italiana ed in due altre aziende, una a Muzzano (Fig ) e l altra a Stabio (Fig ) A Muzzano sono state colpite colture di pomodoro di provenienza olandese, lattuga, batavia rossa e verde seminate in Ticino A Stabio il virus è stato riscontrato in alcuni tunnel con piantine di pomodoro di provenienza italiana, la pronta estirpazione ed i trattamenti insetticidi hanno contenuto le perdite (Pedrinis, ) Nel quattro aziende sono state colpite Nell'azienda di Stabio il virus è stato rilevato su poche piante di lattuga e su quasi tutte le piante di pomodoro in due tunnel Le piante di pomodoro sono state strappate e ripiantate, questa misura non è tuttavia risultata efficace in quanto esse sono state immediatamente colpite A Muzzano il virus è stato riscontrato su pomodoro, inizialmente (maggio) unicamente su di una pianta, in seguito (luglio) su più piante Le piante di pomodoro in entrambe le aziende provenivano dalla Sicilia, ma erano state fornite da ditte diverse Due nuove aziende, l'una situata nel Sopraceneri, ad Iragna (Fig ) e la seconda a Novazzano (Fig ) sono anch esse state colpite In entrambi i casi il virus è stato rilevato su pomodoro Le piantine acquistate dall azienda di Iragna provenivano dall'olanda, mentre quelle dell azienda di Novazzano da germogli italiani L'orticoltore di Coldrerio, le cui colture sono state colpite nel 999 e ha abbandonato l'attività (non a causa di TSWV), i terreni vengono probabilmente destinati a colture viticole (Pedrinis, comunicazione personale) Nel il virus è stato riscontrato in aprile in un azienda di Novazzano (Fig ) su colture di lattuga e lattuga foglia di quercia provenienti dall Olanda, in maggio è apparso

9 su di una pianta di pomodoro proveniente dalla Sicilia nell azienda di Muzzano colpita nei due anni precedenti ed in giugno è stato ritrovato su pomodoro a Stabio (Jermini, comunicazione personale) Fig : Cartina geografica del Ticino rappresentante la localizzazione delle aziende colpite da TSWV Tenero, primo ed unico rilevamento nel 99, Coldrerio, primo rilevamento nel 999, Muzzano, primo rilevamento nel, Stabio, primo rilevamento nel, Iragna, primo rilevamento nel, Novazzano (Brusata), primo rilevamento nel, Novazzano primo rilevamento nel DIFFUSIONE GEOGRAFICA TSWV è diffuso mondialmente nelle zone (sub)tropicali ed a clima temperato, eccetto in alcune regioni o nazioni della penisola araba o confinanti con il Sahara (Peters, 99) In Europa esso è presente in Austria, Belgio, Bulgaria, Cechia, Croazia, Francia, Germania, Gran Bretagna, Grecia, Ungheria, Irlanda, Italia, Lituania, Malta, Moldavia, Norvegia (in corso di eradicazione), Paesi Bassi, Polonia, Portogallo, Romania, Russia, Slovacchia, Spagna (Canarie comprese), Svezia, Svizzera, Turchia, Ucraina, Yugoslavia Il virus è stato debellato in Danimarca e Finlandia (EPPO, ) Non sono state trovate indicazioni su come ciò sia avvenuto IMPATTO ECONOMICO Annualmente TSWV causa in tutto il mondo perdite non inferiori ad un miliardo di dollari (Gallitelli & Davino, 998) I danni arrecati alle colture sono ingenti e possono in casi estremi determinare la perdita dell intero raccolto come riportato da Berling et al (99) per le colture di lattuga, peperoni e melanzane

10 SINTOMATOLOGIA I sintomi causati da TSWV variano a dipendenza della varietà e dello stadio di sviluppo della pianta ospite, dal periodo d infezione, dalle condizioni ambientali e dall'isolato virale Essi vengono espressi giorni dopo l inoculazione ( su petunia, su lattuga) e possono facilmente esser confusi con i sintomi provocati da funghi, batteri o causati da fitotossicità SINTOMI SU POMODORO (Lycopersicon esculentum Mill) Le piante colpite presentano bronzatura fogliare, macchie necrotiche ed avvizzimento I sintomi compaiono su foglie e frutti nella parte apicale della pianta con conseguente arresto della crescita ed accartocciamento verso l alto o il basso del lembo fogliare Le foglie più giovani assumono un tipico colore bronzeo mentre su quelle basali compaiono macchie necrotiche ben marcate, che si estendono fino ad interessare l intera foglia Sui frutti formati appaiono macchie circolari o anulature concentriche, spesso in rilievo e confluenti tra loro (Vicchi, 999) (Fig ) A A B B C Fig : A Sintomi di bronzatura su foglie di pomodoro B Tacche circolari su frutti acerbi C Aree decolorate su frutti maturi (Servizio fitosanitario cantonale, ) SINTOMI SU LATTUGA (Lactuca sativa L var capitata L) La pianta infetta presenta sulle foglie macchie necrotiche e/o clorotiche che si estendono con la crescita Le foglie ingialliscono, si deformano e possono divenire completamente necrotiche e disseccare I sintomi si presentano inizialmente su di un solo lato della pianta, essi si estendono in seguito verso il centro Se la pianta viene colpita precocemente, la sua crescita viene fortemente alterata (Marchoux et al, ) (Fig )

11 Fig : Lattuga con foglie cloronecrotiche (Servizio fitosanitario cantonale, ) IL VIRUS TASSONOMIA TSWV è tassonomicamente collocato nella famiglia Bunyaviridae, genere Tospovirus, sierogruppo Tomato spotted wilt Tospovirus è l unico di cinque generi appartenenti alla famiglia Buniyaviridae che comprende fitovirus, infatti ai generi Bunyavirus, Phlebovirus, Hantavirus e Nairovirus appartengono unicamente virus umani ed animali Il genere Tospovirus è suddiviso in due sierogruppi Nel sierogruppo Tomato spotted wilt sono riunite le specie Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV) e Tomato chlorotic spot virus (TCSV) Il sierogruppo Watermelon silver mottle comprende le specie Watermelon silver mottle virus (WSMV), Watermelon bud necrosis virus (WBNV) e Groundnut bud necrosis virus (GBNV) Le specie Impatiens necrotic spot virus (INSV), Chrysanthemum stem necrosis virus (CNSV), Iris yellow spot virus (IYSV), Peanut chlorotic fanspot virus (PCFV), Peanut yellow spot virus (PYSV), Physalis severe mottle virus (PSMV) e Zucchini lethal chlorosis virus (ZLCV) non appartengono ad alcun gruppo di sierotipi (Moyer, ) BIOLOGIA TSWV possiede un virione di forma sferica, il cui diametro varia tra 8 e nm Ogni particella virale è composta da un involucro di natura lipidica che racchiude tre RNA a singolo filamento (ssrna), chiamati in base alle loro dimensioni, S (small,,9 kb), M (medium,, kb) e L RNA (large, 8,9 kb) (Fig )

12 Fig : Rappresentazione tridimensionale e schematica di una particella di TSWV (Roselló et al, 99) I filamenti M e S RNA hanno strategia codificante ambisense, entrambi dispongono di due fasi di lettura aperta (ORF) separate da una regione ricca di basi A e U M RNA codifica una proteina non strutturale chiamata NSm (, kda), la quale svolge un ruolo importante nel trasporto sistemico del virus favorendo il passaggio da una cellula all altra di nucleocapsidi non racchiusi da un involucro (Kormelink et al, 99) In viral complementary sense M RNA codifica un precursore delle due glicoproteine G e G (, kda) le quali si trovano sulla superficie della particella virale S RNA codifica anch esso in viral sense una proteina non strutturale denominata NSs (, kda), la cui funzione specifica non è conosciuta, sembra tuttavia essere associata a strutture fibrillari od alla diffusione nel citoplasma delle cellule infette In viral complementary sense S RNA codifica la proteina nucleocapsidica NP (8,8 kda) strettamente associata a RNA L RNA codifica in viral complementary sense la proteina L, una trascrittasi inversa (DNA polimerasi RNAdipendente) (Fig ) La strategia di replicazione è tipica dei negative strand RNA viruses

13 Fig : Strategia di replicazione del genoma di TSWV I rettangoli grigi rappresentano le fasi di lettura aperta (ORF) I quadrati neri rappresentano la sequenza non viral necessaria per iniziare la traslazione di RNA messaggero (mrna) Le sequenze viral sono indicate con v, quelle viral complementary con vc (Roselló et al, 99) PIANTE OSPITI Più di specie appartenenti a 9 famiglie botaniche sono state riportate come suscettibili ai Tospovirus, di queste più di 9 possono ospitare TSWV (Peters, 998) In Europa le principali specie orticole ed industriali sono pomodoro (Lycopersicon esculentum), melanzana (Solanum melongena), peperone (Capsicum annuum), lattuga (Lactuca sativa), cicoria (Cychorim spp), patata (Solanum tuberosum), tabacco (Nicotiana tabacum), Cucurbitaceae (compreso cocomero, melone ed anguria), carciofo (Cynara scolymus) e fava (Vicia faba) Le principali piante ornamentali sono Alstroemeria, Anemone, Anthirrium, Aracea, Aster, Begonia, Bouvardia, Calceolaria, Callistephus, Celosia, Cestrum, Columnea, Cyclamen, Dahlia, Dendrathema x grandiflorum, Eustoma, Fatsia japonica, Gazania, Gerbera, Gladiolus, Hydrangea, Impatiens, Iris, Kalanchoe, Leucanthemum, Limonium, Pelargonium, Ranunculus, Saintpaulia, Senecio cruentus, Sinningia, Tagetes, Verbena, Vinca e Zinnia Piante infestanti o appartenenti alla flora 8

14 spontanea quali Amaranthus spp, Conyza bonariensis, Galinsoga spp, Polygonium lapathifolium, Portulaca oleracea, Senecio vulgaris, Solanum nigrum, Sonchus spp, Stellaria media, Taraxacum officinale possono rappresentare importanti serbatoi per il virus (EPPO, ) GLI INSETTI VETTORI In passato Thrips tabaci Lindemann era considerato il principale vettore di TSWV Successive ricerche hanno dimostrato che il virus può venir trasmesso da Frankliniella fusca Hinds, F intonsa Trybom, F schultzei Trybom, T palmi Karny, T setosus Moulton e che il vettore più efficiente è F occidentalis Pergande (Wijkamp et al, 99) F OCCIDENTALIS PERGANDE F occidentalis appartiene all ordine Thysanoptera, famiglia Thripidae, subfamiglia Thripinae L insetto è presente in quasi tutte le nazioni europee dal 98 e del sud degli USA (zona d origine), sporadicamente in Asia (Cipro, Corea, Israele, Giappone, e Turchia), Africa (Kenia, La Rèunion, Sud Africa e Zimbawe), Oceania (Australia e Nuova Zelanda), Centro (Guatemala e Costa Rica) e Sud America (Argentina, Cile, Colombia, eradicata nella Guyana Francese) (EPPO, 998) In un monitoraggio svolto nel è risultato che F occidentalis è presente in gran parte delle aziende orticole senza differenze regionali (Besomi, ) BIOLOGIA La femmina di F occidentalis raggiunge,, mm di lunghezza, il maschio è sensibilmente più piccolo e misura,9, mm Foccidentalis è notevolmente polifaga, essa è segnalata su piante ortive, floricole, fruttiferi e numerose piante erbacee infestanti Oltre a trasmettere TSWV essa provoca danni diretti alle colture tramite l alimentazione, la quale avviene mediante immissione di saliva nei tessuti vegetali e successiva suzione dei contenuti cellulari parzialmente digeriti e l ovodeposizione Esse causano depigmentazioni, disseccamenti, suberificazioni, cicatrici, necrosi e deformazioni su germogli, foglie, fiori e frutti (Pollini, 998) Il ciclo biologico di F occidentalis comprende sei stadi: uovo, primo (neanide) e secondo stadio larvale, prepupa, pupa ed adulto L insetto si nutre attivamente unicamente nel primo e secondo stadio larvale e da adulto L acquisizione del virus avviene durante il primo stadio larvale con l alimentazione su piante infette in un tempo medio di minuti (Wijkamp et al, 99) Dopo un periodo di latenza, durante il quale l insetto raggiunge il secondo stadio larvale ed il virus si moltiplica nelle cellule dell epitelio del canale alimentare, in quelle dei muscoli che lo circondano e nelle ghiandole salivari (Bandla et al, 998), esso diventa vettore del virus Nei due stadi che seguono (prepupa e pupa) l insetto si trova nel suolo e non trasmette il virus L adulto, pur nutrendosi di piante infette, non può acquisire il virus per una particolare conformazione del canale alimentare Esso trasmette il virus unicamente se lo ha acquisito nel primo stadio larvale Il periodo medio di inoculazione è di 9 minuti Il virus non viene trasmesso alla prole attraverso le uova (Wijkamp et al, 99) (Fig) Il tipo di trasmissione è persistente, circolativo e replicativo (propagativo) 9

15 Fig : Ciclo biologico di F occidentalis Pergande (Zitter & Daughtrey, 989) Tra parentesi durata del singolo stadio (Pollini, 998) Rettangolo grigio: stadio in cui l insetto acquisisce il virus Rettangolo nero: stadio in cui l insetto è in grado di trasmettere il virus 8 ALTRI MODI DI TRASMISSIONE 8 TRASMISSIONE TRAMITE SEME GebreSelassie et al (989) indicano che la trasmissione del virus via seme è stata riportata nel dopoguerra, ma che essa non è mai stata confermata Marchoux et al () riportano che, data la forte frequenza di infezioni in colture di cineraria (Senecio cineraria), la trasmissione tramite seme sembra essere possibile ma che finora non è stato possibile provarlo, mentre Reddy (988) esclude totalmente questa via Antignus et al (99) indicano che i semi di pomodoro, peperone, celosia e petunia sono esternamente contaminati da virus, ma che tuttavia non avviene alcuna trasmissione Pottorff & Newman () riportano che TSWV può venir trasmesso tramite seme di Petunia x hybrida e Lycopersicon esculentum 8 TRASMISSIONE TRAMITE ATREZZI DI LAVORO La trasmissione tramite attrezzi di lavoro è aleatoria ed ha molto probabilmente solamente un'importanza secondaria (GebreSelassie et al, 989)

16 9 DIAGNOSI Diverse tecniche possono essere utilizzate per la diagnosi della presenza di Tospovirus Trasmissione meccanica su piante test (Allen & Matteoni, 99) Microscopia elettronica (Peters et al, 99, Kitajima et al, 99) Trasmissione tramite tripidi Serologia Test immunoenzimatico della presenza del virus sia nell ospite vegetale con anticorpi policlonali (Gonsalves & Trujillo, 98) e monoclonali (Sherwood et al, 989) sia nell insetto vettore (Cho et al, 988, Bandla et al, 99) Dotblot immunoassay (Hsu & Lawson, 99) Ibridazione con cloni di cdna (Ronco et al, 989) Ibridazione con ribosonde (Huguenot et al, 99) Tecniche basate su Polymerase Chain Reaction (PCR) (Immunocapture Polymerase Chain Reaction (ICPCR), Reverse Transcription Polymerase Chain Reaction (RT PCR), Immunocapture Reverse Transcription Polymerase Chain Reaction (ICRT PCR)) (Nolasco et al, 99, Mumford et al, 99, Weekes et al, 99, Adam et al, 99, Jain et al, 998) CONTROLLO DELLA MALATTIA MISURE PER RIDURRE L INOCULO Le misure per ridurre l inoculo comprendono: () il controllo del trasporto di materiale vegetale per evitare la diffusione del focolaio di infezione e l'introduzione di piante infette in campi sani, () l eliminazione di piante infestanti e dei resti della coltura precedente che potrebbero fungere da serbatoio, () il controllo protettivo della coltura con reti e () la rimozione delle prime piante infette (Roselló et al, 99) o dell intera coltura se l'incidenza è troppo elevata (Yudin et al, 99) MISURE DI CONTROLLO DEL VETTORE Il controllo del vettore consiste in metodi fisici, chimici e di lotta biologica I primi comprendono l uso di reti a maglie finissime su porte e finestre per colture coperte o di pacciamatura riflettente (repellente per l insetto) I metodi chimici sono sovente inefficaci data la difficoltà nel colpire l insetto nel ricettacolo florale (luogo principale d insediamento), l elevata velocità di proliferazione, l accavallarsi di più generazioni con il rischio di insorgenza di resistenze e non da ultimo l elevata polifagia dell insetto che ne determina la presenza in moltissime specie sia spontanee che coltivate (Vicchi & Garritano, 999) La lotta biologica sfrutta antagonisti naturali, quali acari predatori (Amblyseius spp), cimici predatrici (Orius spp) o funghi (Verticillium lecanii) per ridurre la popolazione di tripidi (UMS, )

17 MIGLIORAMENTO GENETICO La selezione di piante resistenti è il metodo più efficace per evitare la malattia Negli ultimi decenni, grandi sforzi orientati verso la ricerca di resistenze in generi vicini di Lycopersicon e nello sviluppo di piante transgeniche tolleranti o resistenti sono stati profusi senza tuttavia mostrare risultati positivi mantenuti nel tempo EVOLUZIONE DEI VIRUS RNA Virus con RNA come genoma sono i parassiti cellulari conosciuti più diffusi Lo straordinario successo evolutivo è da ricondurre alla loro abilità di usare molteplici strategie riproduttive con un periodo generativo ridotto e di adattarsi facilmente ad una varietà di nicchie ecologiche Vi sono diversi fattori che conducono ad una variazione del genoma: mutazioni, riassortimenti e ricombinazioni (Matthews, ) () Le mutazioni (sostituzioni, delezioni ed addizioni) sono dovute alla scarsa fedeltà della replicazione dei genomi costituiti da RNA ed all assenza di un meccanismo di riparazione I virus RNA possiedono oltre ad un elevato tasso di replicazione ( replicazioni al giorno) un elevato tasso di mutazione ( mutazioni per nucleotide per replicazione) (Tsimring et al 99) () I virus RNA dispongono di meccanismi di riassortimento, attraverso i quali nuove varianti possono essere generate da geni virali preesistenti () Le ricombinazioni determinano la formazione di molecole di acido nucleico da segmenti precedentemente separatisi dalla stessa molecola o presenti in molecole parentali diverse Avviene normalmente durante la replicazione e può essere un meccanismo di riparazione Un ulteriore fattore rilevante è il fenomeno chiamato random genetic drift Esso si verifica in modo rilevante nelle piccole popolazioni, dove singoli alleli possono essere eliminati o aumentare di frequenza, in modo del tutto casuale (senza selezione) in condizioni di drastiche riduzioni di popolazioni (bottleneck effect) o quando una nuova popolazione prende avvio da un numero ridotto di individui (founder effect) Da tutti questi fattori risulta che da un genitore può derivare nel corso del tempo una moltitudine di mutanti Sebbene vi sia una grande eterogeneità, questo non significa che si verifichi una rapida evoluzione Ci sono infatti condizioni (fattori biotici ed abiotici) per le quali i virus si riproducono velocemente ed efficientemente e quindi che favoriscono un accumulo di mutazioni competitive (Steinhauer & Holland, 98) EVOLUZIONE DI TSWV Il genoma tripartito di TSWV, la capacità di replicarsi sia nella pianta sia nell insetto vettore e la presenza di ceppi o Tospovirus diversi in infezione mista nella stessa pianta o in replicazione nello stesso vettore possono facilmente favorire la comparsa di riassortanti o di ricombinanti (Gallitelli & Davino, 998)

18 ANALISI FILOGENETICHE Organismi possono essere paragonati e quindi differenziati analizzando le differenze a livello della sequenza degli acidi nucleici in esso contenuti Anche una sola base mutata in un intero genoma può servire da elemento distintivo Le differenze genomiche possono essere sondate con diversi tipi di marcatori molecolari come RFLPs, AFLPs, RAPDs, SSRs o come in questa ricerca sequenziando una parte di un gene (NP) Un concetto chiave per la sistematica molecolare è quello di distanza genetica, la quale esprime la divergenza tra unità tassonomiche (operational taxonomic unit, OTU) Le distanze possono venir calcolate con diversi modelli utilizzati secondo l analisi da effettuare p distance è il più semplice JukesCantor, Kimura parametri, TajimaNei, Tamura e TamuraNei sono modelli matematici che permettono di stimare il numero di nucleotidi sostituiti Contrariamente a p distance, considerano sostituzioni parallele e backward e sono quindi più adatti quando il rapporto p (numero di loci polimorfici diviso per l intera lunghezza del genoma) è elevato Un terzo tipo di modelli (Gamma distance for the JukesCantor Model, Gamma distance for the Kimura Model, Gamma distance for the TamuraNei Model) basati sulla distribuzione gamma, considera la diversità del tasso di nucleotidi sostituiti Rappresentazioni grafiche delle distanze tra OTU vengono chiamate alberi filogenetici o dendogrammi Essi consistono in nodi (OTU) e rami (percorsi che connettono i nodi) e riassumono il percorso evolutivo degli OTU in questione Un albero è in scala se la lunghezza dei suoi rami è proporzionale alla distanza genetica ed è unrooted se privo di un nodo interno che rappresenta un potenziale antenato Esistono molteplici algoritmi capaci di calcolare distanze tra OTU e rappresentarne gli alberi, essi possono essere classificati in distance methods (Neighbor Joining, UPGMA) e discretecharacter methods (Maximum Parsimony, Maximum likelihood) L algoritmo Neighbor Joining è basato sul principio di minimum evolution, il quale assume che l albero con la minor somma della lunghezza dei rami sia il migliore Neighbor Joining non esamina tutte le possibili topologie, ma ad ogni stadio del cladeing applica il principio di minimum evolution (Nei & Kumar, ) L algoritmo Maximum Parsimony assume che ogni OTU evolva indipendentemente e calcola il minor numero di sostituzioni che spiegano l intero processo evolutivo, la topologia che richiede il minor numero di sostituzioni è poi ritenuta come migliore albero Vi sono due classi di metodi di ricerca degli alberi ottimali: metodi esatti (branch and bound search) ed euristici (heuristic search) Con un numero di OTU maggiore di 9 è consigliabile utilizzare il metodo di ricerca heuristic per evitare tempi di calcolazione troppo elevati Esso non garantisce affatto che l albero corretto venga generato, poichè unicamente una piccola parte degli alberi possibili vengono esaminati Quale risultato vengono generati una serie di alberi (equally parsimonius trees), nel caso ottimale uno solo (most parsimonious o optimal tree), dai quali viene calcolato un consensus tree secondo diversi algoritmi Al fine di conferire una sicurezza statistica all ipotesi di relazione, Felsenstein (98) ha sviluppato l algoritmo bootstrap Il metodo utilizzato in MEGA differisce lievemente da quello descritto originariamente da Felsenstein, esso attua una campionatura dei dati iniziali e genera una serie di replicati casuali che inserisce nelle sequenze originali, generandone un nuovo set, il quale è utilizzato per creare un nuovo albero La topologia dell albero così ottenuto viene paragonata a quello iniziale Ad ogni ramo che coincide viene dato il valore (identity value) mentre agli altri Questo processo viene ripetuto più volte (generalmente ) e la percentuale delle volte in cui il ramo ha valore viene calcolata Questo valore è indicarto come bootstrap confidence value o semplicemente bootstrap value (Nei & Kumar, )

19 SCOPO DELLA RICERCA Implementare la tecnica della trascrizione inversa (RTPCR) come metodo di diagnosi della presenza di TSWV Determinare se con questa tecnica è possibile diagnosticare infezioni latenti (senza presenza di sintomi) e nel caso positivo dopo quanto tempo dall infezione Determinare attraverso sequenziamento se in Ticino sono presenti uno o più genotipi di TSWV Se più genotipi sono presenti, determinarne la possibile origine

20 MATERIALE E METODI PROVENIENZA DEI CAMPIONI campioni di foglia di pomodoro prelevati da piante presentanti i sintomi tipici di TSWV sono stati raccolti da M Jermini e T Pedrinis nei mesi di luglio ed agosto presso le aziende All Orto (Muzzano, campioni), Ballerini (Novazzano, Brusata, campioni), Beghelli (Iragna, 9 campioni) e Giorgi (Novazzano, 9 campioni) I campioni sono stati conservati a C in sacchetti di plastica PROVENIENZA DEI CAMPIONI Un campione di foglia di pomodoro, uno di lattuga ed uno di lattuga foglia di quercia con i sintomi tipici di TSWV riscontrati in aziende ticinesi sono stati raccolti e conservati a C in sacchetti di plastica PRELIEVO DEI CAMPIONI DI LATTUGA E POMODORO PER DIAGNOSI PRECOCE Una superficie (tunnel di plastica, 8 m) è stata selezionata presso l azienda Giorgi a Novazzano dove il virus ha avuto una forte incidenza nella stagione La temperatura e l umidità all interno del tunnel sono state rilevate con un termoidrografo La popolazione degli insetti vettori (F occidentalis e T tabaci) è stata monitorata con l ausilio di trappole cromotropiche Rebell blu (Andermatt Biocontrol, Grossdietwil) da M Jermini CAMPIONI DI LATTUGA (Lactuca sativa L var capitata L) Campioni di foglia sono stati prelevati ad intervalli settimanali (in totale prelievi) da piante di lattuga varietà Gomera Le piante non hanno subito alcun trattamento fitosanitario dopo il trapianto nel tunnel piante di lattuga sono state scelte casualmente all interno della parcella, esse sono state marcate con una bacchetta di plastica posta vicino alla pianta e numerate in maniera crescente a partire dalle entrate del tunnel (Fig ) cm ca di tessuto proveniente dalle prime foglie (tra la quinta e l ottava partendo dal piede) sono stati staccati, posti singolarmente in sacchetti di plastica e conservati a C Il primo prelievo è stato effettuato il marzo, l ultimo il aprile quando le piante erano pronte per la raccolta

21 Nord Sud Fig : Rappresentazione del tunnel da cui sono stati prelevati i campioni di lattuga : pianta di lattuga CAMPIONI DI POMODORO (Lycopersicon esculentum Mill) Campioni di foglia sono stati prelevati ad intervalli settimanali ( prelievi) da piante di pomodoro Egeris a due teste Il tunnel è stato suddiviso in tre sezioni con diverso trattamento insetticida Nella prima, posizionata a sud, i trattamenti insetticidi sono stati eseguiti secondo una soglia di tolleranza di inizialmente, in seguito insetti per trappola La seconda sezione, situata nel mezzo del tunnel è stata trattata intensivamente, mentre la terza, posta a nord non è stata trattata (sezione testimone) Sono state scelte 8 piante disposte vicino alle entrate, esse sono state numerate per fila in modo crescente a partire dall entrata del tunnel I campioni da a provengono dalla superficie testimone, mentre i campioni da a 8 da piante trattate secondo la soglia di tolleranza, basata sul numero di catture per trappola (chiamata in questo lavoro: strategia) (Fig 8) cm ca di tessuto proveniente dalla fogliola all estremità della terza foglia (dalla testa verso il basso), sono stati staccati, posti singolarmente in provette Eppendorf da ml e conservati a C Il primo prelievo è stato effettuato il maggio, l ultimo il maggio Nord Testimone Trattamento intensivo Strategia Sud Fig 8: Rappresentazione del tunnel da cui sono stati prelevati i campioni di pomodoro Il tunnel è stato suddiviso in tre sezioni con diverso trattamento insetticida I campioni sono stati prelevati nella sezione testimone ed in quella trattata secondo la strategia : pianta di pomodoro : altre piante di pomodoro presenti nel tunnel ma non indicate nella rappresentazione

22 ESTRAZIONE DI RNA Sono stati applicati quattro metodi di estrazione ESTRAZIONE CON IL KIT NUCLEOSPIN MULTI9 PLANT (MACHEREY NAGEL, OENSINGEN, SVIZZERA) È stato seguito il protocollo annesso con le seguenti modifiche: punto : non è stata aggiunta RNasi punto : i campioni sono stati centrifugati per min a g invece di min punto : i campioni sono stati centrifugati per min a g invece di min ESTRAZIONE CON RNeasy PLANT MINI KIT (QIAGEN, HILDEN, GERMANIA) È stato seguito il protocollo annesso ESTRAZIONE CON SV TOTAL RNA ISOLATION SYSTEM (PROMEGA, MADISON, USA) È stato seguito il protocollo annesso ESTRAZIONE CON IL PROCEDIMENTO DESCRITTO DA Jones et al, 998 È stato seguito il procedimento con modifiche Polverizzare mg di foglia (Fast Prep FP BIO Savant) in un Eppendorf da ml con biglie di vetro di, mm (Biospec) Aggiungere µl di homogenisation buffer e mischiare Aggiungere µl di % SDS e 8 µl di cloroformioalcol isoamilico (:) Mischiare le fasi per min e centrifugare per min a g ( C Eppendorf) Trasferire la fase acquosa in un nuovo Eppendorf da, ml e riestrarre con µl di cloroformioalcol isoamilico (:), mischiare le fasi per min e centrifugare per min a g ( C Eppendorf) Ripetere il punto Trasferire il supernatante ( µl) in un nuovo Eppendorf da, ml ed aggiungere µl di acetato di sodio M e ml di etanolo gelido al % 8 Incubare a C per min e centrifugare per min a g ed a C ( R Eppendorf) 9 Scartare il supernatante, risospendere il pellet in µl di acetato di sodio M Incubare su ghiaccio per min, centrifugare per min a g ed a C ( R Eppendorf) Scartare il supernatante, risospendere il pellet di RNA in µl di TE ph 8, aggiungere µl di acetato di sodio M

23 Estrarre con µl di cloroformioalcol isoamilico (:), mischiare le fasi per min e centrifugare per min a g ( C Eppendorf) Trasferire il supernatante in un nuovo Eppendorf da, ml ed aggiungere µl di etanolo al % Incubare a C per min Centrifugare per min a g ed a C ( R Eppendorf) Scartare il supernatante Lavare il pellet con µl di etanolo al % Essiccare il pellet per min (SpeedVac Concentrator Savant) Risospendere il pellet in µl di acqua priva di RNAsi (DEPC treated water) Homogenisation buffer:, M TrisHCl ph 8,,, M saccarosio, mm acetato di Mg, mm KCl, % PVP,,% βmercaptoetanolo GEL ELETTROFORESI DEL PRODOTTO ESTRATTO (RNA) µl di prodotto estratto sono stati separati su gel di agarosio % (Gibco) in,x TBE contenente tracce di bromuro di etidio SINTESI DI cdna ED AMPLIFICAZIONE TRAMITE PCR (RTPCR) Sono stati applicati quattro sistemi, due utilizzanti la retrotrascrittasi derivata da Avian Myeloblastosis Virus (AMV), uno Moloney Murine Leukemia Virus (MMuLV) ed un sistema a base di ricombinanti eterodimerci di enzimi espressi in E coli per la sintesi di cdna RTPCR CON ACCESS RTPCR INTRODUCTORY SYSTEM (PROMEGA MADISON, USA) Per l analisi dei campioni di pomodoro raccolti nel, i quali presentavano sintomi evidenti di TSWV è stato utilizzato il kit Access RTPCR Introductory Sytem (Promega, Madison, USA) Il protocollo annesso è stato seguito utilizzando i primers NP pubblicati da Jain et al, 998 (Tab ) ed aggiungendo al mix di reazione µl di Template RNA (Tab ) Per l amplificazione, eseguita in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), sono state rispettate le condizioni descritte in Tab Tab : Primer specifici per gene NP di TSWV (sintetizzati da Mycrosynth, Belgach, Svizzera) Primer Coordinate Sequenza Referenza NP for ATGTCTAAGGTTAAGCTC Jain et al, 998 NP rev 9 9 TTAAGCAAGTTCTGTGAG Jain et al, 998 Coordinate sulla mappa dei nucleotidi dell isolato BR (De Haan et al, 99) 8

24 Tab : Mix di reazione per RT PCR Reagenti Mix Concentrazione finale ddh O µl AMV/Tfl x Reaction Buffer µl x dntp Mix (mm di ogni dntp) µl, mm Primer For ( µm) µl µm Primer Rev ( µm) µl µm mm MgSO µl µm AMV Reverse Trancsriptase (u/µl) µl, u/µl Tfl DNA Polymerase (u/µl) µl, u/µl RNA totale µl Volume totale µl Tab : Condizioni per RTPCR First strand cdna Synthesis ( ciclo) Temperatura Durata Reverse transcription 8 C min AMV RT inactivation and RNA/cDNA/primer denaturation 9 C min Second strand Synthesis e amplificazione tramite PCR ( cicli) Temperatura Durata Denaturazione 9 C s Annealing C min Estensione 8 C min Estensione finale 8 C min RTPCR CON REVERSE TRANSCRIPTASE AMV (ROCHE, MANNHEIM, GERMANIA) Per l analisi dei bulks dell esperimento di diagnosi precoce di lattuga e pomodoro senza sintomi è stata utilizzata, per la sintensi di cdna la retrotrascriptasi AMV (Roche, Mannheim, Germania) Il prodotto ottenuto è stato successivamente amplificato mediante PCR, seguita da un ulteriore amplificazione con nested primers SINTESI DEL cdna Non trattandosi di un kit one step, è stato dapprima sintetizzato cdna utilizzando l enzima AMV (Roche, Mannheim, Germania) Il protocollo annesso è stato seguito utilizzando i primers NP pubblicati da Jain et al, 998 (Tab ) ed aggiungendo al mix di reazione µl di RNA totale (Tab ) Per la sintesi di cdna, eseguita in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), sono state rispettate le condizioni descritte in Tab 9

25 Tab : Mix di reazione per sintesi del cdna Reagenti Mix x Incubation Buffer µl dntp Mix µl Primer NP rev ( µm), µl AMV Reverse Trancsriptase (u/µl), µl RNA totale µl Volume totale µl Tab : Condizioni per reverse transcriptase (Dewey et al, 99) First strand cdna Synthesis ( ciclo) Temperatura Durata Sintesi di cdna C min AMV RT inactivation 9 C, min AMPLIFICAZIONE SPECIFICA TRAMITE PCR In un secondo passaggio cdna sono stati amplificati mediante PCR µl di soluzione di sintesi di cdna sono stati aggiunti al mix di reazione di PCR (Tab ) Per l amplificazione, eseguita in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), sono state rispettate le condizioni descritte in Tab Tab : Mix di reazione per PCR specifica Reagenti Mix Concentrazione finale ddh O,8 µl x Buffer, µl dntp Mix, µl, mm Primer NP rev ( µm), µl, µm Primer NP for ( µm), µl, µm Taq, µl, u/µl cdna µl Volume totale µl Tab : Condizioni per PCR specifica ( cicli) Temperatura Durata Denaturazione 9 C s Annealing C s Estensione C min Estensione finale 8 C min NESTED PCR Nested primers sono stati disegnati sulla sequenza TITOA allineata con altre sequenze di isolati ticinesi (TITOB TITOC) (Tab 8)

26 Tab 8: Primers per nested PCR (sintetizzati da Mycrosynth, Belgach, Svizzera) Primer Coordinate Sequenza Referenza NPnest for CCTTGAGTTTGAGGAAGATCAGA questa ricerca NPnest rev 8 8 CCTTTAGCATTAGGATTGCTGG questa ricerca Coordinate sulla mappa dei nucleotidi dell isolato BR (De Haan et al, 99) µl di prodotto PCR della prima amplificazione sono stati aggiunti al mix di reazione (Tab 9) Per l amplificazione, eseguita in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), sono state rispettate le condizioni descritte in Tab Tab 9: Mix di reazione per PCR specifica Reagenti Mix Concentrazione finale ddh O,88 µl x Buffer, µl dntp Mix, µl, mm Primer NPnest rev ( µm), µl, µm Primer NPnest for ( µm), µl, µm Taq, µl, u/µl Template DNA µl Volume totale µl Tab : Condizioni per PCR specifica ( cicli) Temperatura Durata Denaturazione 9 C s Annealing C s Estensione C min Estensione finale 8 C min RTPCR CON ONE STEP RTPCR KIT (QIAGEN, HILDEN, GERMANIA) Il protocollo annesso è stato seguito utilizzando i primers NP pubblicati da Jain et al, 998 (Tab ) ed aggiungendo al mix di reazione µl di RNA totale (Tab ) Per l amplificazione, eseguita in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), sono state rispettate le condizioni descritte in Tab Tab : Mix di reazione per RT PCR Reagenti Mix Concentrazione finale RNAse free Water 8 µl x QIAGEN One Step RTPCR Buffer µl x dntp Mix µl µl di ogni dntp Primer NP rev ( µm) µl, µμ Primer NP for ( µm) µl, µμ QIAGEN One Step RTPCR Enzyme Mix µl Template RNA µl Volume totale µl

27 Tab : Condizioni per RTPCR First strand cdna Synthesis ( ciclo) Temperatura Durata Reverse transcription C min Initial PCR activation step 9 C min Second strand Synthesis e amplificazione tramite PCR ( cicli) Temperatura Durata Denaturazione 9 C s Annealing C s Estensione C min Estensione finale C min RTPCR CON ROBUST II RTPCR KIT (FINNZYMES, ESPOO, FINLANDIA) Il protocollo annesso è stato seguito utilizzando i primers NP pubblicati da Jain et al, 998 (Tab ) ed aggiungendo al mix di reazione µl di RNA totale (Tab ) Per l amplificazione, eseguita in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), sono state rispettate le condizioni descritte in Tab Tab : Mix di reazione per RT PCR Reagenti Mix RNase free Water µl x RobusT Reaction buffer µl mm MgCl µl dntp Mix µl Primer NP rev ( µm) µl Primer NP for ( µm) µl MMuLV RT RNase H u/µl µl DyNAzyme EXT u/µl µl RNA totale µl Volume totale µl Tab : Condizioni per RTPCR First strand cdna Synthesis ( ciclo) Temperatura Durata Reverse transcription 8 C min Initial PCR activation step 9 C, min Second strand Synthesis ed amplificazione tramite PCR ( cicli) Temperatura Durata Denaturazione 9 C s Annealing C s Estensione C min Estensione finale C min GEL ELETTROFORESI DEL PRODOTTO RTPCR µl di prodotto RTPCR sono stati separati su gel di agarosio % (Gibco) in,x TBE contenente tracce di bromuro di etidio

28 PURIFICAZIONE DEL PRODOTTO RTPCR E stato utilizzato il QIAquick PCR Purification Kit (Qiagen, Hilden, Germania) seguendo il protocollo annesso, eluendo con µl di tampone d eluizione QUANTIFICAZIONE DEL DNA La stima della quantità di DNA purificato è stata effettuata confrontando la luminosità delle bande di DNA con le bande degli standard ng, ng e ng su gel di agarosio EFFICACIA DELLA RTPCR COME METODO DI DIAGNOSI DELLA PRESENZA DI TSWV L efficacia della diagnosi di TSWV tramite RTPCR è stata testata analizzando campioni di foglia di pomodoro in cui la presenza del virus è stata precedentemente accertata, campioni provenienti da piante sane ed di acqua (controlli negativi) RNA è stato estratto con il kit Nucleospin Multi9 Plant (MachereyNagel, Oensingen, Svizzera) e la sintesi di cdna e successiva amplificazione tramite PCR è stata eseguita con il kit Access RTPCR Introductory System (Promega, Madison, USA) utilizzando i primers L indicati in Tab Tab : Primer specifici per gene L di TSWV (sintetizzati da Mycrosynth, Belgach, Svizzera) Primer Coordinate Sequenza Referenza L AATTGCCTTGCAACCAATTC Mumford et al, 99 L 9 ATCAGTCGAAATGGTCGGCA Mumford et al, 99 Coordinate sulla mappa dei nucleotidi dell isolato BR (De Haan et al, 99) 8 ANALISI DEI CAMPIONI DI LATTUGA E POMODORO PER DIAGNOSI PRECOCE RNA è stato estratto utilizzando il kit NucleoSpin Multi9 Plant (Macherey Nagel, Oensingen, Svizzera) La presenza di RNA è stata controllata su gel (cap ) Dai Template RNA estratti, disposti su 8 righe (AH) in () colonne in una piastra da microtitrazione, sono stati prelevati µl di ogni campione e sono stati mescolati per linea e per colonna ottenendo bulk, 8 di RNA presenti nelle righe (AH) e nelle colonne ()

29 A 9 A B 8 B C 9 C D 8 D E 9 E F 8 F G 9 G H 8 8 H Fig 9: Schema rappresentante la costruzione dei bulk per diagnosi precoce 9 CYCLE SEQUENCING Per determinare la sequenza delle basi nella molecola di DNA è stato utilizzato ABI PRISM Big Dye TM Terminator v Ready Reaction Cycle Sequencing Kit (Applied Biosystems, ) Ogni DNA è stato sequenziato nelle due direzioni utilizzando i primers NP for e NP rev pubblicati da Jain et al, 998 Le reazioni di sequenziamento sono state eseguite come descritto in Tab in un termocycler Gene Amp 9 PCR System (Perkin Elmer Cetus), rispettando le condizioni descritte in Tab Tab : Mix per cycle sequencing Mix Big dye µl x rxn buffer, µl Primer NP for o NP rev (, µμ) (nested per insalata), µl ddh O Y DNA ( ng) X Volume totale µl x rxn buffer: mm Tris HCl, mm MgCl, ph 9, Tab : Condizioni per cycle sequencing ( cicli) Temperatura Durata Denaturazione 9 C s Annealing C s Estensione C min

30 9 PURIFICAZIONE DEI PRODOTTI DELLA CYCLE SEQUENCING Con questa procedura vengono eliminati sali, primers e altri oligonucleotidi di lunghezza leggermente superiore, ddntps e dntp non integrati In una piastra per filtrazione MAHVN (ABI PRISM) aggiungere ad un volume di µl di DNA Grade Sephadex G Fine (Amersham Pharmacia Biotech), 9 µl di ddh O Lasciar equilibrare a temperatura ambiente per ore o più a lungo in refrigerante Le piastre equilibrate possono venir sigillate con un foglio di pellicola per alimenti (Saran) e conservate a C in refrigerante per più settimane Porre la piastra per filtrazione su una piastra per titolazione (microtiter plate) e centrifugare a 9 g per min (Sigma C Qiagen) Gettare il tampone raccolto nella piastra per titolazione Aggiungere µl di ddh O per purificare il Sephadex e centrifugare a 9 g per min (Sigma C Qiagen) Aggiungere µl di acqua al prodotto di reazione Pipettare il tutto nella colonna di Sephadex Porre la piastra per filtrazione su una piastra (Beckman CEQ) e centrifugare a 9 g per min (Sigma C Qiagen) Ricoprire con µl di olio minerale il prodotto purificato SEQUENZIAMENTO Il sequenziamento del prodotto PCR è stato eseguito con il sequenziatore Genetic Analyzer (ABI PRISM) secondo i parametri descritti in Tab 8 Tab 8: Parametri di lettura delle sequenze Lunghezza dei capillari mm Run s Run temperature C Run voltage, kv Injection s Injection voltage, kv ELABORAZIONE DEGLI ELETTROFEROGRAMMI Per ogni campione è stata ottenuta la sequenza FORWARD e REVERSE Il programma GCG (Genetics Computer Group of the University of Winsconsion, Devereux et al, 98) è stato utilizzato per allineare la sequenza della matrice e la sequenza del suo complementare Il programma fa risaltare eventuali incongruenze tra le sequenze e permette una correzione Dal confronto delle due sequenze (FORWARD e REVERSE), viene creata la sequenza consensus RICERCA DI SEQUENZE Sequenze del gene NP di TSWV di isolati mondiali sono state ottenute dalla letteratura (Heinze et al ) e con ricerca in banca dati (GenBank)

31 ALLINEAMENTO DELLE SEQUENZE Le sequenze sono state allineate utilizzando il programma CLUSTAL W (Thompson et al, 99) messo a disposizione nel sito web wwwddbjnigjp/ /clustalwehtml ANALISI FILOGENETICHE Le analisi filogenetiche sono state effettuate con i programmi PAUP* (Phylogenetic Analysis Using Parsimony and Other Methods) versione (Swofford, 998) in GCG (Genetics Computer Group of the University of Winsconsion, Devereux et al 98) e MEGA (Molecular Evolutionary Genetics Anlysis), versione (Kumar et al, ) Una serie di cladogrammi basati sull algoritmo di maximum parsimony è stata calcolata con il metodo di ricerca heuristic search in PAUPSearch, da essi è stato generato un consensus tree secondo la % majority rule ed esso è stato rappresentato graficamente in PAUPDisplay Le analisi di distanza sono state effettuate in MEGA con l algoritmo Neighbour Joining (NJ) ed il modello JukesCantor Per l analisi statistica bootstrap sono state scelte ripetizioni Il cladogramma ottenuto in PAUP* è stato confrontato con il filogramma ottenuto con MEGA e quindi rappresentato Le biforcazioni con valore bootstrap inferiore al % (non significanti) sono state eliminate ed i rami fusi Il numero di sostituzioni sinonime e non sinonime è stato calcolato con il metodo di Nei Gojobori in MEGA Per le sequenze di 8 nucleotidi, rispettivamente aminoacidi sono state effettuate unicamente analisi di distanza in MEGA come precedentemente descritto, per mancanza di tempo

32 RISULTATI EFFICACIA DELLA RTPCR COME METODO DI DIAGNOSI DELLA PRESENZA DI TSWV TSWV è divenuto nel corso degli ultimi tre anni un importante problema nelle colture orticole ticinesi Lo scopo di questo primo esperimento era di determinare la possibilità di utilizzare la RTPCR come metodo di diagnosi della presenza di TSWV Sono stati analizzati campioni di foglia di pomodoro in cui la presenza del virus è stata precedentemente accertata, campioni provenienti da piante sane ed di acqua (controlli negativi) L RNA è stato estratto con il kit Nucleospin Multi9 Plant (MachereyNagel, Oensingen, Svizzera) e su gel è stata controllata la presenza di RNA per tutti i campioni provenienti da foglia di pomodoro (con e senza virus) La sintesi di cdna e la successiva amplificazione tramite PCR è stata eseguita con il kit Access RTPCR Introductory System (Promega, Madison, USA) Su gel sono state osservate bande (,,,,,, 8,,,,, ) di approssimativamente bp corrispondenti al gene L di TSWV unicamente per il prodotto RTPCR sintetizzato da RNA estratto da foglie di piante con TSWV La banda ottenuta per il campione è risultata molto debole Non è stata ottenuta un amplificazione nè per il prodotto RTPCR sintetizzato da RNA estratto da foglie di piante sane nè per il controllo negativo con acqua (Fig) M * 8 9* * W S S S Fig : Gel elettroforesi del prodotto RTPCR sintetizzato da RNA estratto da foglie di pomodoro di piante con presenza accertata di TSWV, da foglie di piante sane e controllo negativo con acqua,,,,,, 8,,,,, : prodotto RTPCR sintetizzato da RNA estratto da foglie di piante con TSWV *, 9*, *: prodotto RTPCR sintetizzato da RNA estratto da foglie di piante sane W: acqua (controllo negativo) M: bp ladder S, S, S: Standard,, ng DNA I risultati positivi di questo esperimento hanno dimostrato la possibilità di identificare la presenza di TSWV tramite RTPCR Si è quindi proceduto alla scelta dei metodi d estrazione dell RNA e di trascrizione inversa (sintesi di cdna e successiva amplificazione tramite PCR) più veloci, economici ed efficaci per i vari tipi di esperimento

33 EFFICACIA DEI METODI DI ESTRAZIONE DI RNA I quattro metodi di estrazione di RNA da foglia di pomodoro ed insalata utilizzati (Kit Nucleospin Multi9 Plant (MachereyNagel, Oensingen, Svizzera), RNeasy Plant Mini Kit (Qiagen, Hilden, Germania), SV Total RNA Isolation System (Promega, Madison, USA) e Jones et al, 998) sono risultati tutti ugualmente efficaci, la quantità di RNA estratto è risultata approssimativamente uguale Si è optato per il kit Nucleospin Multi9 Plant (MachereyNagel, Oensingen, Svizzera) perchè permette di svolgere contemporaneamente un elevato numero di estrazioni in tempo relativamente breve EFFICACIA DEI METODI DI SINTESI DI cdna ED AMPLIFICAZIONE TRAMITE PCR (RTPCR) I quattro metodi di sintesi di cdna ed amplificazione tramite PCR (RTPCR) hanno dato risultati diversi Il kit RTPCR Introductory System (Promega, Madison, USA) ha dato risultati ottimali per RNA estratto da foglie di pomodoro con evidenti sintomi di TSWV, mentre non ha sintetizzato DNA da RNA estratto da foglie di insalata (lattuga e lattuga foglia di quercia) con sintomi Una successiva riamplificazione specifica con primers NP del prodotto ottenuto ha mostrato su gel la presenza di più bande di grandezze diverse, lo stesso risultato è stato ottenuto con l uso di nested primers La sintesi di cdna e successiva amplificazione tramite PCR con Reverse Transcriptase AMV (Roche, Mannheim, Germania) come descritta nel protocollo annesso non ha dato risultati positivi, in alcuni casi erano presenti bande di intensità molto debole ed in altri esse erano totalmente assenti L aumento da a cicli della prima amplificazione e la successiva riamplificazione con nested primers ha permesso di ottenere bande di forte intensità, corrispondenti ad una concentrazione di più di ng di DNA per µl sia per l RNA dei singoli campioni che per i miscugli di RNA di insalata e pomodoro in assenza di sintomi (v cap ) Il kit One Step RTPCR (Qiagen, Hilden, Germania) ha dato risultati positivi mentre l efficacia del kit RobustII RTPCR (Finnzymes, Espoo, Finlandia) non è risultata soddisfacente per RNA estratto da foglie di pomodoro con sintomi di TSWV Per l analisi di diagnosi precoce da lattuga e pomodoro è stato scelto il metodo con Reverse Transcriptase AMV (Roche, Mannheim, Germania) con cicli di amplificazione e successiva riamplificazione ( cicli) con nested primers DIAGNOSI PRECOCE ED EPIDEMIOLOGIA Le analisi di diagnosi precoce su lattuga e pomodoro sono state svolte allo scopo di determinare se attraverso RTPCR è possibile diagnosticare infezioni latenti di TSWV (senza presenza di sintomi) Dapprima sono stati analizzati i campioni dell ultimo prelievo per determinare se TSWV fosse presente in piante senza sintomi Per le piante positive è stato analizzato il campione del prelievo precedente, risalendo fino a ritrovare campioni privi di TSWV 8

34 LATTUGA campioni di foglia di lattuga sono stati prelevati ad intervalli settimanali dalle stesse piante dal marzo al aprile (in totale prelievi) presso l azienda Giorgi a Stabio in un tunnel fortemente colpito nella stagione RNA è stato estratto da 8 campioni di foglia di lattuga provenienti dall ultimo prelievo Allo scopo di ridurre il numero di reazioni, RNA estratto dai singoli campioni è stato mescolato per riga (bulk AH) e per colonna (bulk ), ottenendo miscugli Ai bulk A ed è stato aggiunto RNA estratto da lattuga foglia di quercia (BREFQ) in cui la presenza di TSWV è stata precedentemente accertata ottenendo i miscugli di controllo positivi (CA e C) Acqua (W) è stata utilizzata come controllo negativo La sintesi di cdna è stata eseguita utilizzando Reverse Transcriptase AMV (Roche, Mannheim, Germania), oltre ai bulk ed ai miscugli di controllo sono stati trascritti ed amplificati singolarmente RNA estratto da lattuga (L, BRELE) e due provenienti da lattuga foglia di quercia (FQ, BREFQ) come controlli positivi singoli Per 9 dei bulk (A, C, F, G,,,, e ), per i miscugli di controllo (CA e C) e per i controlli positivi singoli (L, FQ) è stata ottenuta su gel una banda di bp corrispondente a parte del gene NP di TSWV (Fig ) M A B C D E F G H CA W C L FQ FQ S S S Fig : RTPCR test di bulks di RNA estratto da foglie di lattuga senza sintomi raccolte il aprile (ultimo prelievo) presso l azienda Giorgi a Stabio M: bp ladder AH, : miscugli (bulks) CA, C: miscugli di controllo (BREFQ) L, FQ: controlli positivi singoli (BRELE, BREFQ) S, S, S: Standard,, ng DNA Dalle amplificazioni ottenute è quindi ipotizzabile la presenza di almeno un campione con TSWV in ognuno dei bulk per i quali è stata ottenuta su gel una banda (Fig ) A 9 B 8 C 9 D 8 E 9 F 8 G 9 H 8 8 Fig : Schema rappresentante in grigio i bulk contenenti almeno un campione di lattuga con TSWV In grassetto sono indicati i campioni potenzialmente infetti, in bianco i bulks ed i campioni in cui la presenza di TSWV non è stata riscontrata 9

35 Al fine di determinare il numero esatto di piante con TSWV, si è proceduto all analisi dei campioni potenzialmente infetti (,,,, 9,,,,, 9,,,,,,,,, e, indicati in grassetto nella figura ) Questa analisi ha permesso di determinare che di essi (,, 9,,,,,,,,,, e ) su 8 (9,%) piante provenienti dall ultimo prelievo sono effettivamente infetti dal virus Successivamente si è proceduto al sequenziamento dei campioni allo scopo di determinare il loro aplotipo (vedi ) La loro distribuzione è rappresentata nella figura Nord Sud Fig : Rappresentazione del tunnel da cui sono stati prelevati i campioni di lattuga e distribuzione degli aplotipi : pianta di lattuga,,, e : Aplotipi di TSWV presenti in piante di lattuga senza sintomi ( : TITOD, : TITOC, : TITOG, : TITOLEI, : TILEL, : TILEM, vedi ) Per mancanza di tempo non sono stati analizzati i campioni dei prelievi precedenti il sesto POMODORO 8 campioni di foglia di pomodoro sono stati prelevati ad intervalli settimanali dal al maggio (in totale prelievi) presso l azienda Giorgi a Stabio nel tunnel fortemente colpito nel dal quale sono stati prelevati i campioni di lattuga (cap ) Per l analisi dei campioni si è proceduto come per la lattuga RNA è stato estratto dai 8 campioni di foglia di pomodoro provenienti dall ultimo prelievo Allo scopo di ridurre il numero di reazioni, RNA estratto dai singoli campioni è stato mescolato per riga (bulk AH) e per colonna (bulk ), ottenendo bulk Ai bulk RNA A ed è stato aggiunto RNA estratto da pomodoro (BEGTO) in cui la presenza di TSWV è stata precedentemente accertata ottenendo i miscugli di controllo (CA e C) Acqua (W) è stata utilizzata come controllo negativo Per dei bulk (A, B, D, G, H,, ) e per i bulk di controllo (CA e C è stata ottenuta su gel una banda di bp corrispondente a parte del gene NP di TSWV Non è stata visualizzata su gel alcuna banda per il controllo negativo con acqua (W) (Fig )

36 M A B C D E F G H CA C W S S S Fig : RTPCR test dei bulks di RNA estratto da foglie di pomodoro raccolte il maggio (ultimo prelievo) presso l azienda Giorgi a Stabio M: bp ladder AH, : bulk CA, C: miscugli con controllo positivo (BEGTO) W: controllo negativo (acqua) S, S, S: Standard,, ng DNA Dalle amplificazioni è ipotizzabile la presenza di almeno un campione con TSWV in ognuno dei bulk per i quali è stata ottenuta su gel una banda (Fig ) A 9 B 8 C 9 D 8 E 9 F 8 G 9 H 8 8 Fig : Schema rappresentante in grigio i miscugli contenenti almeno un campione di pomodoro con TSWV In grassetto sono indicati i campioni potenzialmente infetti, in bianco in bianco i bulks ed i campioni in cui la presenza di TSWV non è stata riscontrata RNA estratto dai campioni,,, 9,,,,, e 8 è stato retrotrascritto ed amplificato singolarmente Attraverso l analisi su gel del prodotto RTPCR ottenuto è stata visualizzata una banda di bp, corrispondente a parte del gene NP di TSWV per i campioni 9,, e, indicando che queste piante sono infette da TSWV Sorprendentemente nessuno dei campioni,, e, presenti nei bulk B e D (indicati come bulks contenenti almeno un campione potenzialmente infetto) è risultato positivo Per verificare l efficacia del metodo sono quindi stati successivamente amplificati singolarmente i campioni presenti nelle righe B e D Non è stata ottenuta nessuna banda per i campioni,, 8,, e della riga B, mentre i campioni, e di D hanno mostrato su gel una banda corrispondente a parte del gene NP Il segnale ottenuto per il campione è risultato molto debole Successivamente si è proceduto al sequenziamneto dei campioni allo scopo di determinare il loro aplotipo (vedi ) La distribuzione delle piante infette è rappresentata nella figura

Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi

Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi Identificazione di Tomato Spotted Wilt Virus (TSWV) in potenziali piante ospiti e variabilità genetica degli isolati ticinesi Lavoro di diploma Caterina Matasci Febbraio Giugno Swiss Federal Institute

Dettagli

Studio dello svernamento di Tomato Spotted Wilt Virus (TSWV) e della sua incidenza su diverse colture orticole in una serra del Canton Ticino

Studio dello svernamento di Tomato Spotted Wilt Virus (TSWV) e della sua incidenza su diverse colture orticole in una serra del Canton Ticino Studio dello svernamento di Tomato Spotted Wilt Virus (TSWV) e della sua incidenza su diverse colture orticole in una serra del Canton Ticino Lavoro di diploma Dafne Gianettoni Novembre 2002 Aprile 2003

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

VALUTAZIONE DELLA BIODIVERSITÀ MICROBICA MEDIANTE L UTILIZZO DI TECNICHE MOLECOLARI

VALUTAZIONE DELLA BIODIVERSITÀ MICROBICA MEDIANTE L UTILIZZO DI TECNICHE MOLECOLARI VALUTAZIONE DELLA BIODIVERSITÀ MICROBICA MEDIANTE L UTILIZZO DI TECNICHE MOLECOLARI Laboratorio di Genetica dei Microrganismi (Responsabile attività: Prof. Giovanni Salzano; Tutor: Dr.ssa Maria Grazia

Dettagli

Polymerase chain reaction - PCR. Biotecnologie applicate all ispezione degli alimenti di origine animale

Polymerase chain reaction - PCR. Biotecnologie applicate all ispezione degli alimenti di origine animale Prof.ssa Tiziana Pepe Polymerase chain reaction - PCR Biotecnologie applicate all ispezione degli alimenti di origine animale Dip. di Medicina Veterinaria e Produzioni animali tiziana.pepe@unina.it Metodologia

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

IL PROBLEMA DELLA VIROSI DA GPGV IN VITICOLTURA. Alessandro Raiola

IL PROBLEMA DELLA VIROSI DA GPGV IN VITICOLTURA. Alessandro Raiola IL PROBLEMA DELLA VIROSI DA GPGV IN VITICOLTURA Alessandro Raiola LA SCOPERTA DI UN NUOVO VIRUS DELLA VITE 2012 GPGV: Grapevine pinot gris virus Il GPGV, Virus del Pinot Grigio, è stato identificato per

Dettagli

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,

Dettagli

Marcatori molecolari

Marcatori molecolari Marcatori molecolari Caratteristiche e applicazioni Luca Gianfranceschi e Rosanna Marino 1 I marcatori molecolari Strumento per l analisi genetica Strumento Molecolari Analisi genetica Marcatori non oggetto

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza. O.G.M. Vegetali

Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza. O.G.M. Vegetali Progetto :TRIFOGLIO UNIVERSITA CATTOLICA DEL SACRO CUORE Piacenza O.G.M. Vegetali Identificazione di un O.G.M. e metodi di analisi del DNA transgenico Marco Nani 5BL Liceo Scientifico Mattei di Fiorenzuola

Dettagli

USO DEI MARCATORI MOLECOLARI A DNA PER LA TRACCIABILITÀ DEI VITIGNI NEI VINI

USO DEI MARCATORI MOLECOLARI A DNA PER LA TRACCIABILITÀ DEI VITIGNI NEI VINI USO DEI MARCATORI MOLECOLARI A DNA PER LA TRACCIABILITÀ DEI VITIGNI NEI VINI CLAUDIO D ONOFRIO*, FABIOLA MATESE*, ELEONORA DUCCI E GIUSEPPE CELANO *UNIVERSITÀ DI PISA, DIPARTIMENTO DI SCIENZE AGRARIE,

Dettagli

TASSONOMIA O SISTEMATICA

TASSONOMIA O SISTEMATICA TASSONOMIA O SISTEMATICA È la branca della batteriologia responsabile della caratterizzazione degli organismi ed organizzazione in gruppi affini (TAXA). NOMENCLATURA CLASSIFICAZIONE IDENTIFICAZIONE taxon

Dettagli

A COSA SERVE il CLONAGGIO del DNA?? COME FUNZIONA il CLONAGGIO del DNA? COME FUNZIONA il CLONAGGIO del DNA?

A COSA SERVE il CLONAGGIO del DNA?? COME FUNZIONA il CLONAGGIO del DNA? COME FUNZIONA il CLONAGGIO del DNA? A COSA SERVE il CLONAGGIO del DNA?? CREARE COPIE IDENTICHE (= CLONI) DI UN FRAMMENTO DI DNA DIFFERENZE con la PCR: è una reazione in vivo sfrutta l apparato di replicazione del DNA della cellula ospite

Dettagli

Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8

Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8 Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8 Piccolo test: trova al differenza Gel 2 Gel 1 Gel 1. digestione DNA genomico Gel 2. Digestione inserto cloni genomici BANCHE DI DNA RICOMBINANTE

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

Le malattie virali economicamente rilevanti per la qualità dell orticoltura protetta della Sicilia

Le malattie virali economicamente rilevanti per la qualità dell orticoltura protetta della Sicilia Convegno: Strategie per il Miglioramento dell Orticoltura Protetta in Sicilia - Vittoria (RG), 25-26 Novembre 2005 Le malattie virali economicamente rilevanti per la qualità dell orticoltura protetta della

Dettagli

Importanza della genetica dei microrganismi

Importanza della genetica dei microrganismi Importanza della genetica dei microrganismi 1.I microrganismi rappresentano un mezzo essenziale per comprendere la genetica di tutti gli organismi. 2.Vengono usati per isolare e duplicare specifici geni

Dettagli

La GENETICA DELLE POPOLAZIONI. studia con modelli matematici, a livello di gruppi di individui, variabilità genetica

La GENETICA DELLE POPOLAZIONI. studia con modelli matematici, a livello di gruppi di individui, variabilità genetica La GENETICA DELLE POPOLAZIONI studia con modelli matematici, a livello di gruppi di individui, la variabilità genetica che è l unico tipo di variabilità rilevante per l evoluzione La variabilità genetica

Dettagli

Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva.

Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva. OBIETTIVO DEL LAVORO SPERIMENTALE: TIPIZZAZIONE DEI CROMOSOMI SESSUALI X e Y Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva. Cromosoma X Cromosoma y La tipizzazione

Dettagli

I nematodi a cisti della patata. Alba Cotroneo

I nematodi a cisti della patata. Alba Cotroneo I nematodi a cisti della patata Alba Cotroneo Globodera spp È uno dei principali parassiti delle regioni temperate e fredde Larva STORIA G. rostochiensis e G. pallida sono originari delle montagne andine;

Dettagli

Laboratorio di Microbiologia Referente: Prof. Carla Vignaroli. I nostri inquilini invisibili

Laboratorio di Microbiologia Referente: Prof. Carla Vignaroli. I nostri inquilini invisibili Laboratorio di Microbiologia Referente: Prof. Carla Vignaroli I nostri inquilini invisibili Viviamo quotidianamente in compagnia di una moltitudine invisibile di microrganismi, che si trova nell ambiente

Dettagli

16 11 Virus e viroidi 45%

16 11 Virus e viroidi 45% Le avversità del pomodoro sono circa 200 16 11 Virus e viroidi 45% 45 Funghi 28% 28 Abiotiche 16% Batteri e fitoplasmi 11% Assieme a nematodi e fitofagi, le malattie del pomodoro portano a perdite produttive

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Corso STEM Il papilloma virus (Prof.ssa Gabriella Di Cola)

Corso STEM Il papilloma virus (Prof.ssa Gabriella Di Cola) Corso STEM Il papilloma virus (Prof.ssa Gabriella Di Cola) Il papilloma virus (HPV) interessa maggiormente le donne intorno ai 25 anni di età; esso intacca la zona genitale, in particolare le cellule dell

Dettagli

Virus influenzali: caratteristiche

Virus influenzali: caratteristiche I VIRUS INFLUENZALI FRA EPIDEMIE E PANDEMIE Prof. Alessandro Zanetti Napoli, 15 ottobre 2009 Virus influenzali: caratteristiche Emoagglutinina (HA) Famiglia: Orthomyxoviridae Neuroaminidasi (NA) Canale

Dettagli

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi GENOMA EVOLUZIONE CONTENUTO FUNZIONE STRUTTURA Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine Progetti genoma in centinaia di organismi Importante la sintenia tra i genomi The

Dettagli

Incontro tecnico la frutticoltura: PSA-Batteriosi dell actinidia: sintomi, diagnosi e situazione in provincia di Brescia Martedì 17 Dicembre 2013

Incontro tecnico la frutticoltura: PSA-Batteriosi dell actinidia: sintomi, diagnosi e situazione in provincia di Brescia Martedì 17 Dicembre 2013 Incontro tecnico la frutticoltura: PSA-Batteriosi dell actinidia: sintomi, diagnosi e situazione in provincia di Brescia Martedì 17 Dicembre 2013 Francesca Gaffuri-Laboratorio Fitopatologico Regione Lombardia-

Dettagli

Il virus del mosaico del pepino su pomodoro in Svizzera. Olivier Schumpp

Il virus del mosaico del pepino su pomodoro in Svizzera. Olivier Schumpp Il virus del mosaico del pepino su pomodoro in Svizzera Struttura della presentazione 1. Epidemiologia & diagnostica 2. Metodi diagnostici 3. Situazione del PepMV in Svizzera 4. La protezione incrociata

Dettagli

Capitolo 8. Turismo Comune di Lecce - Ufficio Statistica di Lecce - Ufficio Statistica 127

Capitolo 8. Turismo Comune di Lecce - Ufficio Statistica di Lecce - Ufficio Statistica 127 Capitolo 8. Turismo Comune di Lecce - Ufficio Statistica 127 8. Turismo L'analisi delle strutture ricettive e del loro utilizzo evidenzia che nel 2008 nella categoria esercizi alberghieri gli alberghi

Dettagli

TAVOLA MOVIMENTO CLIENTI NEGLI ESERCIZI RICETTIVI PER PAESE DI RESIDENZA, CATEGORIE E TIPOLOGIE DI ESERCIZI Anno 2015

TAVOLA MOVIMENTO CLIENTI NEGLI ESERCIZI RICETTIVI PER PAESE DI RESIDENZA, CATEGORIE E TIPOLOGIE DI ESERCIZI Anno 2015 Esercizi Alberghieri Alberghi 1 stella Alberghi 2 stelle Alberghi 3 stelle e 3 stelle sup. Alberghi 4, 4 sup. e 5 stelle Residenze Turistico Alberghiere Alberghieri ITALIA 92,2 97,8 93,1 56,7 130,8 86,5

Dettagli

Credito ai Consumatori in Europa a fine 2012

Credito ai Consumatori in Europa a fine 2012 Credito ai Consumatori in Europa a fine 2012 Introduzione Crédit Agricole Consumer Finance ha pubblicato, per il sesto anno consecutivo, la propria ricerca annuale sul mercato del credito ai consumatori

Dettagli

NUOVE VIROSI DEL POMODORO

NUOVE VIROSI DEL POMODORO NUOVE VIROSI DEL POMODORO Monitoraggio e uso sostenibile dei prodotti fitosanitari: le attività del servizio fitosanitario, 29 Maggio 2014 Andrea Taddei e Francesca Gaffuri Servizio fitosanitario regionale

Dettagli

Applicazione della biologia molecolare nella valutazione del benessere del cavallo

Applicazione della biologia molecolare nella valutazione del benessere del cavallo UNIVERSITA DEGLI STUDI DI PERUGIA FACOLTA DI MEDICINA VETERINARIA Centro di Studio del Cavallo Sportivo Applicazione della biologia molecolare nella valutazione del benessere del cavallo Andrea Verini

Dettagli

TRIESTE TURISTICA I NUMERI DELLA CRESCITA

TRIESTE TURISTICA I NUMERI DELLA CRESCITA COMUNE DI TRIESTE AREA SVILUPPO ECONOMICO E TURISMO DIREZIONE ATTIVITA PROMOZIONE TURISTICA TRIESTE TURISTICA I NUMERI DELLA CRESCITA luglio 2009 Anno ARRIVI DI TURISTI variazione su anno precedente ARRIVI

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

VIROSI DEL PEPERONE E DEL POMODORO

VIROSI DEL PEPERONE E DEL POMODORO VIROSI DEL PEPERONE E DEL POMODORO I virus che più comunemente colpiscono queste colture, e che negli ultimi anni hanno causato gravi perdite di prodotto commerciale, sono il virus del mosaico del cetriolo

Dettagli

REGIONI TOTALE ITALIANI TOTALE GENERALE

REGIONI TOTALE ITALIANI TOTALE GENERALE AZIENDA AUTONOMA U.O.B. -STATISTICA E GESTIONE DEL PORTALE GENNAIO 2005 GENNAIO 2006 DIFFERENZA FEBBRAIO 2005 FEBBRAIO 2006 DIFFERENZA MARZO 2005 MARZO 2006 DIFFERENZA Esercizi 16 Esercizi 19 Esercizi

Dettagli

Blue Tongue situazione epidemiologica in Italia e aspetti normativi. Treviso 30 aprile 2008

Blue Tongue situazione epidemiologica in Italia e aspetti normativi. Treviso 30 aprile 2008 Blue Tongue situazione epidemiologica in Italia e aspetti normativi Treviso 30 aprile 2008 Situazione epidemiologica Analisi del rischio introduzione e circolazione 1 Flussi animali da zone a rischio Consistenza

Dettagli

EVOLUZIONE MOLECOLARE. Silvia Fuselli

EVOLUZIONE MOLECOLARE. Silvia Fuselli EVOLUZIONE MOLECOLARE Silvia Fuselli silvia.fuselli@unife.it TESTI Organizzazione del corso Graur and Li, Fundamentals of molecular evolution, Sinauer 2000 Michael Lynch, The Origins of Genome Architecture,

Dettagli

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione La mappatura dei geni umani SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione Un grande impulso alla costruzione di mappe genetiche è stato dato da le tecniche della

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

L emergenza virosi nelle coltivazioni intensive

L emergenza virosi nelle coltivazioni intensive Centro di ricerca per la Patologia Vegetale - Roma L emergenza virosi nelle coltivazioni intensive Marina Barba CREA-PAV A. Ciufalo, B. Giuliano, F. Miracolo Rete Agronomica Anicav Il filo rosso del pomodoro

Dettagli

21 Forum Medicina Vegetale. BOTANIGARD SE : nuova formulazione ed efficacia insetticida

21 Forum Medicina Vegetale. BOTANIGARD SE : nuova formulazione ed efficacia insetticida 21 Forum Medicina Vegetale BOTANIGARD SE : nuova formulazione ed efficacia insetticida Bari, 3 dicembre 2009 Insetticida biologico per la difesa delle colture orticole ed ornamentali in serra COMPOSIZIONE

Dettagli

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DEL COMELICO SAPPADA: ANNI

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DEL COMELICO SAPPADA: ANNI I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DEL COMELICO SAPPADA: ANNI 2005-2015 Premessa In queste pagine viene presentato l'approfondimento per comprensorio turistico della precedente

Dettagli

Differenti tipi di PCR

Differenti tipi di PCR Differenti tipi di PCR Colony PCR Nested PCR Multiplex PCR AFLP PCR Hot start PCR In situ PCR Inverse PCR Asymmetric PCR Long PCR Long accurate PCR Reverse transcriptase PCR Allele Specific PCR Real time

Dettagli

indicazioni epidemiologiche Legno Nero della vite: Francesco Pavan Attualità sanitarie in viticoltura: il Legno Nero Oristano, 21 novembre 2008

indicazioni epidemiologiche Legno Nero della vite: Francesco Pavan Attualità sanitarie in viticoltura: il Legno Nero Oristano, 21 novembre 2008 Attualità sanitarie in viticoltura: il Legno Nero Oristano, 21 novembre 2008 Legno Nero della vite: indicazioni epidemiologiche Francesco Pavan Dipartimento di Biologia e Protezione delle Piante Università

Dettagli

Notiziario su prospettive e congiuntura dell economia italiana

Notiziario su prospettive e congiuntura dell economia italiana Ufficio di supporto agli organi collegiali Notiziario su prospettive e congiuntura dell economia italiana L Italia in confronto con i paesi dell OCSE Ufficio di supporto agli organi collegiali Notiziario

Dettagli

Università degli Studi di Sassari Dipartimento di Protezione delle Piante, Sez. Entomologia Agraria Osservazioni sulla dinamica di popolazione di Tuta absoluta ed esperienze di controllo in Sardegna DELRIO

Dettagli

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CADORE AURONZO MISURINA: ANNI

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CADORE AURONZO MISURINA: ANNI I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CADORE AURONZO MISURINA: ANNI 2005-2015 Premessa In queste pagine viene presentato l'approfondimento per comprensorio turistico della

Dettagli

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Basi biologiche delle malattie Genetica delle neoplasie Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Samantha Messina 2017 GENETICA DELLE NEOPLASIE Ciclo - alterazione dei meccanismi

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

Vettori derivati dal fago λ: batteriofagi filamentosi M13

Vettori derivati dal fago λ: batteriofagi filamentosi M13 Vettori derivati dal fago λ: batteriofagi filamentosi M13 A. Phage display: esibizione della proteina clonata in M13 ed esposta sulla superficie del batteriofago (facile screening dei ricombinanti) mediante

Dettagli

Il turismo nella Provincia di Forlì-Cesena - Anno 2014

Il turismo nella Provincia di Forlì-Cesena - Anno 2014 Il turismo nella Provincia di Forlì-Cesena - Anno 2014 Assessorato al Turismo della Provincia di Forlì-Cesena CAPACITÀ RICETTIVA 2014 Complessivamente 2.807 strutture ricettive con un offerta di 70.458

Dettagli

Alberi filogenetici. File: alberi_filogenetici.odp. Riccardo Percudani 02/03/04

Alberi filogenetici. File: alberi_filogenetici.odp. Riccardo Percudani 02/03/04 Alberi filogenetici The tree of life Albero filogenetico costruito con le sequenze della subunità piccola dell RNA ribosomale. Tutte le forme viventi condividono un comune ancestore (LCA, last common ancestor

Dettagli

METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI

METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI SPETTRI UV E QUANTIZZAZIONE SPETTROFOTOMETRICA DEGLI ACIDI NUCLEICI FIGURA 7.6A METODOLOGIA BIOCHIMICA (WILSON) a a = a 1 Assorbimento = a b a 1 b FIGURA

Dettagli

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010 Le biotecnologie 1 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi viventi o da loro derivati.

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

lezione giovedì 8 aprile 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM)

lezione giovedì 8 aprile 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) lezione 17-18 giovedì 8 aprile 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) il prodotto di PCR è sempre a lineare b solo al primo ciclo il templato è solo

Dettagli

Tecnologia del DNA e la genomica

Tecnologia del DNA e la genomica Tecnologia del DNA e la genomica DNA ricombinante La tecnologia del DNA ricombinante permette di unire in laboratorio il DNA di organismi diversi Permette di manipolare il DNA di un organismo allo scopo

Dettagli

Caratteristiche prestazionali

Caratteristiche prestazionali Caratteristiche prestazionali Kit RNeasy DSP FFPE, Versione 1 73604 Gestione della versione Il presente è il documento Caratteristiche prestazionali del kit RNeasy DSP FFPE, Versione 1, R1. Prima di eseguire

Dettagli

Industria alberghiera e altre infrastrutture. Alberghi, garni, motel, ristoranti con alloggio. Case e appartamenti di vacanza, camere private.

Industria alberghiera e altre infrastrutture. Alberghi, garni, motel, ristoranti con alloggio. Case e appartamenti di vacanza, camere private. Industria alberghiera e altre infrastrutture. Pernottamenti Fonte TS 1'437'572 1'479'520 41'948 9'876'721 10'050'118 173'397 1.8 5'153'159 5'476'068 322'909 6.3 837'375 849'994 12'619 1.5 17'304'827 17'855'700

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo GENOMA di alcuni organismi viventi raffigurato come libri

Dettagli

Informazioni Statistiche

Informazioni Statistiche Informazioni Statistiche Settore Sistema Informativo di supporto alle decisioni. Ufficio Regionale di Statistica Maggio 20 L'utilizzo del Cloud Computing nelle imprese con almeno 10 addetti L Istat realizza

Dettagli

04_biochimica. MFN0366-A1 (I. Perroteau) - Tecniche biochimiche-molecolari: Western blot

04_biochimica. MFN0366-A1 (I. Perroteau) - Tecniche biochimiche-molecolari: Western blot 1 2 1 - Gel di elettroforesi Trasferimento (blotting) + Membrana per western blot 3 4 2 Anticorpo primario ---> anticorpo secondario coniugato all enzima ---> reazione di biolimunescenza ---> luce che

Dettagli

Biotecnologie. Screening delle genoteche con le sonde geniche

Biotecnologie. Screening delle genoteche con le sonde geniche Biotecnologie Screening delle genoteche con le sonde geniche Giancarlo Dessì http://www.giand.it Licenza Creative Commons BY-NC-SA (BY: attribuzione, NC: uso non commerciale, SA: condividi allo stesso

Dettagli

Fitoplasmi e fitoplasmosi

Fitoplasmi e fitoplasmosi Fitoplasmi e fitoplasmosi Ripresa vegetativa anticipata Scopazzi Malformazioni al frutto Sintomi causati da fitoplasmi Fillomania Virescenza Ingrossamento stipole FITOPLASMI IN CELLULE DEL FLOEMA AL TEM

Dettagli

Piverone, Ruolo di Scaphoideus titanus nell epidemiologia della Flavescenza dorata

Piverone, Ruolo di Scaphoideus titanus nell epidemiologia della Flavescenza dorata Piverone, 28-01-2017 Ruolo di Scaphoideus titanus nell epidemiologia della Flavescenza dorata Scaphoideus titanus Ball (Hemiptera: Cicadellidae) Specie originaria dell areale neartico (USA e Canada), diffusa

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CORTINA D'AMPEZZO: ANNI

I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CORTINA D'AMPEZZO: ANNI Premessa I FLUSSI TURISTICI DELL' ALBERGHIERO NEL COMPRENSORIO TURISTICO DI CORTINA D'AMPEZZO: ANNI 2005-2015 In queste pagine viene presentato l'approfondimento per comprensorio turistico della precedente

Dettagli

Analisi degli alimenti tramite PCR Real-Time. Introduzione ad una tecnologia all'avanguardia

Analisi degli alimenti tramite PCR Real-Time. Introduzione ad una tecnologia all'avanguardia Analisi degli alimenti tramite PCR Real-Time Introduzione ad una tecnologia all'avanguardia Obiettivi Questa presentazione tratterà i seguenti argomenti: Quali sono le applicazioni della PCR Real-time?

Dettagli

IAT SIRMIONE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT SIRMIONE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 9.993 226.892 136.283 465.751

Dettagli

Corso di Bioinformatica. Docente: Dr. Antinisca DI MARCO

Corso di Bioinformatica. Docente: Dr. Antinisca DI MARCO Corso di Bioinformatica Docente: Dr. Antinisca DI MARCO Email: antinisca.dimarco@univaq.it Analisi Filogenetica Gene Ancestrale duplicazione genica La filogenesi è lo studio delle relazioni evolutive tra

Dettagli

TRASFORMAZIONE GENETICA DI SPINACIO (SPINACIA OLERACEA L.) MEDIATA DA AGROBACTERIUM TUMEFACIENS

TRASFORMAZIONE GENETICA DI SPINACIO (SPINACIA OLERACEA L.) MEDIATA DA AGROBACTERIUM TUMEFACIENS LABORATORIO DI BIOTECNOLOGIE VEGETALI (Prof. Alma Balestrazzi) TRASFORMAZIONE GENETICA DI SPINACIO (SPINACIA OLERACEA L.) MEDIATA DA AGROBACTERIUM TUMEFACIENS CHE COSA SONO LE PIANTE TRANSGENICHE? Le piante

Dettagli

DGGE/TTGE. Le differenze nel punto di denaturazione, chimica o termica, dipendono dalla sequenza nucleotidica

DGGE/TTGE. Le differenze nel punto di denaturazione, chimica o termica, dipendono dalla sequenza nucleotidica DGGE/TTGE Lungo gradiente di sostanze denaturanti (es. Urea) - DGGE Separazione degli amplimeri con elettroforesi Lungo gradiente temporale di temperatura (TTGE) Le differenze nel punto di denaturazione,

Dettagli

PROGRAMMAZIONE DI GEOGRAFIA CLASSE SECONDA A.S

PROGRAMMAZIONE DI GEOGRAFIA CLASSE SECONDA A.S 1. L EUROPA E L UNIONE EUROPEA: la formazione dell Europa, la società europea, l unione europea (vol. I) 2. L EUROPA FISICA E POLITICA IN GENERALE (ripasso) 2. L EUROPA MEDITERRANEA: Spagna, Andorra, Principato

Dettagli

Elementi di genetica forense

Elementi di genetica forense www.aifo-italia.it Elementi di genetica forense Dr.ssa Sandra von Borries Dove si trova il DNA? Ogni organismo vivente è costituito da cellule. Ogni cellula presenta un NUCLEO. All interno del nucleo si

Dettagli

IAT EDOLO FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT EDOLO FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 3.75 8.669 1.111 1.597 4.186

Dettagli

IAT DARFO BOARIO TERME FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT DARFO BOARIO TERME FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 29.668 112.816 4.581 27.373

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

IMPATTO DELLA PHTHORIMEA OPERCULELLA SULLA COLTURA DELLA PATATA

IMPATTO DELLA PHTHORIMEA OPERCULELLA SULLA COLTURA DELLA PATATA IMPATTO DELLA PHTHORIMEA OPERCULELLA SULLA COLTURA DELLA PATATA BOLOGNA 22-10- 2013 Dr. D. D Ascenzo Servizio Fitosanitario Abruzzo Per poter inquadrare correttamente la problematica della tignola è importante

Dettagli

Parla Facile 14,90 tariffe in vigore dal 01/12/2012. Sezione 1 - Costo complessivo di una chiamata (Valori in cent, IVA inclusa) Fonia vocale Locale

Parla Facile 14,90 tariffe in vigore dal 01/12/2012. Sezione 1 - Costo complessivo di una chiamata (Valori in cent, IVA inclusa) Fonia vocale Locale Parla Facile 14,90 tariffe in vigore dal 01/12/2012 Sezione 1 - Costo complessivo di una chiamata (Valori in cent, IVA inclusa) Fonia vocale Locale Nazionale Verso mobile - TIM Verso mobile - VODAFONE

Dettagli

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione

Dettagli

Microbiologia clinica

Microbiologia clinica Microbiologia clinica Docente : Prof. Ubaldo Scardellato Testo: MICROBIOLOGIA CLINICA Eudes Lanciotti Cea ed. 2001 Temi cardine del programma 1. Lo sviluppo della microbiologia come scienza. 2. La natura

Dettagli

Introduzione Generalità sul poliomavirus JC Il poliomavirus umano JC (JCV) è un virus a DNA a lenta evoluzione appartenente alla famiglia

Introduzione Generalità sul poliomavirus JC Il poliomavirus umano JC (JCV) è un virus a DNA a lenta evoluzione appartenente alla famiglia Introduzione Generalità sul poliomavirus JC Il poliomavirus umano JC (JCV) è un virus a DNA a lenta evoluzione appartenente alla famiglia Polyomaviridae. Esso possiede un genoma formato da una molecola

Dettagli

IAT GARDONE RIVIERA FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT GARDONE RIVIERA FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 12.315 28.567 37.352 16.61

Dettagli

IAT PONTE DI LEGNO FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE

IAT PONTE DI LEGNO FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE FLUSSO TURISTICO DATI COMPARATI ANNO PRECEDENTE ESERCIZI ALBERGHIERI PERIODO I T A L I A N I S T R A N I E R I T O T A L E arrivi presenze arrivi presenze arrivi presenze 213 31.457 137.146 2.98 114.433

Dettagli

laboratorio biotecnologie zootecniche BAA/LM 3CFU

laboratorio biotecnologie zootecniche BAA/LM 3CFU laboratorio biotecnologie zootecniche BAA/LM 3CFU Calendario accademico Inizio delle Lezioni: 6 Marzo 2012 Fine delle Lezioni : 5 Giugno 2012 Inizio vacanze di Pasqua: 6 Aprile Fine vacanze di Pasqua:

Dettagli

I risultati di PISA 2006 Un primo sguardo d insieme. 4 Dicembre 2007

I risultati di PISA 2006 Un primo sguardo d insieme. 4 Dicembre 2007 I risultati di PISA 2006 Un primo sguardo d insieme 4 Dicembre 2007 Risultati di PISA 2006 Presentazione del rapporto internazionale OCSE, Parigi Prima presentazione dei risultati italiani rapporto nazionale:

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

Definizione materiale genetico racchiuso da un involucro proteico o lipoproteico parassita sub-cellulare macchinario biosintetico

Definizione materiale genetico racchiuso da un involucro proteico o lipoproteico parassita sub-cellulare macchinario biosintetico Definizione 1) Un virus è un insieme di materiale genetico racchiuso da un involucro proteico o lipoproteico, che può organizzare la sua stessa replicazione solo all interno di una cellula ospite (parassita

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori

Dettagli

Classificazione dei virus

Classificazione dei virus Classificazione dei virus Criteri di classificazione International Committee on Taxonomy of Viruses Ospiti: animali, piante, batteri. Natura dell acido nucleico nel virione : RNA o DNA Simmetria del capside:

Dettagli

INDICE. - Sintesi - Grafici

INDICE. - Sintesi - Grafici Statistica INDICE - Sintesi - Grafici Tav. 1 - Strutture ricettive e posti letto al 31.12.2013. Comune di Pordenone Tav. 2 - Arrivi e presenze negli esercizi alberghieri e complementari. 2008-2013 Tav.

Dettagli

artus EBV QS-RGQ Kit Prestazioni caratteristiche Maggio 2012 Sample & Assay Technologies Sensibilità analitica plasma

artus EBV QS-RGQ Kit Prestazioni caratteristiche Maggio 2012 Sample & Assay Technologies Sensibilità analitica plasma artus EBV QS-RGQ Kit Prestazioni caratteristiche artus EBV QS-RGQ Kit, Version 1, 4501363 Check availability of new electronic labeling revisions at www.qiagen.com/products/artusebvpcrkitce.aspx before

Dettagli

Research Collection. Studio sul dosaggio delle sostanze amare nelle droghe vegetali. Doctoral Thesis. ETH Library. Author(s): Biaggini, Francesco

Research Collection. Studio sul dosaggio delle sostanze amare nelle droghe vegetali. Doctoral Thesis. ETH Library. Author(s): Biaggini, Francesco Research Collection Doctoral Thesis Studio sul dosaggio delle sostanze amare nelle droghe vegetali Author(s): Biaggini, Francesco Publication Date: 1957 Permanent Link: https://doi.org/10.3929/ethz-a-000113908

Dettagli

Statistica sulla domanda di turismo in Ticino NOVEMBRE 2011

Statistica sulla domanda di turismo in Ticino NOVEMBRE 2011 Statistica sulla domanda di turismo in Ticino NOVEMBRE 2011 LUGANO, 16.01.2012 Ticino, ancora in calo la domanda di turismo nel mese di novembre. Le statistiche provvisorie fornite dall Ufficio federale

Dettagli

Modello per la struttura (presunta) di un RNA viroide: le lineette interne indicano i legami tra le basi complementari

Modello per la struttura (presunta) di un RNA viroide: le lineette interne indicano i legami tra le basi complementari Viroidi Agenti infettivi costituiti da una sola molecola di RNA circolare a singolo filamento (+ o -), ripiegato a formare regioni a doppia elica, prive di capside, sensibili a RNasi Aree a doppia elica

Dettagli

La cimice asiatica, una nuova avversità del pero:

La cimice asiatica, una nuova avversità del pero: La cimice asiatica, una nuova avversità del pero: le strategie di difesa Massimo Bariselli Servizio Fitosanitario Emilia-Romagna UniMoRe Consorzio Fitosanitario Mo e Re Inquadramento della specie Emittero

Dettagli