C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC.

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC."

Transcript

1 SOLUZIONI AI PROBLEMI DEL CAPITOLO 11 Domande concettuali C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC. C2. Per replicazione bidirezionale si intende la replicazione del DNA in entrambe le direzioni a partire da un origine. C3. L'affermazione C non è vera. Un nuovo filamento viene sempre sintetizzato a partire da un filamento stampo preesistente. Perciò, una doppia elica contiene sempre un filamento più vecchio dell'altro. C4. C5. No. In un meccanismo conservativo, una doppia elica sarebbe sempre completamente metilata per cui le cellule non potrebbero ritardare il successivo ciclo di replicazione del DNA mediante il meccanismo di metilazione. C6. Assumiamo che ci siano bp di DNA e che la replicazione avvenga in maniera bidirezionale alla velocità di 750 nucleotidi al secondo. Se ci fosse una singola forca replicativa, /750 = 6133 secondi, o 102,2 minuti. Siccome la replicazione è bidirezionale, 102,2/2=51,1 minuti. In effetti, questo è un valore medio che si basa su una varietà di condizioni di crescita. In condizioni ottimali la replicazione può avvenire molto più velocemente. Rispetto agli errori, se assumiamo un tasso di 1 errore ogni nucleotidi, allora x 1000 batteri = nucleotidi di DNA replicato cioè / = 46 errori. Se ci pensi, questo è piuttosto sorprendente. In questa popolazione la DNA polimerasi provocherebbe soltanto 46 errori su un totale di 1000 batteri, ciascuno dei quali contiene 4,6 milioni di coppie di basi. C7. DNA Polimerasi

2 C8. La DNA polimerasi scorrerebbe da destra a sinistra. Il filamento neosintetizzato sarebbe 3' CTAGGGCTAGGCGTATGTAAATGGTCTAGTGGTGG 5' C9. 1. DnaA box Siti di legame per la proteina DnaA. 2. Siti di metilazione Siti di metilazione dell'adenina che sono importanti per la regolazione della replicazione del DNA. 3. Regioni ricche in AT Siti in cui il DNA inizia la separazione dei filamenti per formare un'apertura, talvolta denominata bolla replicativa. C10. A. Guardando la Figura 11.3, la prima, la seconda e la quarta DnaA box sono orientate nella stessa direzione, mentre la terza e la quinta vanno nella direzione opposta. Una volta che hai realizzato ciò, puoi riscontrare che le sequenze sono molto simili tra loro. B. In accordo con la direzione della prima DnaA box, la sequenza consenso è TGTGGATAA ACACCTATT C. Questa sequenza è lunga nove nucleotidi. Siccome ci sono quattro tipi di nucleotidi (cioè A, T, G, e C), la possibilità che questa sequenza sia presente per caso è 4 9 che equivale a nucleotidi. Poiché il cromosoma di E. coli è lungo più di 10 volte questo valore, è molto probabile che questa sequenza consenso sia osservata in altre posizioni. Il motivo per cui nonostante ciò non si osservano origini multiple, sta nel fatto che l origine possiede cinque copie della sequenza consenso molto vicine tra loro. La probabilità di osservare cinque copie della sequenza consenso vicine tra loro per il solo effetto del caso sarebbe molto piccola. C11. Α. La tua mano dovrebbe scivolare lungo il laccio bianco. L'estremità libera del laccio bianco è l'estremità 5', e la DNA elicasi procede in direzione 5' 3'. Β. La tua mano destra dovrebbe avvolgere il laccio bianco in un ansa. Il laccio nero è il filamento stampo per la sintesi del filamento guida. Per la sintesi di questo filamento la DNA polimerasi III si sposta verso la forca replicativa. Il laccio bianco è lo stampo per il filamento in ritardo, e deve essere avvolto ad ansa attorno alla DNA polimerasi III perché l enzima possa spostarsi verso la forca replicativa. C In base alla regola AT/GC, una pirimidina si lega sempre con una purina. Una transizione coinvolge ancora una coppia pirimidina/purina, mentre una transversione causa un appaiamento tra due purine o due pirimidine. La struttura della doppia elica rende più improbabile che si formi questo tipo di appaiamento. 2. Il fenomeno dell adattamento indotto della DNA polimerasi rende improbabile che l enzima catalizzi la formazione di legami idrogeno quando al filamento stampo si appaia un nucleotide errato. Una transizione crea un interazione negativa tra le basi dei filamenti opposti, ma ancor più negativo è l effetto di una transversione, che riguarda un appaiamento tra due purine oppure due pirimidine. 3. La funzione di correzione di bozze della DNA polimerasi può identificare e rimuovere un nucleotide errato che sia stato incorporato nel filamento nascente. Una transversione causerà una distorsione molto grande nella struttura della doppia elica, e sarà più probabile che essa sia

3 riconosciuta dalla DNA polimerasi. C13. È necessario un primer per la sintesi di ogni frammento di Okazaki. La lunghezza media di un frammento di Okazaki è compresa tra 1000 e 2000 bp. Se usiamo un valore medio di 1500 bp per ogni frammento di Okazaki, allora ci dovrebbero essere circa / 1500 = 3067 copie. C14. La primasi e la DNA polimerasi possono allontanare dallo stampo le proteine che legano il DNA a singolo filamento. C15. A. L eliminazione dei primer di RNA si svolge in direzione 5 3, mentre la funzione di correzione delle bozze avviene in direzione 3 5. B. No. La rimozione dei primer di RNA avviene a partire dall'estremità 5' del filamento. C16. A. Il frammento di Okazaki a destra è il primo ad essere stato sintetizzato. Esso è il più lontano dalla forca replicativa. La forca, che non si vede in questo disegno, sarebbe alla sinistra dei tre frammenti di Okazaki e si muoverebbe da destra verso sinistra. B. Il primer di RNA nel frammento di Okazaki a destra sarà rimosso per primo. La DNA polimerasi inizierà l allungamento del frammento centrale e rimuoverà il primer di destra grazie alla sua attività esonucleasica 5 3. La DNA polimerasi I userà l estremità 3 del frammento di Okazaki centrale come primer per sintetizzare il DNA nella regione dove è stato rimosso il primer di RNA. Se il frammento centrale non fosse presente, la DNA polimerasi non potrebbe riempire questa interruzione (perché necessita di un primer). C. Hai bisogno della DNA ligasi solo in corrispondenza della freccia di destra. La DNA polimerasi I inizia dall estremità del frammento a sinistra e sintetizza il DNA per riempire la regione, fintanto che rimuove il primer di RNA centrale. In corrispondenza della freccia di sinistra, la DNA polimerasi I sta semplicemente allungando il frammento di Okazaki di sinistra. Qui la ligasi non serve. Quando la DNA polimerasi I ha allungato il filamento di sinistra fino alla regione dove è stato rimosso il primer di RNA, e va a raggiungere il DNA del frammento di Okazaki centrale. Qui siamo alla freccia di destra, e in questo punto c è un estremità 5 con un monofosfato. La DNA ligasi serve a collegare questo nucleoside monofosfato con l estremità 3 della regione dove è stato rimosso il primer di RNA centrale. D. Come menzionato nella parte C, l estremità al 5 del DNA del frammento di Okazaki centrale è un nucleoside monofosfato, che precedentemente era collegato al primer di RNA tramite un legame fosfoesterico. Perché la DNA polimerasi possa funzionare, l energia che serve a collegare due nucleotidi deriva dall idrolisi del nucleoside trifosfato libero. Però in questa posizione il nucleotide è già presente al 5 del DNA ed è un nucleoside monofosfato. La DNA ligasi collega questo nucleotide con il frammento di Okazaki di sinistra usando energia, che viene ottenuta dall idrolisi di ATP o NAD +. C17. La metilazione del DNA è l'aggiunta covalente di gruppi metilici alle basi del DNA. Immediatamente dopo la replicazione del DNA, i filamenti neosintetizzati non sono metilati. L'inizio della replicazione del DNA a livello del sito di origine non avviene prima che la sequenza non sia completamente metilata. Perciò, il ritardo nella metilazione del DNA serve a impedire la replicazione prematura del DNA immediatamente dopo la divisione cellulare. C18.

4 1. Riconosce l origine di replicazione. 2. Inizia la formazione della bolla di replicazione. 3. Recluta l elica in questa regione. C19. Sarebbe difficile ritardare la replicazione del DNA dopo la divisione cellulare, perché la diluizione della proteina DnaA è un meccanismo che regola la replicazione. Ci si potrebbe aspettare che un tale ceppo abbia più copie per cellula del cromosoma batterico rispetto a un ceppo normale. C20. Il disegno dovrebbe raffigurare una proteina che viaggia lungo il filamento di DNA e separa le due eliche. C21. Un frammento di Okazaki è un breve segmento di DNA di nuova sintesi nel filamento in ritardo. La produzione di questi brevi frammenti è necessaria perché nel filamento in ritardo la forca replicativa espone i nucleotidi in direzione 5 3, ma la DNA polimerasi si sposta lungo il filamento stampo in direzione 3 5 allontanandosi dalla forca replicativa. Perciò, il filamento lagging neosintetizzato viene prodotto mediante brevi frammenti che vengono poi legati tra loro. C22. Il filamento guida ha un solo primer all origine, dopodiché la DNA polimerasi III lo sintetizza in modo continuo nella direzione della forca replicativa. Nel filamento in ritardo vengono formati molti piccoli segmenti di DNA, i frammenti di Okazaki. Ciò richiede molti primer di RNA, che sono poi rimossi dalla DNA polimerasi I. Questo enzima inoltre riempie le interruzioni rimaste con DNA. Infine la DNA ligasi collega covalentemente i frammenti di Okazaki. Un complesso di questi enzimi, quale il primosoma o il replisoma fornisce il coordinamento tra le diverse fasi del processo replicativo e quindi permette di procedere più rapidamente ed efficientemente. C23. Il sito attivo della DNA polimerasi ha la capacità di riconoscere un nucleotide appaiato in modo non corretto in un filamento di nuova sintesi, e di rimuoverlo mediante un taglio esonucleasico. La correzione delle bozze avviene in direzione 3 5. Dopo che l'errore di appaiamento è stato rimosso, la DNA polimerasi riprende la sintesi di DNA in direzione 5 3. C24. Un enzima processivo resta agganciato al proprio substrato. Nel caso della DNA polimerasi, esso resta agganciato al filamento stampo e sintetizza il nuovo filamento. Questo permette che la sintesi di DNA proceda più rapidamente. C25. È necessario che la replicazione del DNA sia regolata per mantenere il numero corretto di cromosomi in ogni cellula. Se la replicazione fosse troppo lenta, le cellule figlie potrebbero non ricevere alcun cromosoma. Se fosse troppo veloce, esse potrebbero riceverne troppi. C26. La ragione è la sua incapacità di sintetizzare il DNA nella direzione 3 5 e il bisogno del primer. La telomerasi differisce dalla DNA polimerasi perché per la sintesi utilizza come stampo una propria sequenza di RNA. Siccome usa questa sequenza molte volte di seguito, essa produce una sequenza ripetuta in tandem all estremità telomerica 3 dei cromosomi lineari. C27. Il filamento opposto viene sintetizzato in modo convenzionale dalla DNA polimerasi usando come stampo il filamento prodotto dalla telomerasi.

5 C28. Cinquanta, perché da ciascuna origine si dipartono due forche di replicazione: la replicazione del DNA è bidirezionale. C29. Le estremità indicate con B e C non possono essere replicate dalla DNA polimerasi. La DNA polimerasi produce un filamento in direzione 5 3 usando un filamento stampo disposto in direzione 3 5. Inoltre, la DNA polimerasi necessita di un primer. Alle estremità B e C, non vi è posto (a monte) per la sintesi di un primer. C30. A. Sia la trascrittasi inversa che la telomerasi usano uno stampo di RNA per produrre un filamento complementare di DNA. B. Siccome la trascrittasi inversa non possiede un attività di correzione di bozze, è più facile che introduca degli errori. Questo crea molti ceppi mutanti di virus. Alcune mutazioni possono impedire al virus di riprodursi. Tuttavia altre mutazioni possono impedire al sistema immunitario di combattere il virus, e queste aumenteranno le capacità proliferative virali. C31. Come illustrato nella Figura 11.18, il primo passaggio coinvolge il legame della telomerasi al telomero. L'estremità 3' sporgente si lega all'rna complementare nella telomerasi. Per questo motivo, per la telomerasi è necessario possedere una porzione 3' sporgente per replicare il telomero. Domande sperimentali S1. A. Quattro generazioni: 7/8 leggere, 1/8 di peso intermedio; cinque generazioni: 15/16 leggere, 1/16 di peso intermedio. B. Tutte le doppie eliche di DNA sarebbero pesanti per 1/8. C. Il gradiente di CsCl separa le molecole in base alla loro densità. I composti contenenti 14 N presentano una densità inferiore rispetto a quelli contenenti 15 N. Le basi del DNA contengono azoto. Se le basi contengono solamente 15 N, il DNA sarà pesante e sedimenterà a una densità maggiore. Se le basi contengono solamente 14 N, il DNA sarà leggero e sedimenterà a una densità inferiore. Se le basi di un filamento contengono 14 N e quelle del filamento opposto 15 N, il DNA sarà di peso intermedio e sedimenterà a una densità intermedia. S2. A. Avresti visto probabilmente ancora una banda, ma soltanto una banda pesante. B. Probabilmente non avresti visto una banda, perché il DNA non sarebbe stato rilasciato dai batteri, che avrebbero sedimentato sul fondo della provetta. C. Non avresti visto una banda. La luce UV è necessaria per visualizzare il DNA, che assorbe la luce nella regione UV. S3. Potresti determinare il numero delle forche replicative e le loro localizzazioni approssimative. Per i cromosomi con una sola origine di replicazione, potresti determinare che la replicazione è bidirezionale. Tuttavia, non otterresti alcuna informazione di natura molecolare circa il processo della replicazione del DNA. S4. Iniziando con un filamento di DNA a singolo filamento, avresti bisogno di un primer (o della primasi), dntp, e DNA polimerasi. Iniziando con un DNA a doppia elica, avresti bisogno anche di

6 un elicasi. L aggiunta delle proteine che legano il DNA a singolo filamento e la topoisomerasi può essere di aiuto. S5. Dovresti aggiungere uno stampo di DNA con un'estremità 3' sporgente complementare alla sequenza del telomero. Dovresti anche aggiungere la telomerasi e i dntp. S6. Questo è un punto critico perché hai bisogno di separare la radioattività presente nei nucleotidi non legati da quella del filamento neosintetizzato. Se usi un acido che precipita i nucleotidi e il filamento di DNA, tutta la radioattività sarà nel pellet. Otterresti così la stessa quantità di segnale radioattivo indipendentemente da quanto DNA neosintetizzato sia presente. L acido perclorico è cruciale perché separa la radioattività dei nucleotidi liberi da quella del filamento neosintetizzato. S7. No, perché l'idrolisi dei deossiribonucleosidi trifosfato fornisce l'energia necessaria per la sintesi dei nuovi filamenti. S8. A. L estremità sinistra è l estremità 5. Se tu ruoti la sequenza del primo primer su se stessa, noterai che essa è complementare all estremità destra dello stampo di DNA. L estremità 5 del primo primer si lega all estremità 3 dello stampo. B. La sequenza sarebbe 3' CGGGGCCATG 5'. Essa non potrebbe essere usata perché l estremità 3 del primer è alla fine dello stampo di DNA. Non ci sarebbe spazio per aggiungere nucleotidi all estremità 3 del primer e legarsi al filamento stampo. S9. Affinché un filamento di DNA si allunghi, viene formato un legame fosfoesterico tra il gruppo 3'-OH di un nucleotide e il gruppo 5' fosfato più interno nel nucleotide che deve essere aggiunto (confronta la Figura 11.7). Se manca il gruppo -OH, non può formarsi il legame fosfoesterico. S10. A. Le due eliche sono separate col calore perciò non hai bisogno dell elicasi. B. Ogni primer dovrebbe essere una sequenza complementare a uno dei filamenti di DNA. Ci sono due tipi di primer, e ciascuno si lega a uno dei due filamenti complementari. C. Viene usata una DNA polimerasi termofila perché la DNA polimerasi isolata da specie non termofile verrebbe inattivata permanentemente durante la fase di riscaldamento della PCR. Ricorda che la DNA polimerasi è una proteina, e la gran parte delle proteine viene denaturata al calore. Tuttavia le proteine degli organismi termofili si sono evolute per resistere al calore, che è la ragione per cui questi organismi sopravvivono ad alte temperature. D. A ciascun ciclo, la quantità di DNA viene raddoppiata. Poiché all inizio ci sono 10 copie di DNA, dopo 27 cicli ci saranno 10 x 2 27 copie ossia 1,34 x 10 9 copie di DNA. Come puoi vedere la PCR amplifica la quantità di DNA in modo davvero stupefacente!

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

MODALITA DI REPLICAZIONE

MODALITA DI REPLICAZIONE MODALITA DI REPLICAZIONE In teoria è ipotizzabile che il DNA possa duplicarsi con modalità: 1) semi-conservativa se alla generazione successiva passano due doppie eliche entrambi costituite da un'elica

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

DNA e replicazione del DNA

DNA e replicazione del DNA DNA e replicazione del DNA 1928: EXP di Griffith Scoperto il fattore trasformante Struttura elicoidale del DNA Struttura del DNA Subunità nucleotidiche Struttura del DNA Subunità nucleotidiche La replicazione

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

REPLICAZIONE DEI GENOMI A DNA

REPLICAZIONE DEI GENOMI A DNA REPLICAZIONE DEI GENOMI A DNA LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA FIGURA 12.26 GENES VII FIGURA 13.1 GENOMI II FIGURA 13.2 GENOMI II NEL 1958 MESELSON E STAHL DIMOSTRANO CHE

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Ciclo cellulare Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Arthur Kornberg, 1970 Replicazione

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B2 Il linguaggio della vita 3 Le basi molecolari dell ereditarietà Prima

Dettagli

Biologia Molecolare. CDLM in CTF La Replicazione del DNA

Biologia Molecolare. CDLM in CTF La Replicazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La Replicazione del DNA Prospettiva Storica La replicazione semidiscontinua Differenze tra procarioti ed eucarioti E fondamentale che ad ogni divisione cellulare

Dettagli

Quanto DNA è contenuto in una cellula?...

Quanto DNA è contenuto in una cellula?... Quanto DNA è contenuto in una cellula?... bp = Base Pair (coppie di basi) lungh DNA/lungh struttura ospitante E. coli: 4,6x10 6 bp (1,7 mm) 850 (unica molecola circolare) Cellula umana: 3,2x10 9 bp (~2

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

Legami idrogeno tra le coppie di basi

Legami idrogeno tra le coppie di basi Legami idrogeno tra le coppie di basi 4 3 6 1 4 3 2 6 1 2 Interazioni elettrostatiche deboli che si stabiliscono tra un atomo elettronegativo (es.ossigeno o azoto) e un atomo di idrogeno legato ad un secondo

Dettagli

Il modello del Replicone

Il modello del Replicone Il modello del Replicone Il replicone copre l intera regione di DNA replicata a partire da una singola origine di replicazione (es. il genoma di E.coli corrisponde ad un singolo replicone). Il replicone

Dettagli

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio LEZIONE III DUPLICAZIONE DEL DNA Dott. Paolo Cascio DUPLICAZIONE DEL DNA NEI PROCARIOTI LA DUPLICAZIONE DEL CROMOSOMA BATTERICO CIRCOLARE INIZIA IN UN UNICO PUNTO E PROCEDE BIDIREZIONALMENTE FINO A QUANDO

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Mappa del cromosoma di E. coli in cui sono indicate le posizioni dei geni che codificano proteine importanti per il metabolismo del DNA L esperimento di Meselson e Stahl (1957):

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 21 La replicazione del DNA Concetti chiave: La DNA polimerasi necessita di uno stampo e di inneschi (i primer) per sintetizzare

Dettagli

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze LA TRASCRIZIONE processo nel quale il DNA stampo viene copiato in una molecola di RNA La molecola di RNA è identica in sequenza all elica codificante e complementare a quella stampo. La trascrizione è

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI La tecnologia del DNA ricombinante è molto complessa dal punto di vista operativo, ma dal punto di vista concettuale si basa su criteri

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina DNA e CROMOSOMI Come il DNA si replica, si ripara e ricombina Nel 1928 venne dimostrato che il DNA è il materiale genetico dei batteri (Griffith) Alcune proprietà dei batteri S morti possono trasformare

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare.

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Nelle cellule in proliferazione le 4 fasi impiegano dalle 10 20 ore in dipendenza

Dettagli

Il processo di ricopiatura, detto replicazione del DNA, deve avvenire perché da una cellula si possano formare 2 cellule figlie geneticamente

Il processo di ricopiatura, detto replicazione del DNA, deve avvenire perché da una cellula si possano formare 2 cellule figlie geneticamente Lezione 5 - La replicazione del DNA 1. Introduzione 2. Modelli ed esperimenti 3. Replicazione nei procarioti 4. Complesso enzimatico 5. Svolgimento del DNA 6. Forcella replicativa 7. Primasi e innesco

Dettagli

LE BASI AZOTATE PIRIMIDINE PURINE

LE BASI AZOTATE PIRIMIDINE PURINE LE BASI AZTATE PURIE PIRIMIDIE Le basi azotate sono composti eterociclici aromatici con azoti portanti doppietti basici. Possono avere un solo anello (pirimidine) o due (purine). Le basi adenina, guanina

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc.

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc. estremità 5' 5 3 - P N 5 2 C 3 ponte fosfodiestere P A 1 2 C 5 P 3 G N 1 2 C 5 3 P T N 1 5 2 C 3 etc. DNA C N 1 estremità 3' zucchero N 1 C 3 4 3 timina N adenina N N 1 6 N N 9 N zucchero N zucchero citosina

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

Il DNA è il materiale ereditario e non le proteine

Il DNA è il materiale ereditario e non le proteine DNA -Come è stato scoperto -Quali sono le sue funzioni Il DNA è il materiale ereditario e non le proteine Esperimento di Griffith 1928 Streptococcus pneumoniae S(smooth) capsulato virulento R(rough) acapsulato

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

Telomeri e Telomerasi:

Telomeri e Telomerasi: Telomeri e Telomerasi: 1 I cromosomi eucariotici sono molecole lineari, a doppio filamento, che terminano generalmente con un segmento di 10000 coppie di basi, costituito da piccole sequenze nucleotidiche

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Funzioni dei nucleotidi

Funzioni dei nucleotidi Funzioni dei nucleotidi monomeri degli acidi nucleici esempi di altre funzioni ATP: moneta energetica GTP: fonte di energia nella sintesi proteica camp: secondo messaggero nella trasduzione del segnale

Dettagli

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI IL MATERIALE GENETICO Fino agli anni 40 si credeva che le proteine fossero le molecole della informazione ereditaria. C erano comunque

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

Enzimi di restrizione. di Vittorio Scornaienchi

Enzimi di restrizione. di Vittorio Scornaienchi Enzimi di restrizione di Vittorio Scornaienchi Generalità Nucleasi Le nucleasi sono enzimi che tagliano i legami sui filamenti degli acidi nucleici: 5. Le esonucleasi aggrediscono una delle estremità libere

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

Biotecnologie. Screening delle genoteche con le sonde geniche

Biotecnologie. Screening delle genoteche con le sonde geniche Biotecnologie Screening delle genoteche con le sonde geniche Giancarlo Dessì http://www.giand.it Licenza Creative Commons BY-NC-SA (BY: attribuzione, NC: uso non commerciale, SA: condividi allo stesso

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA La chimica della sintesi del DNA DNA polimerasi III La forca replicativa La fase di inizio della replicazione Selezione delle origini replicative La terminazione della replicazione

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi.

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Ogni cellula contiene un organello, il NUCLEO, all interno

Dettagli

ENZIMI DI RESTRIZIONE E DNA RICOMBINANTE

ENZIMI DI RESTRIZIONE E DNA RICOMBINANTE ENZIMI DI RESTRIZIONE E DNA RICOMBINANTE GLI ENZIMI DI RESTRIZIONE Sono enzimi che tagliano la doppia elica del DNA in corrispondenza di specifiche sequenze (frammenti non casuali). La grandezza dei frammenti

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti?

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Domande Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Tre modelli di replicazione del DNA Meselson e Stahl 1958 http://www.youtube.com/watch?v=kybdh8vpigk

Dettagli

Interfase. La REPLICAZIONE del DNA

Interfase. La REPLICAZIONE del DNA Interfase La REPLICAZIONE del DNA REPLICAZIONE del DNA Doppia elica parentale Il modello di replicazione del DNA ipotizzato da Watson e Crick è basato sulla complementarietà delle basi dei due filamenti

Dettagli

Modulo 8: I nucleotidi e gli acidi nucleici

Modulo 8: I nucleotidi e gli acidi nucleici Modulo 8: I nucleotidi e gli acidi nucleici Modulo 10: Acidi nucleici Filamento di DNA fuoriuscito da una cellula di Escherichia coli Struttura e funzioni dei nucleotidi Funzioni dei nucleotidi: Unità

Dettagli

Allineamento dei 2 RNA

Allineamento dei 2 RNA La traduzione 2 codone Allineamento dei 2 RNA anticodone Studi Molecolari hanno dimostrato che: 3 residui nucleotidici del mrna sono necessari per codificare ciascun amminoacido Il linguaggio contenuto

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie Lezione 1 Il clonaggio 2 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi

Dettagli

Le molecole di RNA possono assumere particolari strutture che conferiscono loro particolari funzioni.

Le molecole di RNA possono assumere particolari strutture che conferiscono loro particolari funzioni. Traduzione: t-rna Le molecole di RNA possono assumere particolari strutture che conferiscono loro particolari funzioni. Singola catena alta flessibilità ripiegamento su stessa legami deboli con se stessa

Dettagli

ENZIMI. Durante la reazione l enzima può essere temporaneamente modificato ma alla fine del processo ritorna nel suo stato originario, un enzima viene

ENZIMI. Durante la reazione l enzima può essere temporaneamente modificato ma alla fine del processo ritorna nel suo stato originario, un enzima viene ENZIMI Tutti gli enzimi sono PROTEINE che funzionano da catalizzatori biologici nelle reazioni cellulari, e lavorano in condizioni blande di temperatura e ph (sono in grado di aumentare la velocità delle

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Dimensioni di Genomi

Dimensioni di Genomi Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa

Dettagli

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin Watson e Crick Rosalind Franklin Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. citochinesi: o citodieresi. Divisione del citoplasma

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

La Terminazione della Trascrizione

La Terminazione della Trascrizione La Terminazione della Trascrizione I geni batterici possiedono dei terminatori della trascrizione. I Terminatori sono sequenze dell RNA che promuovono il distacco dell RNA polimerasi dal templato Ne esistono

Dettagli

Adenina Adenine H H N N N N N Z

Adenina Adenine H H N N N N N Z Adenina Adenine Z Guanina O GUAIA Z Citosina CITOSIA Z O Timina Thymine C3 O Z O Siti di attacco elettrofilo 3 Thymine Basi appaiate: Timina-Adenina Adenine C 3 O O 3.ooA Basi appaiate: Citosina-Guanina

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE?

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE? DNA E PROTEINE NUMEROSI DATI SUGGERISCONO CHE IL DNA SVOLGA IL SUO RUOLO GENETICO CONTROLLANDO LA SINTESI DELLE PROTEINE, IN PARTICOLARE DETERMINANDONE LA SEQUENZA IN AMINOACIDI E NECESSARIO RISPONDERE

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

Alcune sequenze di DNA insolite. Palindromo. Sequenze con una simmetria doppia

Alcune sequenze di DNA insolite. Palindromo. Sequenze con una simmetria doppia Alcune sequenze di DNA insolite Palindromo Sequenze con una simmetria doppia Possono formare: Struttura a croce dette anche anse cruciformi DNA rilassato DNA parzialmente disavvolto DNA cruciforme Struttura

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Polymerase chain reaction - PCR. Biotecnologie applicate all ispezione degli alimenti di origine animale

Polymerase chain reaction - PCR. Biotecnologie applicate all ispezione degli alimenti di origine animale Prof.ssa Tiziana Pepe Polymerase chain reaction - PCR Biotecnologie applicate all ispezione degli alimenti di origine animale Dip. di Medicina Veterinaria e Produzioni animali tiziana.pepe@unina.it Metodologia

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

Nucleotidi 26/10/2014. Nucleotidi (1)

Nucleotidi 26/10/2014. Nucleotidi (1) I Nucleotidi Hanno Tre Componenti Base azotata Nucleotidi https://www2.chemistry.msu.edu/faculty/reusch/virttxtjml/nucacids.htm Base azotata Qualsiasi composto che manifesta proprietà basiche per via della

Dettagli

Biologia Molecolare. CDLM in CTF La trascrizione nei procarioti

Biologia Molecolare. CDLM in CTF La trascrizione nei procarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione nei procarioti I meccanismi della trascrizione Il modello dell operone L attenuazione Batteri Polimerasi RNA Polimerasi Geni Trascritti Tutti

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Basi biologiche delle malattie Genetica delle neoplasie Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Samantha Messina 2017 GENETICA DELLE NEOPLASIE Ciclo - alterazione dei meccanismi

Dettagli

La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza

Dettagli

Nucleotidi 20/12/2013. Nucleotidi (1) Ribosio Vs. Desossirbosio

Nucleotidi 20/12/2013. Nucleotidi (1) Ribosio Vs. Desossirbosio I Nucleotidi Hanno Tre Componenti Nucleotidi https://www2.chemistry.msu.edu/faculty/reusch/virttxtjml/nucacids.htm Nucleotidi (1) Ribosio Vs. Desossirbosio Un Nucleotide è una molecola costituita da un

Dettagli