Anomalie cromosomiche

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Anomalie cromosomiche"

Transcript

1 Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio ottico si parla allora di anomalia o aberrazione cromosomica. Le anomalie cromosomiche possono essere: Costituzionali, se presenti in tutte le cellule dell organismo. Somatiche, quando interessano un piccolo sottogruppo di cellule o tessuti (mosaicismo, neoplasie). Le anomalie costituzionali risultano da alterazioni nelle cellule germinali, nella fecondazione o nei primissimi stadi dello sviluppo embrionale. Le anomalie cromosomiche sono in genere anomalie di numero e anomalie strutturali. 90

2 Anomalie nel numero dei cromosomi Se ne distinguono tre classi: Poliploidia Aneuplodia Mixoploidia (mosaicismo e chimerismo) La poliploidia più comune è la triploidia (3n) determinata dalla fecondazione di un ovulo da parte di due spermatozoi (dispermia) o da una fecondazione che coinvolge un gamete diploide. La tetraploidoia (4n) è invece dovuta al non completamento della prima divisione zigotica. La poliploidia costituzionale è comunque una condizione molto rara. Interessa l 1-3% dei concepimenti, quasi mai vivi alla nascita, ed è incompatibile con la vita. 91

3 Poliploidia 92

4 Cariotipo triploide 69,XXY (57%) 69,XXX (40%) 69,XYY ( 3%) Un corredo cromosomico triploide (3n) è una tra le più frequenti cause di aborto spontaneo (15% delle anomalie cromosomiche nei materiali abortivi; 1/14). Eccezionalmente nei nati vivi ma precocemente letale (1:10.000). Rischio di ricorrenza per la coppia è trascurabile. 93

5 Cariotipo tetraploide (92,XXYY) Un corredo cromosomico tetraploide (4n) è sempre letale. Rappresenta il 6% delle anomalie cromosomiche nei materiali abortivi. Rischio di ricorrenza per la coppia è trascurabile. 94

6 Aneuploidie (1) L aneuploidia è il risultato dell aggiunta di copie di un cromosoma alla coppia normale di omologhi (ad esempio la trisomia) o della perdita di un cromosoma omologo (monosomia). Le cause possono essere: Non-disgiunzione - I cromosomi appaiati, durante la meiosi I, o i cromatidi fratelli, durante la meiosi II, non sono in grado di separarsi. Ritardo anafasico - Un cromosoma non viene incorparato nel nucleo di una delle cellule figlie al termine della divisione cellulare a seguito della sua ritardata migrazione durante l anafase. 95

7 Non-disgiunzione 96

8 Aneuploidie (2) L aneuploidia può avere effetti diversi a seconda se ad essere interessati sono gli autosomi o i cromosomi sessuali. Nullisomia (perdita di un coppia di omologhi) e monosomia (perdita di un cromosoma) sono letali. La trisomia è in genere letale. La trisomia del 13 (sindrome di Patau) e la trisomia del 18 (sindrome di Edwards) possono essere a termine. La trisomia del 21 (sindrome di Down) la sopravvivenza è fino ai 40 anni o più. Quando sono interessati i cromosomi sessuali la situazione è meno drammatica. Condizioni tipo XXX, XXY, XYY creano minori problemi e danno una buona aspettativa di vita. Nella sindrome di Turner (45,X0) il 99% sono aborti spontanei, ma quelli che sopravvivono sono di intelligenza normale ma infertili e con modesti segni fisici. La condizione 45,Y è sempre letale. 97

9 Cariotipo con trisomia 21 98

10 Cariotipo con Sindrome di Turner (45,X0) 99

11 Aneuploidie nei nati vivi Anomalie autosomiche trisomia 21 (sindrome di Down) 1/750 trisomia 18 (sindrome di Edwards) 1/7.000 trisomia 13 (sindrome di Patau) 1/ Anomalie dei cromosomi sessuali Sindrome di Klinefelter (47,XXY) 1/900 maschi Sindrome XYY (47,XYY) 1/1.000 maschi Sindrome della tripla X (47,XXX) 1/1.200 femmine Monosomia X o S. di Turner (45,X0) 1/2.500 femmine 100

12 Mixoploidia Presenza di due o più linee genetiche nello stesso organismo: Mosaicismo (origine dallo stesso zigote) Chimerismo (raro, da due zigoti distinti) Comuni i mosaicismi aneuploidi (difetti di non disgiunzione mitotica in fasi embrionali precoci) 101

13 Anomalie strutturali dei cromosomi (1) Le anomalie strutturali sono il risultato di rotture nei cromosomi in uno o più punti e della loro successiva riparazione. Esse possono essere: Bilanciate - se non c è acquisizione o perdita netta di materiale cromosomico. Non bilanciate - se c è acquisizione o perdita netta di materiale cromosomico. Le rotture cromosomiche derivano da danni al DNA (radiazioni, agenti chimici) o da errori durante i processi di ricombinazione (appaiamento ineguale): Danno riparato correttamente Danno irreparabile (la cellula è avviata all autodistruzione) Riparazione non corretta (anomalie strutturali). 102

14 103

15 Anomalie strutturali dei cromosomi (2) Se in uno stesso cromosoma si verificano due rotture, si osserva di solito uno di questi eventi: Inversione cromosomica - Quando il segmento viene invertito prima di risaldare i due punti (riarrangiamento bilanciato). Delezione interstiziale - I due frammenti terminali vengono saldati, ma il segmento intermedio è perduto (riarrangiamento non bilanciato). Cromosoma ad anello - Le estremità del segmento ai punti di rottura si risaldano formando una struttura ad anello (riarrangiamento non bilanciato). Come risultato di un appaiamento ineguale: Duplicazione Un segmento del cromosoma risulta essere duplicato (riarrangiamento non bilanciato) 104

16 Inversione cromosomica 105

17 Delezione interstiziale 106

18 Cromosoma ad anello 107

19 Duplicazione cromosomica 108

20 Anomalie strutturali dei cromosomi(2) Se le rotture si verificano su due o più cromosomi si possono ottenere cromosomi ibridi e il processo è detto di traslocazione cromosomica. Si conoscono tre tipi di traslocazioni cromosomiche: Traslocazione reciproca - E un riarrangiamento bilanciato che si verifica quando viene scambiato materiale distale ai punti di rottura sui due cromosomi. Fusione centrica (Robertsoniana) - Si verifica quando le rotture avvengono vicino al centromero di due cromosomi acrocentrici. Traslocazione con inserzione - Deriva da tre rotture cromosomiche ed implica l escissione di un frammento ed il suo inserimento in un terzo punto di rottura solitamente su di un altro cromosoma. Tutte queste alterazioni possono anche essere asintomatiche ma i portatori possono essere a rischio di generare monosomia o trisomia parziale nella progenie. 109

21 110

22 Traslocazione reciproca 111

23 Fusione centrica (Robertsoniana) Nell uomo, la traslocazione robertsoniana coinvolge due dei 5 cromosomi acrocentrici (13, 14, 15, 21 e 22) 1-2 Mb di geni per l RNA ribosomiale tra due blocchi di eterocromatina. 112

24 Traslocazione con inserzione 113

25 Conseguenze cliniche delle anomalie strutturali dei cromosomi Sono in genere il risultato di uno sbilancio nell espressione dei geni coinvolti nel riarrangiamento. Anomalie cromosomiche bilanciate (vere) possono essere asintomatiche, tranne il caso di: Una rottura che interrompe un gene importante. Una rottura che altera l espressione di un gene senza interromperlo ma separandolo da un elemento regolatore o spostandolo in una regione eterocromatica. Traslocazioni tra un cromosoma X e un autosoma che sono soggette ad inattivazione non casuale della X. Gli individui portatori di anomalie cromosomiche bilanciate possono avere figli con cariotipi sbilanciati. 114

26 Traslocazione X-autosoma 115

27 Traslocazione reciproca bilanciata 116

28 Traslocazione reciproca bilanciata La formazione di tetravalenti aiuta a capire: solo con la segregazione alternata si formano gameti normali o con traslocazione bilanciata, mentre le segregazioni adiacenti 1 e 2 portano alla traslocazione sbilanciata o alla trisomia 117

29 Traslocazione robertsoniana t(14,21) 118

30 Inversione pericentrica I cromosomi normale e invertito si appaiano formando, rispettivamente, un ansa ed un anello. La ricombinazione all interno dell ansa parziale delezione o duplicazione terminale sbilanciata. 119

31 Inversione paracentrica I cromosomi normale e invertito si appaiano formando, rispettivamente, un ansa ed un anello. La ricombinazione all interno dell ansa forma un cromosoma dicentrico e acentrico (instabili). 120

32 Isocromosoma Sono il prodotto di un anomala fissione del centromero (trasversale e non longitudinale) in anafase. Rari nell uomo ad eccezione di: i(xq) S. di Turner i(21q) S. di Down 121

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie Nullisomia: 2n-2 (morte preimpianto) Monosomia: : 2n-1 (generalmente morte embrionale) Trisomia: :

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards)

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Markers di anomalie cromosomiche - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Sindrome di Turner - Sindrome di Williams - Sindrome di Angelman

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

GENETICA CITOGENETICA MEDICA

GENETICA CITOGENETICA MEDICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA A.A.2015/2016 Prof Alberto E.Turco Me 21.10.2015 Lezioni 15 e 16 CITOGENETICA MEDICA ANOMALIE CROMOSOMICHE (Chromosome Disorders) - Abortività

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni

Dettagli

Che cos e la citogenetica?

Che cos e la citogenetica? Che cos e la citogenetica? Lo studio della: Struttura, funzione ed evoluzione dei cromosomi Comportamento dei cromosomi durante la divisione somatica e germinale La citogenetica nasce nel 1956 quando Tjio

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche strutturali numeriche Esistono 5 tipi principali di mutazione della struttura dei cromosomi Esistono 2 tipi di variazioni nel numero dei cromosomi delezione duplicazione inversione

Dettagli

Esistono 2 tipi di variazioni nel numero dei cromosomi eteroploidia a. poliploidia 3n, 4n,5n b. aploidia n

Esistono 2 tipi di variazioni nel numero dei cromosomi eteroploidia a. poliploidia 3n, 4n,5n b. aploidia n Mutazioni cromosomiche strutturali Esistono 5 tipi principali di mutazione della struttura dei cromosomi delezione duplicazione inversione traslocazione (reciproca e non reciproca) trasposizione numeriche

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

Sperimenta il BioLab Le analisi cromosomiche

Sperimenta il BioLab Le analisi cromosomiche Sperimenta il BioLab Le analisi cromosomiche Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INDICE 1. INTRODUZIONE p. 3 2. STRUTTURA E MORFOLOGIA DEI CROMOSOMI

Dettagli

CLASSIFICAZIONE DELLE MALATTIE GENETICHE

CLASSIFICAZIONE DELLE MALATTIE GENETICHE CLASSIFICAZIONE DELLE MALATTIE GENETICHE - Malattie Monogeniche (Mendeliane) A.D., A.R., X-L. - Malattie Cromosomiche (Anomalie di numero e di struttura) - Malattie Multifattoriali (o Poligeniche) - Malattie

Dettagli

Poligeniche multifattoriali

Poligeniche multifattoriali PATOLOGIA EZIOLOGIA (scienza che studia le cause delle malattie) Agenti di malattia Estrinseci (raggruppano le patologie ambientali e le patologie infettive) Intrinseci (patologia genetica, alterazioni

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

www.analisicimatti.it

www.analisicimatti.it Il Laboratorio Cimatti da sempre attento alla innovazione tecnologica e allo sviluppo di Eccellenze nella diagnostica prenatale è partner di Bioscience Genomics, uno spin off accademico partecipato dall

Dettagli

Transizioni Trasversioni. Frameshift. Delezioni Duplicazioni. Inversioni. Traslocazioni. Monoploidia Poliploidia Monosomia Polisomia Nullisomia

Transizioni Trasversioni. Frameshift. Delezioni Duplicazioni. Inversioni. Traslocazioni. Monoploidia Poliploidia Monosomia Polisomia Nullisomia MUTAZIONI CROMOSOMICHE «Nulla ha senso in biologia se non alla luce dell'evoluzione» T Dobzhansky CLASSIFICAZIONE SEMPLIFICATA DELLE MUTAZIONI Missense Sostituzioni Transizioni Trasversioni Nonsense Missense

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Le mutazioni cromosomiche

Le mutazioni cromosomiche Le mutazioni cromosomiche Di numero Di forma poliploidie (3n, 4n, ecc.) Trisomie (2n + 1) aneuploidie Monosomie (2n - 1) delezione duplicazione inversione traslocazione Il materiale ereditario degli eucarioti

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

2. ANALISI dei CROMOSOMI

2. ANALISI dei CROMOSOMI 2. ANALISI dei CROMOSOMI Citogenetica classica - il cariotipo - allestimento di un preparato tessuti analizzabili principali patologie di numero e struttura Citogenetica molecolare tecniche di ibridazione

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

SINDROMI CROMOSOMICHE

SINDROMI CROMOSOMICHE SINDROMI CROMOSOMICHE Lo sviluppo di ciascun organo del corpo è regolato da un gran numero di geni che interagiscono in maniera complessa. Oggi si conoscono bene i meccanismi con cui si ereditano molte

Dettagli

PATOLOGIA CROMOSOMICA

PATOLOGIA CROMOSOMICA PATOLOGIA CROMOSOMICA CARIOTIPO UMANO NORMALE 4 6,X Y 4 6,X X CARIOTIPO UMANO NORMALE Cariotipo normale, giemsa CARIOTIPO UMANO NORMALE bande G C r o m o s o m a c o n b and e G t e lo m e r o c e ntr

Dettagli

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed anche la maggiore dipendenza dalle proteine policomb per

Dettagli

LE MUTAZIONI. www.slidetube.it Pagina 1

LE MUTAZIONI. www.slidetube.it Pagina 1 LE MUTAZIONI Buongiorno a tutti, io sono una collaboratrice del professor Fazio e oggi lo sostituisco perché non può venire. Questa lezione verte soprattutto sulle mutazioni, meccanismi di formazioni di

Dettagli

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY Laboratorio di Citogenetica Laboratorio di Biologia Molecolare LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY MODENA, 09 MARZO 2013 Dott.ssa Patrizia Caggiati

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA. Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO

L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA. Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO CARIOTIPO UMANO: Struttura a corona di rosario 46 cromosomi:

Dettagli

In tutte le nostre cellule il DNA è uguale ma il funzionamento è diverso.

In tutte le nostre cellule il DNA è uguale ma il funzionamento è diverso. DAL GENOTIPO AL FENOTIPO IL GENOTIPO: è il complesso di caratteri genetici di un individuo, cioè di quelli che è capace di trasmettere ai propri discendenti e varia da persona a persona. IL FENOTIPO:è

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

Divisione riduzionale: meiosi

Divisione riduzionale: meiosi Anomalie genetiche Divisione riduzionale: meiosi Nelle ovaie, con la meiosi si generano 4 nuclei da ogni ovogonio ma uno solo diventerà cellula-uovo mentre gli altri tre degenerano. Nei testicoli ogni

Dettagli

CAUSE INTRINSECHE DI MALATTIA

CAUSE INTRINSECHE DI MALATTIA CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono

Dettagli

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione 1. Crea variabilità sulla quale agisce

Dettagli

CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono

Dettagli

Allestimento di un cariotipo di cromosomi umani

Allestimento di un cariotipo di cromosomi umani Allestimento di un cariotipo di cromosomi umani The picture that established 46 as the chromosome number in man. Reproduced with permission from Ref. 1 (1956) Mendelian Society of Lund for the Scandinavian

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

CENNI DI CITOGENETICA

CENNI DI CITOGENETICA CENNI DI CITOGENETICA CARIOTIPO: definisce il numero e la morfologia dei cromosomi di un individuo. Nell uomo tutte le cellule (ad eccezione delle cellule germinali) hanno cariotipo diploide (23 coppie

Dettagli

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Corso di Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Concetti chiave della seconda lezione Il genomadeiplastidie deimitocondrinellepiantesuperiori

Dettagli

LE MUTAZIONI Modificazioni ereditarie del materiale genetico

LE MUTAZIONI Modificazioni ereditarie del materiale genetico LE MUTAZIONI Modificazioni ereditarie del materiale genetico I diversi tipi di mutazioni Mutazioni geniche (o puntiformi) Mutazioni cromosomiche Mutazioni nel numero dei cromosomi Mutazioni nella struttura

Dettagli

La citogenetica studia la struttura e le alterazioni dei cromosomi.

La citogenetica studia la struttura e le alterazioni dei cromosomi. La citogenetica studia la struttura e le alterazioni dei cromosomi. I cromosomi si presentano come piccoli bastoncelli, a loro volta divisi in due longitudinalmente ed uniti in una zona detta centromero,

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI SICURO: Eseguito su un semplice prelievo di sangue materno COMPLETO: Trisomia 21 (Sindrome di

Dettagli

LA SINDROME DI DOWN LA STORIA

LA SINDROME DI DOWN LA STORIA LA SINDROME DI DOWN LA STORIA La sindrome di Down, che è detta anche trisomia 21 o mongoloidismo, è una malattia causata dalla presenza di una terza copia del cromosoma 21; è la più comune anomalia cromosomica

Dettagli

ANOMALIE CROMOSOMICHE DI STRUTTURA. necessitano di rotture dei cromosomi

ANOMALIE CROMOSOMICHE DI STRUTTURA. necessitano di rotture dei cromosomi ANOMALIE CROMOSOMICHE DI STRUTTURA necessitano di rotture dei cromosomi ANOMALIE CROMOSOMICHE DI STRUTTURA necessitano di rotture dei cromosomi una rottura su un cromosoma ANOMALIE CROMOSOMICHE DI STRUTTURA

Dettagli

ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN

ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN Sinonimi: Trisomia 21 Frequenza : 1/750 nati vivi ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN La sindrome di Down (detta anche

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli

Il G-test aumenta il numero di malattie cromosomiche identificate con un semplice prelievo di sangue materno

Il G-test aumenta il numero di malattie cromosomiche identificate con un semplice prelievo di sangue materno Il G-test aumenta il numero di malattie cromosomiche identificate con un semplice prelievo di sangue materno Roma, 28 gennaio 2016 Cresce in fretta il G-test, il test di screening non invasivo, effettuato

Dettagli

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y L infertilità è considerata dall Organizzazione Mondiale della Sanità una patologia. Per infertilità si intende l assenza di concepimento dopo 12/24 mesi di rapporti mirati non protetti. Il fenomeno dell

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva

Dettagli

Una mappa del corso. Medicina Genetica. Medicina Genomica. Poligenia e genetica dei caratteri continui. Malattie monogeniche

Una mappa del corso. Medicina Genetica. Medicina Genomica. Poligenia e genetica dei caratteri continui. Malattie monogeniche Citogenetica Una mappa del corso Medicina Genetica Medicina Genomica Malattie monogeniche Poligenia e genetica dei caratteri continui Genetica delle popolazioni Mutazioni Citogenetica Mendel Darwin Test

Dettagli

ESTENSIONI E VARIAZIONI DEI PRINCIPI FONDAMENTALI DELL EREDITARIETÀ

ESTENSIONI E VARIAZIONI DEI PRINCIPI FONDAMENTALI DELL EREDITARIETÀ Genetica 2 ESTENSIONI E VARIAZIONI DEI PRINCIPI FONDAMENTALI DELL EREDITARIETÀ Gli alleli letali; Gli alleli multipli; Le interazioni tra i geni; L eredità citoplasmatica Penetranza % di individui che

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

SECONDA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 8-14) AA

SECONDA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 8-14) AA SECONDA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 8-14) AA 2014-2015 1. Nella epistasi: A) una porzione di cromosoma viene eliminata; B) un gene regola l espressione di altri geni; C) il comportamento

Dettagli

geni e dintorni piccola guida alle malattie ereditarie

geni e dintorni piccola guida alle malattie ereditarie 2 geni e dintorni piccola guida alle malattie ereditarie A cura Regione Toscana Giunta Regionale Dipartimento del diritto alla salute e delle politiche di solidarietà Uoc Sviluppo delle risorse professionali

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo LE MUTAZIONI

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo LE MUTAZIONI CORSO DI GENETICA LE MUTAZIONI Generalità sulle mutazioni - 1 La mutazione è un processo che altera la sequenza di basi nel DNA. Generalità sulle mutazioni - 2 Le mutazioni della linea somatica avvengono

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

u filamenti di DNA e proteine u portatori di informazioni u il DNA è ripiegato secondo un pattern preciso

u filamenti di DNA e proteine u portatori di informazioni u il DNA è ripiegato secondo un pattern preciso CITOGENETICA E LA DISCIPLINA CHE STUDIA I CROMOSOMI E LE LORO ALTERAZIONI NUMERICHE E STRUTTURALI http://learn.genetics.utah.edu/content/chromosomes/ u filamenti di DNA e proteine u portatori di informazioni

Dettagli

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Tipi. MUTAZIONI: Tipi, Origini, Conseguenze

Tipi. MUTAZIONI: Tipi, Origini, Conseguenze MUTAZIONI Tipi MUTAZIONI: Tipi, Origini, Conseguenze Origini Mutazioni spontanee MUTAZIONI: Tipi, Origini, Conseguenze FORME TAUTOMERICHE Origini Mutazioni spontanee MUTAZIONI: Tipi, Origini, Conseguenze

Dettagli

INFORMAZIONI SUL TEST

INFORMAZIONI SUL TEST QUALITY OF SCIENCE INFORMAZIONI SULLA SOCIETÀ INFORMAZIONI SUL TEST Sequenom Laboratories, una consociata interamente controllata di Sequenom, Inc., è un laboratorio di diagnostica molecolare riconosciuto

Dettagli

Patologia e Fisiopatologia Generale

Patologia e Fisiopatologia Generale Patologia e Fisiopatologia Generale Dr. Giulio Piluso Dipartimento di Biochimica, Biofisica e Patologia Generale Seconda Università degli Studi di Napoli Tel. 081 5665685 giulio.piluso@unina2.it http://www.webalice.it/giulio.piluso

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli