Tecniche di bandeggio

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Tecniche di bandeggio"

Transcript

1

2 Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande) caratteristico si ritiene che il bandeggio dipenda da: sequenza DNA proteine legate 2

3 Nomenclatura Citogenetica Le definizioni ed i termini attualmente in uso sono stati stabiliti nel 1978 dallo ISCN (International System for Human Cytogenetic Nomenclature) 3

4 La nomenclatura citogenetica si riferisce a cromosomi metafasici (cioè bloccati in metafase)* colorati con metodi tradizionali (cioè cromosomi NON bandeggiati) *questi cromosomi sono costituiti da 2 cromatidi uniti per il centromero, che costituisce la costrizione primaria e divide il cromosoma in: braccio corto p braccio lungo q 4

5 In base alla posizione del centromero si distinguono 4 tipi di cromosomi METACENTRICI: centromero al centro dimensioni circa uguali di p e q SUBMETACENTRICI: centromero lievemente spostato in alto ACROCENTRICI: centromero molto spostato in alto p molto più corto di q a volte dotati di satelliti TELOCENTRICI: centromero situato all estremo prossimale del cromosoma NON sono presenti nel cariotipo umano 5

6 I bracci del cromosoma sono suddivisi in regioni e sottoregioni REGIONI numerate in maniera crescente spostandosi dal centromero verso il telomero SOTTOREGIONI ogni regione è suddivisa in sottoregioni, numerate anch esse in maniera crescente verso il telomero; le sottoregioni possono a loro volta essere suddivise in altre sottoregioni numerate con lo stesso sistema 6

7 I bracci del cromosoma sono suddivisi in regioni e sottoregioni 7

8 La nomenclatura dei referti citogenetici consiste in 3 parti separate da una virgola numero totale di cromosomi individuati 2. costituzione cromosomi sex 3. eventuali anomalie riscontrate (indicate con + di acquisizione e di perdita) 47, XY, +21 maschio affetto da Trisomia 21 in forma libera 46, XX cariotipo normale femminile in un cariotipo normale NON si indica la parte 3 8

9 Simboli e abbreviazioni usati in citogenetica per indicare eventuali anomalie riscontrate 9

10 esempi di cariotipi con anomalie SIMBOLO SIGNIFICATO es. REFERTI CITOGENETICI DESCRIZIONE del delezione 46, XX, del(5)(p15.3) Cri du chat; delezione nel cromosoma 5, nel braccio corto in posizione , XX, del(5)(p ) oppure 46, XX/5p manca tutto il braccio corto del cromosoma 5 dup duplicazione 46, XY, dup(21)(q21) trisomia parziale del cromosoma 21 inv inversione 46, XX, inv(9)(p12q13) in questo caso si ha un inversione pericentrica / mosaicismo 46, XX/45, X0 differenzia le 2 linee del mosaico t traslocazione 46, XY, t(1;2)(p21;p24) si usa il punto e virgola per differenziare i cromosomi 1 e 2, e i rispettivi punti in cui è avvenuta la traslocazione 10

11 Cariotipo umano normale CARIOTIPO = costituzione del patrimonio cromosomico di una specie dal punto di vista morfologico ANALISI DEL CARIOTIPO = rappresentazione ordinata del corredo cromosomico di un individuo 7 gruppi di cromosomi: distinti in base a dimensione e posizione del centromero gruppi da A a G: ogni gruppo contiene 1 o più coppie di omologhi per convenzione i cromosomi si montano col braccio corto rivolto verso l alto e quello lungo verso il basso i centromeri vengono disposti tutti alla stessa altezza posizionandoli a livello di una linea 11

12 Cariotipo umano normale GRUPPI DESCRIZIONE COPPIE OMOLOGHI CARATTERISTICHE A B C D E F G grandi metacentrici grandi sub-metacentrici medi sub-metacentrici medi acrocentrici piccoli quasi metacentrici piccoli metacentrici piccoli acrocentrici 1 metacentrici 2 sub-metacentrici 3 metacentrici 4 sub-metacentrici 5 X sub-metacentrici acrocentrici metacentrici 17 sub-metacentrici metacentrici 20 Y 21 acrocentrici 22 12

13 Cariotipo umano normale 13

14 I esempi di cariotipo umano normale 14

15 II esempi di cariotipo umano normale 15

16 III esempi di cariotipo umano normale 16

17 Alterazioni cromosomiche numeriche si ha un numero di cromosomi diverso dal normale numero diploide di 46 (per le cellule somatiche) o aploide di 23 (per le cellule sessuali mature) le alterazioni numeriche degli autosomi hanno sempre gravi effetti sul fenotipo le delezioni sono sensibilmente più gravi delle trisomie si dividono in: Aneuploidie Poliploidie variazione del numero di cromosomi di 1 o poche coppie di omologhi variazione di interi assetti cromosomici 17

18 ANEUPLOIDIE MONOSOMIE 2n 1 manca un intero cromosoma conta = 45 le monosomie autosomiche sono sempre incompatibili con la vita le monosomie eterosomiche possono essere compatibili con la vita (= l embrione viene portato a termine ma l individuo ha problemi più o meno gravi) alcune monosomie parziali possono essere compatibili con la vita (ossia quando manca solo una parte di un determinato cromosoma) TRISOMIE 2n + 1 un cromosoma è presente in triplicato conta = 47 le trisomie autosomiche compatibili con la vita sono le 13, 18, 21, 22 le trisomie eterosomiche sono solitamente compatibili con la vita TETRASOMIE 2n + 2 un cromosoma è presente in quadruplicato conta = 48 vitale solo quella della X 18

19 esempio di monosomia 19

20 esempio di trisomia 20

21 POLIPLOIDIE TRIPLOIDIE 2n + n NON compatibili con la vita conta = 69 anomalia numerica osservata con discreta frequenza nel materiale abortivo TETRAPLOIDIE 2n + 2n NON compatibili con la vita conta = 92 21

22 esempio di triploidia 22

23 Alterazioni cromosomiche strutturali alterazioni in cui viene modificata la normale sequenza di geni di uno o più cromosomi in seguito al verificarsi di rotture, seguite da un anomala riunione dei frammenti cromosomici; ne derivano perdita o acquisizione o localizzazione anomala di porzioni del genoma dal punto di vista clinico bisogna fare una distinzione di bilanciamento del corredo genetico: ALTERAZIONI STRUTTURALI BILANCIATE: il patrimonio genetico rimane in quantità inalterate; il portatore NON presenta danni fenotipici; nella prole si potranno avere alterazioni sbilanciate; sono: inversioni traslocazioni ALTERAZIONI STRUTTURALI SBILANCIATE: il patrimonio genetico viene sbilanciato per difetto/eccesso; causano danni fenotipici nel portatore; sono: delezioni duplicazioni traslocazioni 23

24 DELEZIONI si intende la perdita di una porzione cromosomica monosomie parziali: nel cromosoma manca un pezzo, che può essere una piccola banda fino a un intero braccio (solitamente il braccio corto in quanto quello lungo contiene troppi geni per portare ad una situazione compatibile con la vita) la delezione di un grosso frammento cromosomico è in genere incompatibile con la vita si confondono con le monosomie 24

25 DELEZIONI in base al punto in cui avvengono sono di 2 tipi TERMINALI: viene persa una parte terminale del cromosoma INTERSTIZIALI: viene scisso un pezzo interno si distinguono in PURE: si trova solo monosomia parziale deriva da crossing-over ineguale o da scambio ineguale fra cromatidi fratelli 85-90% dei casi ASSOCIATE A TRISOMIA: si trova sia monosomia che trisomia deriva da segregazione sbilanciata di una traslocazione reciproca presente in un genitore nella forma bilanciata 10-15% dei casi 25

26 DELEZIONI cromosoma ad anello: cromosomi che si formano in seguito a piccole delezioni terminali sia nel braccio corto che nel braccio lungo, e alla riunione delle estremità appiccicose mitosi generalmente stabili; danno origine a cellule figlie contenenti anelli uguali meiosi generalmente instabili 26

27 DUPLICAZIONI si intende la presenza di un frammento cromosomico in eccesso trisomie o tetrasomie parziali 27

28 DUPLICAZIONI derivano da crossing-over ineguale o da scambio ineguale fra cromatidi fratelli 28

29 DUPLICAZIONI a seconda dell incorporazione del frammento si distinguono in INTERCROMOSOMICA: se il frammento è incorporato in un cromosoma NON omologo INTRACROMOSOMICA: se il frammento è incorporato all interno del medesimo cromosoma si distinguono in DIRETTE se viene mantenuta la direzione del segmento come in origine rispetto al centromero INVERTITE se si inverte la direzione del segmento rispetto al normale si distinguono in PURE si trova solo trisomia associata alle duplicazioni ASSOCIATA A MONOSOMIA (delezione) parti trisomiche e monosomiche 29

30 INVERSIONI si intende il risultato di una rottura in 2 punti dello stesso cromosoma con rotazione di 180 del frammento staccatosi e sua saldatura all interno del cromosoma stesso possono essere: PERICENTRICHE: attorno al centromero; il frammento invertito include il centromero possibile cariotipo sbilanciato nella prole (duplicazioni e deficienza) PARACENTRICHE: NON riguarda il centromero; si verifica all interno di un braccio cromosomico 30

31 INVERSIONI 31

32 INVERSIONI Conseguenze ridotta fertilità nel portatore nessuno sbilanciamento nel portatore possibile sbilanciamento nella prole quando avviene crossing-over nel punto dove è avvenuta l inversione si può avere sbilanciamento varia il pattern di bande può variare la forma del cromosoma per spostamento del centromero alla meiosi inversioni piccole i cromosomi omologhi (invertito + normale) possono appaiarsi normalmente, e solo il piccolo tratto invertito non si appaia inversioni grandi i cromosomi omologhi (invertito + normale) possono appaiarsi per tutto il tratto invertito, mentre non si appaieranno nella restante porzione cromosomica inversioni medie i cromosomi omologhi (invertito + normale) possono appaiarsi se si forma un ansa da inversione; un eventuale crossing-over a livello dell ansa da inversione causa un nuovo arrangiamento cromosomico, e nel caso di inversione pericentrica si avrà deficienza-duplicazione 32

33 TRASLOCAZIONI si intende una mutazione cromosomica caratterizzata da scambio di frammenti fra 2 cromosomi, in ciascuno dei quali è avvenuta una rottura si distinguono tra BILANCIATE: NON vi è perdita o acquisto di materiale genetico NON vi è effetto sul fenotipo (di regola); raramente possono esserci effetti nel fenotipo nei rari casi in cui la rottura per la traslocazione comporta l interruzione di un gene importante possibile traslocazione sbilanciata nella prole aborti spontanei SBILANCIATE: perdita o acquisto di materiale genetico effetti sul fenotipo derivano da una traslocazione bilanciata in uno dei 2 genitori 33

34 TRASLOCAZIONI bilanciate 34

35 TRASLOCAZIONI sbilanciate 35

36 Traslocazioni Reciproche 36

37 Traslocazione Robertsoniana traslocazione reciproca con fusione centrica di 2 cromosomi acrocentrici; bracci corti si fondono a loro volta costituendo un microsoma satellitato che in genere viene perduto *da notare che un gamete con una monosomia del 14 NON esiste nel cariotipo umano quindi viene abortito 37

38 ANOMALIE DI DIVISIONE DEL CENTROMERO Fusione Centrica La traslocazione robertsoniana deriva da eventi di fusione centrica; si possono verificare almeno 3 casi CASO 1 Fusione centrica con formazione di un cromosoma monocentrico il centromero deriva da entrambi i cromosomi 38

39 ANOMALIE DI DIVISIONE DEL CENTROMERO Fusione Centrica CASO 2 Rottura di un braccio corto e di un braccio lungo con formazione di un monocentrico il centromero deriva da uno solo dei cromosomi può formarsi un piccolissimo cromosoma, che molto sperso si perde; questo piccolissimo cromosoma ha un ruolo secondario in quanto è formato dai bracci corti, ossia regioni ridondanti, e spesso presenta satelliti 39

40 ANOMALIE DI DIVISIONE DEL CENTROMERO Fusione Centrica CASO 3 Rottura delle braccia corte con formazione di un dicentrico o di un monocentrico cromosoma dicentrico: cromosoma NON stabile in quanto alla divisione funzionano entrambi i centromeri che venendo agganciati dai poli opposti rompono di fatto il cromosoma cromosoma monocentrico: si forma per soppressione di uno dei centromeri 40

41 ANOMALIE DI DIVISIONE DEL CENTROMERO Fissione Centrica sutura perfettamente al centromero il centromero si rompe orizzontalmente formando 2 cromosomi, ognuno dei quali avente il suo centromero funzionante da 1 cromosoma se ne formano 2 (quindi si passa ad una situazione a 47 cromosomi) i cromosomi che si formano sono di fatto telocentrici, e si comportano come tali divisione verticale NON formano isocromosoma genoma bilanciato e fenotipo normale alla meiosi i prodotti della fissione centrica formano un trivalente con il cromosoma omologo segregazione come per la traslocazione Robertsoniana 41

42 ANOMALIE DI DIVISIONE DEL CENTROMERO Cromosoma isodicentrico sutura nettamente spostata da un lato (*1) riarrangiamento da un lato con perdita di buona parte dei bracci lunghi (*2) le estremità si saldano (*3) il centromero si separa verticalmente e il cromosoma si apre: in tal maniera il cromosoma risulta specularmente uguale rispetto al punto medio fra i 2 centromeri (*4) SE uno dei 2 centromeri si inattiva continua a comportarsi come un isocromosoma 42

43 ANOMALIE DI DIVISIONE DEL CENTROMERO presentano la delezione in un braccio e la duplicazione di un altro braccio presenta le 2 braccia uguali per dimensione e composizione di DNA (braccia isologhe), ossia speculari rispetto al centromero sempre metacentrico (per definizione; iso vuol dire che le braccia sono uguali) può avvenire nel p o nel q Isocromosoma sutura lievemente spostata da un lato si formano: 1 cromosoma acentrico viene perso 1 cromosoma centrico: NON si comporta come un cromatidio, ma si apre e si comporta come un cromatidio, che si apre alla prossima divisione forma isocromosoma 43

44 ANOMALIE DI DIVISIONE DEL CENTROMERO Isocromosoma Es. 1 44

45 ANOMALIE DI DIVISIONE DEL CENTROMERO Isocromosoma Es. 2 45

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

GENETICA CITOGENETICA MEDICA

GENETICA CITOGENETICA MEDICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA A.A.2015/2016 Prof Alberto E.Turco Me 21.10.2015 Lezioni 15 e 16 CITOGENETICA MEDICA ANOMALIE CROMOSOMICHE (Chromosome Disorders) - Abortività

Dettagli

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie Nullisomia: 2n-2 (morte preimpianto) Monosomia: : 2n-1 (generalmente morte embrionale) Trisomia: :

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards)

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Markers di anomalie cromosomiche - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Sindrome di Turner - Sindrome di Williams - Sindrome di Angelman

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

Che cos e la citogenetica?

Che cos e la citogenetica? Che cos e la citogenetica? Lo studio della: Struttura, funzione ed evoluzione dei cromosomi Comportamento dei cromosomi durante la divisione somatica e germinale La citogenetica nasce nel 1956 quando Tjio

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni

Dettagli

L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA. Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO

L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA. Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO CARIOTIPO UMANO: Struttura a corona di rosario 46 cromosomi:

Dettagli

ANOMALIE CROMOSOMICHE DI STRUTTURA. necessitano di rotture dei cromosomi

ANOMALIE CROMOSOMICHE DI STRUTTURA. necessitano di rotture dei cromosomi ANOMALIE CROMOSOMICHE DI STRUTTURA necessitano di rotture dei cromosomi ANOMALIE CROMOSOMICHE DI STRUTTURA necessitano di rotture dei cromosomi una rottura su un cromosoma ANOMALIE CROMOSOMICHE DI STRUTTURA

Dettagli

La citogenetica studia la struttura e le alterazioni dei cromosomi.

La citogenetica studia la struttura e le alterazioni dei cromosomi. La citogenetica studia la struttura e le alterazioni dei cromosomi. I cromosomi si presentano come piccoli bastoncelli, a loro volta divisi in due longitudinalmente ed uniti in una zona detta centromero,

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

Sperimenta il BioLab Le analisi cromosomiche

Sperimenta il BioLab Le analisi cromosomiche Sperimenta il BioLab Le analisi cromosomiche Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INDICE 1. INTRODUZIONE p. 3 2. STRUTTURA E MORFOLOGIA DEI CROMOSOMI

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

PATOLOGIA CROMOSOMICA

PATOLOGIA CROMOSOMICA PATOLOGIA CROMOSOMICA CARIOTIPO UMANO NORMALE 4 6,X Y 4 6,X X CARIOTIPO UMANO NORMALE Cariotipo normale, giemsa CARIOTIPO UMANO NORMALE bande G C r o m o s o m a c o n b and e G t e lo m e r o c e ntr

Dettagli

LE MUTAZIONI. www.slidetube.it Pagina 1

LE MUTAZIONI. www.slidetube.it Pagina 1 LE MUTAZIONI Buongiorno a tutti, io sono una collaboratrice del professor Fazio e oggi lo sostituisco perché non può venire. Questa lezione verte soprattutto sulle mutazioni, meccanismi di formazioni di

Dettagli

CLASSIFICAZIONE DELLE MALATTIE GENETICHE

CLASSIFICAZIONE DELLE MALATTIE GENETICHE CLASSIFICAZIONE DELLE MALATTIE GENETICHE - Malattie Monogeniche (Mendeliane) A.D., A.R., X-L. - Malattie Cromosomiche (Anomalie di numero e di struttura) - Malattie Multifattoriali (o Poligeniche) - Malattie

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

Esistono 2 tipi di variazioni nel numero dei cromosomi eteroploidia a. poliploidia 3n, 4n,5n b. aploidia n

Esistono 2 tipi di variazioni nel numero dei cromosomi eteroploidia a. poliploidia 3n, 4n,5n b. aploidia n Mutazioni cromosomiche strutturali Esistono 5 tipi principali di mutazione della struttura dei cromosomi delezione duplicazione inversione traslocazione (reciproca e non reciproca) trasposizione numeriche

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche strutturali numeriche Esistono 5 tipi principali di mutazione della struttura dei cromosomi Esistono 2 tipi di variazioni nel numero dei cromosomi delezione duplicazione inversione

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY Laboratorio di Citogenetica Laboratorio di Biologia Molecolare LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY MODENA, 09 MARZO 2013 Dott.ssa Patrizia Caggiati

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed anche la maggiore dipendenza dalle proteine policomb per

Dettagli

La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal

Dettagli

u filamenti di DNA e proteine u portatori di informazioni u il DNA è ripiegato secondo un pattern preciso

u filamenti di DNA e proteine u portatori di informazioni u il DNA è ripiegato secondo un pattern preciso CITOGENETICA E LA DISCIPLINA CHE STUDIA I CROMOSOMI E LE LORO ALTERAZIONI NUMERICHE E STRUTTURALI http://learn.genetics.utah.edu/content/chromosomes/ u filamenti di DNA e proteine u portatori di informazioni

Dettagli

www.analisicimatti.it

www.analisicimatti.it Il Laboratorio Cimatti da sempre attento alla innovazione tecnologica e allo sviluppo di Eccellenze nella diagnostica prenatale è partner di Bioscience Genomics, uno spin off accademico partecipato dall

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche 16 Mutazioni cromosomiche Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest, contratto n. 512148. La traduzione dall inglese é stata curata dalla Dr. Nadia Ceratto e dal Dr Domenico

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche 16 TROINA (EN) Telefono 0935 936111 http://www.irccs.oasi.en.it/clinica/ Unit%C3%A0%20Operative%20e%20Moduli/uoemod1.asp? livello1=2&livello2=20&descr=35 Mutazioni cromosomiche Dipartimento di Patologia

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

Transizioni Trasversioni. Frameshift. Delezioni Duplicazioni. Inversioni. Traslocazioni. Monoploidia Poliploidia Monosomia Polisomia Nullisomia

Transizioni Trasversioni. Frameshift. Delezioni Duplicazioni. Inversioni. Traslocazioni. Monoploidia Poliploidia Monosomia Polisomia Nullisomia MUTAZIONI CROMOSOMICHE «Nulla ha senso in biologia se non alla luce dell'evoluzione» T Dobzhansky CLASSIFICAZIONE SEMPLIFICATA DELLE MUTAZIONI Missense Sostituzioni Transizioni Trasversioni Nonsense Missense

Dettagli

CENNI DI CITOGENETICA

CENNI DI CITOGENETICA CENNI DI CITOGENETICA CARIOTIPO: definisce il numero e la morfologia dei cromosomi di un individuo. Nell uomo tutte le cellule (ad eccezione delle cellule germinali) hanno cariotipo diploide (23 coppie

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

2. ANALISI dei CROMOSOMI

2. ANALISI dei CROMOSOMI 2. ANALISI dei CROMOSOMI Citogenetica classica - il cariotipo - allestimento di un preparato tessuti analizzabili principali patologie di numero e struttura Citogenetica molecolare tecniche di ibridazione

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

In tutte le nostre cellule il DNA è uguale ma il funzionamento è diverso.

In tutte le nostre cellule il DNA è uguale ma il funzionamento è diverso. DAL GENOTIPO AL FENOTIPO IL GENOTIPO: è il complesso di caratteri genetici di un individuo, cioè di quelli che è capace di trasmettere ai propri discendenti e varia da persona a persona. IL FENOTIPO:è

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare

Dettagli

Le mutazioni cromosomiche

Le mutazioni cromosomiche Le mutazioni cromosomiche Di numero Di forma poliploidie (3n, 4n, ecc.) Trisomie (2n + 1) aneuploidie Monosomie (2n - 1) delezione duplicazione inversione traslocazione Il materiale ereditario degli eucarioti

Dettagli

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Corso di Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Concetti chiave della seconda lezione Il genomadeiplastidie deimitocondrinellepiantesuperiori

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare)

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare) Il checkpoint del fuso mitotico (Pietro Perini-gruppo ciclo cellulare) 1) Prima di approfondire la funzione del checkpoint del fuso mitotico, è opportuno ricordare quali sono le caratteristiche e le funzioni

Dettagli

Alterazioni della struttura dei cromosomi

Alterazioni della struttura dei cromosomi Alterazioni della struttura dei cromosomi Più di un migliaio di sindromi RARE incidenza complessiva 4/1000 nati sono dovute a riarrangiamenti cromosomici Contribuiscono per un 3-5% alle cause di aborto

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI:

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Durante la meiosi, i membri di una coppia allelica si separano in modo simmetrico nelle uova e negli spermatozoi. Questa separazione

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,

Dettagli

1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti

Dettagli

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI?

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? CARATTERE AUTOSOMICO -codificato da geni su cromosomi non sessuali -non ci sono differenze di trasmissione

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

CEQ in CITOGENETICA COSTITUZIONALE 2014 DIAGNOSI PRENATALE E POSTNATALE

CEQ in CITOGENETICA COSTITUZIONALE 2014 DIAGNOSI PRENATALE E POSTNATALE CEQ in CITOGENETICA COSTITUZIONALE 2014 DIAGNOSI PRENATALE E POSTNATALE Per il CEQ in citogenetica costituzionale sono state definite due categorie di performance: sufficiente e insufficiente. Per ottenere

Dettagli

SINDROMI CROMOSOMICHE

SINDROMI CROMOSOMICHE SINDROMI CROMOSOMICHE Lo sviluppo di ciascun organo del corpo è regolato da un gran numero di geni che interagiscono in maniera complessa. Oggi si conoscono bene i meccanismi con cui si ereditano molte

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

LE MALATTIE GENETICHE CLASSE 3 C

LE MALATTIE GENETICHE CLASSE 3 C LE MALATTIE GENETICHE CLASSE 3 C Malattia causata da allele dominante Il nanismo acondroplastico è una malattia causata da un allele dominante; gli individui che ne sono affetti sono di statura molto bassa,

Dettagli

geni e dintorni piccola guida alle malattie ereditarie

geni e dintorni piccola guida alle malattie ereditarie 2 geni e dintorni piccola guida alle malattie ereditarie A cura Regione Toscana Giunta Regionale Dipartimento del diritto alla salute e delle politiche di solidarietà Uoc Sviluppo delle risorse professionali

Dettagli

libricino giallo Vol 1: Una Guida Alle Anomalie Cromosomiche Rare

libricino giallo Vol 1: Una Guida Alle Anomalie Cromosomiche Rare 8588:8588 5/9/08 12:59 Page i il libricino giallo PO Box 2189 Caterham Surrey CR3 5GN England Tel/Fax: +44 (0) 1883 330766 Email: info@rarechromo.org Website: www.rarechromo.org Unique would like to acknowledge

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI SICURO: Eseguito su un semplice prelievo di sangue materno COMPLETO: Trisomia 21 (Sindrome di

Dettagli

Una mappa del corso. Medicina Genetica. Medicina Genomica. Poligenia e genetica dei caratteri continui. Malattie monogeniche

Una mappa del corso. Medicina Genetica. Medicina Genomica. Poligenia e genetica dei caratteri continui. Malattie monogeniche Citogenetica Una mappa del corso Medicina Genetica Medicina Genomica Malattie monogeniche Poligenia e genetica dei caratteri continui Genetica delle popolazioni Mutazioni Citogenetica Mendel Darwin Test

Dettagli

CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono

Dettagli