Genomi dei procarioti

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Genomi dei procarioti"


1 Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici

2 Il genoma eucariotico Il genoma eucariotico si trova nel nucleo Singole molecole lineari di DNA organizzate in cromosomi. I geni vengono trascritti in molecole di RNA messaggero (mrna ) monocistronici (1 molecola di mrna codifica per 1 proteina) I geni rappresentano solo 2% di tutto il DNA umano; cio significa che 98% del genoma umano e non codificante

3 Genoma umano Singole molecole lineari di DNA 22 autosomi presenti in duplice copia (genoma diploide) 2 cromosomi sessuali X Y maschio; X X femmina Per un totale di 46 cromosomi 6 x 10 9 coppie di basi Viene trascritto in mrna monocistronici

4 Le molecole di DNA eucariotiche sono altamente compattate nei cromosomi Cariotipo umano 22 autosomi 2 cromosomi sessuali Totale di 46 cromosomi



7 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright





12 Figure 5.1b

13 Sequenziamento con metodo Sanger Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

14 Sequenziamento massivo parallelo (next generation sequencing, NGS) Sequenziamento parallelo Assemblaggio Frammentazione random

15 I genomi di molte specie (compreso uomo e topo) sono interamente sequenziati e disponibili sul web. Strategia di sequenziamento Frammentazione In piccoli segmenti Parzialmente sovrapposti Sequenziamento dei frammenti agctct tctgaaagg aaaggctcccc..tgatgta Assemblaggio della sequenza completa agctct..tctgaaaggctccccc.tgatgta



18 Cromatina

19 -> nucleo <- citoplasma

20 I DNA genomici sono piu lunghi di vari ordini di grandezza delle cellule, organelli o particelle virali che li contengono # coppie di basi del DNA Lunghezza del DNA genomico Virus T nm 200 nm Diametro della particella virale o della cellula E. coli ,7 mm >1 micron Homo sapiens ~ 2 metri 7 30 micron Il DNA di tutti gli organismi deve essere compattato per stare dentro una cellula


22 Il nucleosoma è l unità minima di compattamento del DNA cromosomico


24 MNase ( P19Cl6 cells) approx. G. Fulcoli

25 Le interazioni tra il core istonico e il DNA sono mediate da molti contatti indipendenti dalla seq. nucleotidica dimero H3.H4 1) 14 siti di contatto tra l ottamero istonico e il DNA 2) >140 legami idrogeno tra gli istoni e gli atomi di ossigeno dei legami fosfodiestere à forniscono l energia per curvare il DNA 3) la natura basica degli istoni maschera la carica negativa del DNA e permette al DNA di curvare attorno al core istonico.





30 Farmaci possono essere usati per modulare le modificazioni istoniche G. Fulcoli

31 Mutazioni geniche e modificazioni istoniche G. Fulcoli

32 Il DNA batterico e altamente condensato Il DNA batterico e compattato in nucleoidi, strutture meno note rispetto alla cromatina eucariotica In E. coli, circa 500 anse di DNA lungo 10 kbp sono attacate alla superficie interna della membrana plasmatica Punti di connessione alla membrana plasmatica

33 Geni e Genomi

34 Che cosa e un gene? Unità fondamentale dell eredità genetica (codifica molecola funzionale). Un gene e costituito da sequenze codificanti (esoni) e sequenze non-codificanti (introni) I geni sono separati da regioni intrageniche contenenti elementi regolatori La dimensione dei geni e molto variabile; il gene che codifica la distrofina e lungo 2.2 x 10 6 bp; la OXT (ossitocina) 896 bp

35 Dove sono localizzati i geni nel genoma eucariotico?

36 Distribuzione piu o meno casuale con variazione della densita genica nelle diverse posizioni del cromosoma Arabidopsis (erba galletta): densita genica media di 25 geni ogni 100 kb di DNA (varia da 1 a 38). Situazione simile al genoma umano

37 Cariotipo umano colorato con il Giemsa (bande G) Giemsa: maggior affinita per il DNA ricco in A e T Bande G appaiono scure nel cariotipo perche hanno un contenuto A/T >>50% Contenuto A/T dei geni e < 50%

38 Come sono organizzati i geni nel genoma umano?

39 Un segmento contiguo da 50 kb del cromosoma 12 umano 4 Geni (25% del segmento, esoni, 9%) PKP2: codifica una proteina coinvolto nella sintesi di desmosomi SYB1: codifica una proteina di membrana FLJ10143:? funzione CD27: codifica una proteina che regola le vie di trasduzione del segnale 7 microsatelliti (<1%) brevi motivi ripetuti in tandem, CAGCAGCAG 88 sequenze ripetute intersperse (45%) che si trovano distribuite in tutto il genoma; LINE; SINE; LTR LINE: long interspersed nuclear elements SINE: short interspersed nuclear elements LTR: long terminal repeats DNA a singola copia, (30%) non-genico, nonripetitivo, senza funzione nota

40 La dimensione del genoma Misurato in numero di coppie di basi per genoma aploide (singola copia del genoma) Organismi che si riproducono sessualmente hanno un genoma diploide; due copie del genoma, una ereditata dalla madre e l altra dal padre La dimensione del genoma degli eucarioti, anche quelli piu' semplice (lievito), e' un ordine di grandezza maggiore rispetto al genoma dei batteri. Non esiste una precisa correlazione tra la complessita dell organismo e la dimensione del suo genoma

41 dimensione del genoma in varie specie 3.12 miliardi bp ~ geni

42 Organizzazione di altri genomi eucariotici Il genoma del lievito e molto compatto Nel segmento illustrato di 50 kb: 26 geni, nessun gene discontinuo (nessuno introne), poche sequenze ripetitive, regioni intrageniche piccole


44 Compattezza di tre genomi Caratteristica Lievito Moscerino della frutta Uomo Densita genica: No. geni per megabase di DNA Introni per gene 0, % genoma occupato da sequenze ripetute intersperse 3,4% 12% ~45%

45 Il DNA ripetitivo del genoma eucariotico DNA ripetuto intersperso; blocchi di sequenze che sono disperse in tutto il genoma in maniera pseudocasuale (LINE, SINE). DNA ripetuto in tandem (DNA satellite); unita ripetute localizzate una a fianco all altra (LTR, STR). DNA alfoide del centromero: Seq. lunghe 171 bp che sono ripetute dalle 1500 alle volte. DNA non-codificante. Potrebbe svolgere un ruolo strutturale, ad es. sito di legame per proteine centromero-specifico. Minisatelliti: unita ripetuta lunga fino a 25 bp, raggruppate in blocchi di lunghezza fino a 20 kb, ad es. DNA telomerico. Microsatelliti: unita ripetuta lunga 13 bp o meno, raggruppati di lunghezza fino a 150 bp, sono disperse in tutto il genoma

46 Quanti geni e quali le loro funzioni?

47 Categorie funzionali dei geni umani Le funzioni di >50% dei ~ geni umani sono note o possono essere dedotte con un ragionevole margine di sicurezza La maggior parte codifica per proteine; <10% specificano vari tipi di RNA funzionale Le tre categorie principali rappresentano le aree piu studiate della biologia cellulare I geni i cui prodotti non sono stati ancora identificati sono, con molta probabilita, coinvolti in attivita cellulari meno studiate

48 Genoma mitocondriale umano - primo genoma ad essere sequenziato - densa compattazione dei geni - geni codificano per 13 proteine e 24 RNA funzionali (22 trna; 2 rrna) - dimensione del genoma: 16,569 coppie di basi - poche sequenze regolatrici

49 L origine dei genomi degli organelli La teoria dell endosimbionte: 1) similarita nei processi di espressione genica che avvengono nei mitocondri eucariotici e nei batteri 2) sequenza nucleotidica dei geni mitocondriali e piu simile a geni equivalenti dei batteri che non ai geni nucleari eucariotici

50 RIASSUNTO I Il genoma eucariotico e suddiviso in una seria di molecole lineari di DNA, I cromosomi Il DNA e associato a proteine istoniche costituendo i nucleosomi, l unita di base della cromatina La doppia elica è avvolta intorno al nucleosoma, con andamento sinistrorso (superavvolgimento negativo) Le code N-terminali istoniche sono al cuore della regolazione dinamica della struttura cromatinica L organizzazione piu compatta della cromatina e quella dei cromosomi metafasici

51 RIASSUNTO II Il centromero, che e visibile nei cromosomi metafasici, e costituito da lunghi tratti di DNA ripetitivo noto come DNA alfoide I telomeri contengono DNA ripetitivo (minisatellite) Il 44% del genoma umano e costituito da sequenze ripetitive, distinte in seq. ripetitive intersperse e in tandem I geni non sono distribuiti uniformemente lungo i cromosomi e la densita e altamente variabile

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale


Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti


Dimensioni dei Genomi Eucariotici

Dimensioni dei Genomi Eucariotici Dimensioni dei Genomi Eucariotici plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni


Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo


Dimensioni di Genomi

Dimensioni di Genomi Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa


La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici


La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati


David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi


Mappe fisiche. Si basano sulla localizzazione fisica delle molecole di DNA

Mappe fisiche. Si basano sulla localizzazione fisica delle molecole di DNA Mappe fisiche Si basano sulla localizzazione fisica delle molecole di DNA Costruzione di una mappa fisica diversi metodi - Mappe a bassa risoluzione - Mappe ad alta risoluzione Risoluzione= distanza a





7. Gruppi genici e sequenza ripetute

7. Gruppi genici e sequenza ripetute 7. Gruppi genici e sequenza ripetute contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale La duplicazione e la delezione di


Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui


DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni


DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari


Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento


In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide.

In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. Lodish et al. Molecular Cell Biology In molecular terms,


Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule


Legami idrogeno tra le coppie di basi

Legami idrogeno tra le coppie di basi Legami idrogeno tra le coppie di basi 4 3 6 1 4 3 2 6 1 2 Interazioni elettrostatiche deboli che si stabiliscono tra un atomo elettronegativo (es.ossigeno o azoto) e un atomo di idrogeno legato ad un secondo


Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici T.A. Brown Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici Chapter 2_Genome Anatomies Copyright Garland Science 2007 Capitolo 8: Genomi


GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni






CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche


Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,


CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono


L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici


Lezione 3. Genoma umano come esempio di genoma eucariote

Lezione 3. Genoma umano come esempio di genoma eucariote Lezione 3 Genoma umano come esempio di genoma eucariote 3.2 x 10 9 bp Genoma umano 22 autosomi + xx (femmina) o xy (maschio) Primo draft di sequenza: 2001 Genotipo: sequenza di DNA, sia nucleare che mitocondriale.


Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna GENETICA GENERALE - 1 CFU Modulo Biologia Applicata e Genetica generale CORSO INTEGRATO: SCIENZE BIOLOGICHE - 7 CFU Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata



CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3


Stesso DNA ma cellule diverse

Stesso DNA ma cellule diverse Stesso DNA ma cellule diverse Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico I cromosomi sono in coppia Ogni cromosoma


Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO



TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi


Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata



IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale


Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi


DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


Importanza della genetica dei microrganismi

Importanza della genetica dei microrganismi Importanza della genetica dei microrganismi 1.I microrganismi rappresentano un mezzo essenziale per comprendere la genetica di tutti gli organismi. 2.Vengono usati per isolare e duplicare specifici geni


Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200


MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte


Base cellulare della vita

Base cellulare della vita Base cellulare della vita La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria cellulare (Schleiden e



MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino


Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli


Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante





La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle



LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica





Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze


10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo





Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione


Basi Teoriche e Applicazioni delle Nuove Tecnologie Genomiche

Basi Teoriche e Applicazioni delle Nuove Tecnologie Genomiche Corsi di laurea magistrale in: Biotecnologie agrarie e ambientali (LM-7) Biologia cellulare e molecolare (LM-6) Sicurezza e qualitàagroalimentare (LM-69 & LM-70) insegnamento di Basi Teoriche e Applicazioni


La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare


Dal gene alla proteina

Dal gene alla proteina Dal gene alla proteina Il collegamento tra geni e proteine La trascrizione e la traduzione sono i due principali processi che legano il gene alla proteina: uno sguardo panoramico Le informazioni genetiche





Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una

Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp (150.000Mbp=150Gbp) di una Liliacea. Tra le graminacee il frumento ha un genoma








Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da


= ca. 1,7 mt. 3*10 9 (devono rientrare in uno



Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo GENOMA di alcuni organismi viventi raffigurato come libri


espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso


Biologia Molecolare. CDLM in CTF La Genomica ed il Dogma Centrale della Biologia

Biologia Molecolare. CDLM in CTF La Genomica ed il Dogma Centrale della Biologia Biologia Molecolare CDLM in CTF 2010-2011 La Genomica ed il Dogma Centrale della Biologia Il Genoma I Geni Il Dogma centrale della Biologia Il genoma è l'insieme di tutte le informazioni biologiche necessarie


I genomi vegetali. Arabidopsis (genoma aploide circa 140 Mb di DNA; 2n=10 barbabietola da zucchero (750 Mb; 2n=18) pino (23000 Mb; 2n=24)

I genomi vegetali. Arabidopsis (genoma aploide circa 140 Mb di DNA; 2n=10 barbabietola da zucchero (750 Mb; 2n=18) pino (23000 Mb; 2n=24) I genomi vegetali A. thaliana barbabietola pino Arabidopsis (genoma aploide circa 140 Mb di DNA; 2n=10 barbabietola da zucchero (750 Mb; 2n=18) pino (23000 Mb; 2n=24) Tre specie diploidi, le differenze


La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)


5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 5. NUCLEOSOMI contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle



IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi


LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si


Organizzazione del genoma umano I

Organizzazione del genoma umano I Organizzazione del genoma umano I LEZIONE 7 1 Oggi, uno degli obiettivi prioritari è la comprensione dei meccanismi mediante i quali le informazioni contenute nel materiale genetico portano, partendo da


02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della



IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune



GENI, GENOMI E CROMOSOMI GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna


Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La


LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6


Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione


Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione


Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010 Le biotecnologie 1 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi viventi o da loro derivati.


Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del


La cellula eucariotica e i suoi organuli (seconda parte)

La cellula eucariotica e i suoi organuli (seconda parte) Università di Ferrara Corso di Laurea in Scienze Motorie Primo anno di corso Corso di Biologia Applicata Lezione di Biologia Cellulare La cellula eucariotica e i suoi organuli (seconda parte) Dott.ssa


ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI


Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni





3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali Strutture cellulari comuni tra cellule animali e vegetali: CITOPLASMA CITOSCHELETRO RIBOSOMI RETICOLO ENDOPLASMATICO APPARATO DEL GOLGI MITOCONDRI NUCLEO PEROSSISOMI CITOPLASMA materiale gelatinoso incolore


2. I nucleosomi 11/02/16

2. I nucleosomi 11/02/16 2. I nucleosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale u Ordinato e dinamico u Formazione della struttura terziaria



ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui


E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la


Lezione 2. Genomi: struttura, contenuto, organizzazione

Lezione 2. Genomi: struttura, contenuto, organizzazione Lezione 2 Genomi: struttura, contenuto, organizzazione Dimensioni e organizzazione dei genomi Origine della vita sulla terra: 3,5 miliardi di anni fa..ecucarioti 2 miliaridi di anni dopo La genomica comparata


Evoluzione delle molecole biologiche

Evoluzione delle molecole biologiche Evoluzione delle molecole biologiche Un video (in inglese): clic Evoluzione delle emoglobine (I) Un esempio classico di evoluzione delle macromolecole biologiche è dato dall emoglobina(hb), la molecola


La cellula eucariotica animale

La cellula eucariotica animale Tutte le cellule sono circondate da una membrana plasmatica costituita da fosfolipidi e proteine. Le cellule eucariotiche posseggono organuli rivestiti di membrana. L organulo di dimensioni maggiori è


07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale


I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione


Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei.

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. DNA e RNA Composizione e proprietà Struttura Analisi 1 STRUTTURA DAGLI ACIDI NUCLEICI Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. I gruppi fosforici hanno pka vicino


RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso


Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi


Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene
