Soluzioni e tamponi utilizzati per la PCR, senza DNA

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Soluzioni e tamponi utilizzati per la PCR, senza DNA"


1 Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato ( In rosso sono indicati i link a parti del libro. 1. Chi è il colpevole? Sono necessari campioni di DNA prodotti con la PCR; ciascun campione è costituiti da una miscela (mix) di frammenti di diverse lunghezze (bande), corrispondenti ai frammenti ottenibili per amplificazione dei microsatelliti TPOX, VWA, D5S818. La figura riporta le lunghezze indicative, in paia di basi, dei singoli frammenti. TPOX VWA D5S819 Allele a: 482 pb Allele b: 466 pb Allele c: 430 pb Allele d: 414 pb Allele e: 288 pb Allele f: 272 pb Allele g: 244 pb Allele h: 224 pb Allele i: 188 pb Allele l: 168 pb Allele m: 124 pb Allele n: 104 pb Di seguito sono riportate le mix che rappresentano i campioni di DNA appartenenti a vittima (V), sospettati (S) e scena del crimine (SC) (tab. 1.1 ). Per poter essere visualizzato con il SYBR Safe, in ciascun campione, in tutto 10 µl, la concentrazione del DNA deve essere di circa 10 ng/µl (100 ng totali, distribuiti nelle diverse bande presenti nel campione). TABELLA 1.1 MIX 1 = V b + d + e + h + l + n 2 = SC (scena del crimine) = S3 (sospettato 3) a + d + e + h + l S1 (sospettato 1) a + c + e + i + n S2 (sospettato 2) b + d + f + g + i + m C (bianco di PCR) Soluzioni e tamponi utilizzati per la PCR, senza DNA Questo file è una estensione online del corso C. Grazioli, C. Gritti, P. Plevani, G. Viale - Studenti in laboratorio 1

2 2. Identificazione degli OGM Sono necessari campioni di DNA prodotti con la PCR e contenenti frammenti con le lunghezze indicate nella tabella seguente. Ciascun campione contiene 10 µl di DNA alla concentrazione di 10 ng/µl. TABELLA 2.1 BANDA (lunghezza in paia di basi, pb) 1 = gene per una proteina del cloroplasto 484 pb 2 = gene per la zeina 220 pb 3 = campione 189 pb (se il transgene BT è presente) 4 = controllo positivo (presenza transgene BT) 189 pb 5 = controllo negativo (assenza transgene BT) Nessuna banda 6 = bianco di PCR Soluzioni e tamponi utilizzati per la PCR, senza DNA 3. Sano o malato? Per eseguire l intero esperimento sono necessari campioni di DNA prodotti con la PCR, della lunghezza di 376 paia di basi (pb), al cui interno è presente o non è presente un sito di restrizione per MstII: allele β A : frammento di 376 pb con presenza del sito di restrizione; i frammenti risultanti dalla digestione devono avere dimensioni di 175 pb e 201 pb; allele β S : frammento di 376 pb con assenza del sito di restrizione. Ciascun campione contiene 8 µl di DNA (10 ng/µl). TABELLA 3.1 ALLELI 1 = padre (III 1) β A / β S 2 = madre (III 2) β A / β S 3 = primo figlio (IV 1) β A / β A 4 = figlia (IV 2) β A / β A 5 = bambino nato malato (IV 3) β S / β S 6 = probando, in questo caso il feto (IV 4) β A / β S 7 = bianco di PCR Soluzioni e tamponi utilizzati per la PCR, senza DNA Per risparmiare sui tempi di esecuzione dell esperimento è possibile partire da campioni già digeriti. In questo caso i campioni contengono 10 µl di DNA con una miscela di frammenti di 376 pb, 201 pb e 175 pb a seconda del genotipo, come indicato nella tabella 3.2. Le singole bande devono avere una concentrazione di 10 ng/µl per poter essere visualizzate con il SYBR Safe. TABELLA 3.2 BANDE 1 = padre (III 1) 376 pb pb pb 2 = madre (III 2) 376 pb pb pb 3 = primo figlio (IV 1) 201 pb pb 4 = figlia (IV 2) 201 pb pb 5 = bambino nato malato (IV 3) 376 pb 6 = probando, in questo caso il feto (IV 4) 376 pb pb pb 7 = bianco di PCR Soluzioni e tamponi utilizzati per la PCR, senza DNA 2 Questo file è una estensione online del corso C. Grazioli, C. Gritti, P. Plevani, G. Viale - Studenti in laboratorio

3 4. Clonaggio del DNA: bianco o blu? Per eseguire l intero esperimento sono necessari: cellule di Escherichia coli XL1 Blue cresciute in LB + ampicillina fino a ottenere un OD (densità ottica) a 600 nm di 0,3, corrispondente a circa cellule/ml che vengono rese competenti con un trattamento con CaCl 2 ; le cellule così ottenute vanno diluite 1/100 e suddivise in falcon contenenti 5 ml di cellule, 3,5 ml di glicerolo 88% e 2 ml di H 2 O e congelate a 80 C; per ogni studente vanno preparate aliquote da 200 µl in provette eppendorf, diluendo 1:5 con LB la preparazione conservata a 80 C; plasmide puc19 tagliato con EcoRI + frammenti di DNA esogeno tagliati con EcoRI, della lunghezza di pb; plasmide e frammenti servono per preparare la miscela di ligazione (vedi Appendice a pag. 149); campioni già pronti di plasmidi ricombinanti e non ricombinanti, digeriti e non digeriti con EcoRI, secondo la tabella 4.1; ciascun campione contiene 10 µl di plasmide con una concentrazione di 10 ng/µl. TABELLA 4.1 CARATTERISTICHE 1 plasmide puc19 (2686 pb) 2 plasmide non digerito estratto da colonie blu (2686 pb) 3 plasmide ricombinante non digerito estratto da colonie bianche (3900 pb) 8 plasmide non ricombinante estratto da colonie blu digerito con EcoRI (2686 pb, linearizzato) 9 plasmide ricombinante estratto da colonie bianche digerito con EcoRI (2686 pb pb) Per eseguire solo l attività 2 sono necessari due tipi di minicolture batteriche in LB + ampicillina: minicolture di Escherichia coli XL1 Blue trasformate con plasmide puc19; minicolture di Escherichia coli XL1 Blue trasformate con plasmide ricombinante; campioni già pronti di plasmidi ricombinanti e non ricombinanti, digeriti e non digeriti con EcoRI, secondo la tabella 4.1. Le minicolture si possono ottenere prelevando colonie batteriche blu o bianche da piastre già pronte, stemperandole in 500 µl di LB + ampicillina e incubandole a 37 C overnight. A fini didattici, sarebbe opportuno poter mostrare agli studenti piastre con colonie già cresciute, in particolare: piastre con colonie bianche e blu: si ottengono a partire da cellule di Escherichia coli XL1 Blue trasformate con la miscela di ligazione e seminate su piastre di LB agar + ampicillina già trattate con IPTG e X- gal (secondo il protocollo dell attività 1: Bianco o blu?); piastre di controllo positivo con solo colonie blu: si ottengono a partire da cellule di Escherichia coli XL1 Blue trasformate con il plasmide puc19 e seminate su piastre di LB agar + ampicillina già trattate con IPTG e X-gal (secondo il protocollo dell attività 1: Bianco o blu?). Per eseguire solo la corsa elettroforetica sono necessari i campioni di DNA plasmidico indicati nella tabella 4.1, a cui si devono aggiungere i campioni 4, 5, 6, e 7, contenenti DNA plasmidico ricombinante o non ricombinante estratto rispettivamente da colonie bianche e blu, digerito con EcoRI (come i campioni 8 e 9). Ciascun campione contiene 10 µl di plasmide con una concentrazione di circa 10 ng/µl. Questo file è una estensione online del corso C. Grazioli, C. Gritti, P. Plevani, G. Viale - Studenti in laboratorio 3

4 5. Mais blu: dal fenotipo al genotipo Per eseguire l intero esperimento sono necessari almeno 50 cariossidi di mais da piante di una F2, ottenute autofecondando piante eterozigoti per il gene R1 (colored 1): R/r. L allele R determina l accumulo di antociani nell aleurone, l allele r determina l accumulo di antociani nelle radici. Per amplificare il marcatore molecolare bnlg1028 sono necessari i primer indicati in tabella. TABELLA 5.1 Primer forward Primer reverse AGGAAACGAACACAGCAGCT TGCATAGACAAAACCGACGT Nel caso non si possa eseguire la PCR si può fare un elettroforesi caricando campioni di DNA già amplificati estratti da piantine di diverso genotipo. La tabella 5.2 riporta la grandezza dei frammenti di DNA in paia di basi (pb). Ciascun campione contiene 10 µl di DNA, circa 100 ng. TABELLA 5.2 BANDA 1 = R/R 150 pb 2 = r/r 170 pb 3 = R/r 150 pb pb 4 = bianco di PCR Soluzioni e tamponi utilizzati per la PCR, senza DNA 6. Analisi cromosomiche Sono necessarie sospensioni di linfociti B messi in coltura con PHA (phytohaemoagglutinin) e in seguito con colchicina, quindi trattati con soluzione ipotonica e mantenuti in soluzione di fissaggio (metanolo + acido acetico in rapporto 3:1). Si veda alle pagine 53 e 54: Coltura di linfociti per ottenere cromosomi metafasici. Per ogni studente servono circa µl di sospensione cellulare 4 Questo file è una estensione online del corso C. Grazioli, C. Gritti, P. Plevani, G. Viale - Studenti in laboratorio

5 7. Anche i geni possono diventare reporter Per eseguire l esperimento sono necessarie piantine di Arabidopsis thaliana selvatiche e geneticamente modificate per esprimere il gene GUS sotto il controllo di un promotore sensibile al cadmio. Le piantine sono seminate e fatte crescere in condizioni sterili su piastre contenenti terreno di coltura con o senza cadmio, secondo la composizione e le modalità indicate nel protocollo a pag. 134 (Crescita delle piantine di Arabidopsis thaliana). I quattro tipi di piastre occorrenti sono riassunti nella tabella 7.1. TABELLA 7.1 TERRENO senza Cadmio (C) con cadmio (+Cd) senza cadmio (C) con cadmio (+Cd) PIANTINE DI ARABIDOPSIS selvatiche (wt) selvatiche (wt) transgeniche (GUS) transgeniche (GUS) Per amplificare parte del cdna del gene GUS e del gene di controllo S16 sono necessari i primer indicati in tabella. TABELLA 7.2 PRIMER GUS forward GUS reverse S16 forward S16 reverse SEQUENZA ATTACGGCAAAGTGTGGGTC CAGAAAAGCCGCCGACTTCG GGCGACTCAACCAGCTACTGA CGGTAACTCTTCTGGTAACGA Nel caso non si possano eseguire retrotrascrizione e PCR si può fare un elettroforesi caricando campioni di DNA già pronti. La tabella 7.3 riporta la lunghezza dei frammenti di DNA amplificati a partire dal cdna ottenuto da piantine selvatiche o transgeniche cresciute in presenza o assenza di cadmio. Le lunghezze sono indicative ed espresse in paia di basi (pb). Ciascun campione contiene 16 µl di DNA, circa 160 ng. TABELLA 7.3 wt C wt + Cd GUS C GUS + Cd BANDE 450 pb (S16) 450 pb (S16) 450 pb (S16) 1200 pb (GUS) pb (S16) Questo file è una estensione online del corso C. Grazioli, C. Gritti, P. Plevani, G. Viale - Studenti in laboratorio 5

6 8. Separazione e colorazione di proteine Per eseguire l esperimento sono necessari due tipi di estratti proteici da cellule di Saccharomyces cerevisiae (tab. 8.1) trattate con TCA (acido tricloro-acetico) in colorante di caricamento per proteine Laemlii buffer, preparati secondo il seguente protocollo. Estrazione di proteine in TCA (per ogni campione) Partire da (almeno) 10 ml di cellule in fase log ( cellule/ml) Centrifugare 5 a 4000 rpm in falcon da 50 ml Scartare il supernatante, risospendere il pellet in 1 ml di TCA 20%, trasferire la soluzione in eppendorf da 2 ml Centrifugare a rpm per 1 Scartare il supernatante, risospendere il pellet in 1 ml di TCA 20% Centrifugare a rpm per 1 Scartare il supernatante, risospendere il pellet in 50 µl di TCA 20% Aggiungere palline di vetro sterili fino al menisco Vortexare l eppendorf per 3 Aggiungere 100 µl di TCA 5% Recuperare la soluzione con una micropipetta e trasferirla in eppendorf da 1,5 ml Centrifugare a 3000 rpm per 10 Scartare il supernatante, aggiungere 100 µl di Laemlii buffer 2 Aggiungere 60 µl di Tris Base 2M per neutralizzare il ph Bollire i campioni per 5 a 95 C Centrifugare a rpm per 5 Trasferire il supernatante in eppendorf da 1,5 ml Caricare il campione su gel e/o conservarlo a 20 C LAEMLII BUFFER 6 per proteine (NB: si deve usare 2 ) Per 10 ml: Stacking buffer 4 (0,5 M Tris HCl ph 6,8; 0,4% SDS) Glicerolo 90% SDS Ditiotreitolo Blu di Bromofenolo 7 ml 3 ml 1 g 0,93 g 1,2 mg TABELLA 8.1 CONTENUTO 1 estratto proteico da cellule di S. cerevisiae non irraggiate con raggi UV 2 estratto proteico da cellule di S. cerevisiae irraggiate con raggi UV Per ogni campione da caricare nel gel sono necessari 10 µl di estratto proteico. 6 Questo file è una estensione online del corso C. Grazioli, C. Gritti, P. Plevani, G. Viale - Studenti in laboratorio


DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti


Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio


PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in


Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato


Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente


PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA


Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione



PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi


PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica


Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale


Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti


Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!





III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA



PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi


Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine



PROGETTO VERSO IL FUTURO CON L INGEGNERIA GENETICA a.s. 2012/2013 PROGETTO VERSO IL FUTURO CON L INGEGNERIA GENETICA a.s. 2012/2013 PROTOCOLLI SPERIMENTALI FASE 1: Preparazione delle cellule competenti modificato da Maniatis Metodo Materiali Motivazioni Strumenti Utilizzare



ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione


Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano



RISOLUZIONE ENO 24/2004 RICERCA DI SOSTANZE PROTEICHE DI ORIGINE VEGETALE NEI VINI E NEI MOSTI L'ASSEMBLEA GENERALE, Visto l'articolo 2 paragrafo 2 iv dell'accordo del 3 aprile 2001 che istituisce l'organizzazione internazionale


PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi


Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona


Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato


Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno).

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Programma: Giorno 1Preparazione di DNA genomico da foglie 2 - Controllo qualità DNA





scienza come gioco i segreti del DNA

scienza come gioco i segreti del DNA IS science centre immaginario scientifico Laboratorio dell'immaginario Scientifico - Trieste tel. 040224424 - fax 040224439 - e-mail: - indice Estrazione


Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. via Raffaele Garofalo, 133 a/b 00173 Roma (06)


Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail:


Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è



TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi


Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria


Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ORGANISMI


Kit didattico Edvotek: la Tecnica del DNA fingerprinting

Kit didattico Edvotek: la Tecnica del DNA fingerprinting International pbi S.p.A. Milano Copyright pbi MARZO 2003 Kit didattico Edvotek: la Tecnica del DNA fingerprinting Introduzione L analisi del profilo di restrizione del DNA, detto anche DNA fingerprinting,


DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza


Biotecnologie e bonifica ambientale

Biotecnologie e bonifica ambientale Biotecnologie e bonifica ambientale Prof. Laura Martinis Liceo Scientifico G. Marinelli Prof. Massimo Vischi e Luca Marchiol - Facoltà di Scienze Agrarie dell Università di Udine Cl. III B Noi studenti


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza


Detergente enzimi (es. preparato per ammorbidire la

Detergente enzimi (es. preparato per ammorbidire la LABORATORIO 2: ESTRAZIONE ED ANALISI ELETTROFORETICA DI DNA GENOMICO Come fare? Seguiamo 3 semplici passaggi: Detergente enzimi (es. preparato per ammorbidire la carne) Alcol Cooome?? E' così facile??


Il controllo analitico degli OGM

Il controllo analitico degli OGM Il controllo analitico degli OGM Problematiche analitico metodologiche nella tracciabilità degli OGM INDIVIDUAZIONE: l obiettivo è di determinare se un prodotto contiene OGM o no (non da notizie sul tipo


Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (


Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono


Sperimenta il BIOLAB

Sperimenta il BIOLAB Sperimenta il BIOLAB I numeri del BIOLAB Il Maserati porta annualmente al CusMiBio circa 200 alunni dalla 2^ alla 5^ Liceo Scientifico tecnologico per fare 2-3 laboratori di Genetica, Citologia e Biologia



REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità


100bp DNA Ladder H3 RTU

100bp DNA Ladder H3 RTU 100bp DNA Ladder H3 RTU Elettroforesi Una combinazione unica di prodotti di PCR e una serie di plasmidi proprietarie digerito con enzimi di restrizione appropriati per produrre frammenti 12, adatto per


Rottura del tessuto. Omogeneizzazione e rottura delle cellule. Centrifugazione 600 x G per 10 a 4 C. Pellet. Lavaggio.

Rottura del tessuto. Omogeneizzazione e rottura delle cellule. Centrifugazione 600 x G per 10 a 4 C. Pellet. Lavaggio. OBIETTIVO Scopo di questo laboratorio è simulare l isolamento e la separazione di proteine da materiale biologico di partenza. Si parte da tessuto e si procede fino alla separazione della frazione mitocondriale.


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni


SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno


SDS-PAGE/Western blot

SDS-PAGE/Western blot SDS-PAGE/Western blot preparare 2 gels: 7.5% di acrilamide, SPACERS 1.5 mm. Uno verrà utilizzato per il trasferimento su nitrocellulosa, l altro colorato con il blu di coomassie. caricare i campioni dell


Agrobacterium è in grado di trasferire nel genoma vegetale qualsiasi sequenza si trovi delimitata dai right e left borders

Agrobacterium è in grado di trasferire nel genoma vegetale qualsiasi sequenza si trovi delimitata dai right e left borders Agrobacterium è in grado di trasferire nel genoma vegetale qualsiasi sequenza si trovi delimitata dai right e left borders gene di interesse gene di interesse mcs multi cloning site Il gene di interesse


LM Sc.Biosanitarie Ricerca Diagnostica 2013-14 PROTOCOLLO FISH. lezione 12. By NA

LM Sc.Biosanitarie Ricerca Diagnostica 2013-14 PROTOCOLLO FISH. lezione 12. By NA PROTOCOLLO FISH lezione 12 LM Sc.Biosanitarie Ricerca Diagnostica 2013-14 cromosoma sul vetrino sintesi di una sonda complementare marcata con un fluorocromo FISH denaturazione doppia elica di DNA AT C


I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene



ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi


Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione

Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione Per la purificazione del DNA genomico proveniente dai kit di prelievo Oragene e ORAcollect. Per le istruzioni



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli ANALISI OGM SOYA Il progetto si proponeva di verificare le caratteristiche qualitative di diversi lotti di soya rispetto alla contaminazione accidentale da OGM per avere una valutazione indicativa della


III Esercitazione 14-15 gennaio 2015. Tampone buccale Estrazione DNA. Preparazione di gel di agarosio Elettroforesi

III Esercitazione 14-15 gennaio 2015. Tampone buccale Estrazione DNA. Preparazione di gel di agarosio Elettroforesi Corso di Laurea in Ottica e Optometria, Università di Padova Insegnamento di Biologia Dr. Stefania Bortoluzzi, Prof. David Baroni, Dr. Francesca Boaretto III Esercitazione 14-15 gennaio 2015 Sommario schematico



SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio



PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per


Caratterizzazione della comunità microbica

Caratterizzazione della comunità microbica Caratterizzazione della comunità microbica Monitoraggio biologico annuale dell impianto Dipartimento di Biologia Università di Pisa Monitoraggio biologico del reattore Monitoraggio biologico del prototipo


R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale


Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Servizio colture primarie. Istruzioni per l uso di cellule epiteliali bronchiali umane

Servizio colture primarie. Istruzioni per l uso di cellule epiteliali bronchiali umane Servizio colture primarie Istruzioni per l uso di cellule epiteliali bronchiali umane Riassunto del procedimento Il metodo di coltura è basato su due fasi distinte: 1) Espansione del numero di cellule:



ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo INTRODUZIONE Acidi nucleici Gli acidi nucleici sono una famiglia eterogenea di macromolecole distribuite all interno di tutte le cellule


determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Metodi di studio delle proteine : determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Spettrofotometro cuvetta monocromatore rivelatore






AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette



12-05-2010 ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI ESTRAZIONE E PURIFICAZIONE DI ACIDI NUCLEICI Il primo passaggio per la maggior parte delle procedure che verranno trattate in questo corso consiste nell estrazione del DNA (e dell RNA) da materiale biologico, e nella sua purificazione mediante separazione


Tecniche di isolamento

Tecniche di isolamento Tecniche di isolamento Considerazioni generali Spesso il primo passo verso un isolamento di successo è quello di imitare le condizioni ambientali in cui vive l organismo. Ad esempio per alghe marine che


Cinzia Grazioli Cristina Gritti Paolo Plevani Giovanna Viale Studenti in laboratorio. Esperimenti di biologia molecolare e bioinformatica SCIENZE

Cinzia Grazioli Cristina Gritti Paolo Plevani Giovanna Viale Studenti in laboratorio. Esperimenti di biologia molecolare e bioinformatica SCIENZE Cinzia Grazioli Cristina Gritti Paolo Plevani Giovanna Viale Studenti in laboratorio Esperimenti di biologia molecolare e bioinformatica SCIENZE Cinzia Grazioli Cristina Gritti Paolo Plevani Giovanna Viale


Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza


Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari


Metodi di conta microbica

Metodi di conta microbica Metodi di conta microbica esistono differenti metodiche per la determinazione quantitativa dei microrganismi tecniche colturali e non colturali conta diretta ed indiretta il tipo di microrganismo/i ed


Metodologie di microbiologia e genetica

Metodologie di microbiologia e genetica Metodologie di microbiologia e genetica Modulo Metodologie di Genetica Prof.ssa Antonella Furini ESERCITAZIONE N 3 PREPARAZIONE DEL FRAMMENTO E DEL taglio con enzimi di restrizione 1. Taglio del plasmide


Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici





TOSSICOLOGIA. TOSSICO Ogni sostanza capace di provocare in un organismo modificazioni funzionali DANNOSE mediante una azione fisica o chimica.

TOSSICOLOGIA. TOSSICO Ogni sostanza capace di provocare in un organismo modificazioni funzionali DANNOSE mediante una azione fisica o chimica. TOSSICOLOGIA COS E UN FARMACO? - ogni sostanza capace di provocare in un organismo modificazioni funzionali mediante un azione fisica o chimica. - Per l OMS è farmaco una sostanza o un prodotto utilizzato


Preparazione dei campioni da inviare per il sequenziamento

Preparazione dei campioni da inviare per il sequenziamento Preparazione dei campioni da inviare per il sequenziamento PCR preparativa Buffer 10x dntp 2mM Taq polimerasi Oligonucleotidi up e down 100 ng/ul Volume finale 2 ul/campione 2 ul/campione 0,5 U/campione


CERCASI ENZIMA. I.T.S.E. Cecilia DEGANUTTI ALUNNI: Bogojevic Lidija De Stefano Davide Gabara Mihai Andrei Stoian Ioana Versolatto Sara

CERCASI ENZIMA. I.T.S.E. Cecilia DEGANUTTI ALUNNI: Bogojevic Lidija De Stefano Davide Gabara Mihai Andrei Stoian Ioana Versolatto Sara I.T.S.E. Cecilia DEGANUTTI CERCASI ENZIMA ALUNNI: Bogojevic Lidija De Stefano Davide Gabara Mihai Andrei Stoian Ioana Versolatto Sara INSEGNANTE: Prof.ssa Cinello Eugenia TECNICO LABORATORIO: Finiello



PRODUZIONE DI MANGIMI DA PROCESSI FERMENTATIVI DI OLI ESAUSTI PRODUZIONE DI MANGIMI DA PROCESSI FERMENTATIVI DI OLI ESAUSTI Per questa sperimentazione si è utilizzato l olio esausto come substrato per processi fermentativi, ovvero trasformazione di materiale organico


COMET ASSAY ALCALINO (Single Cell Gel Electrophoresis)

COMET ASSAY ALCALINO (Single Cell Gel Electrophoresis) COMET ASSAY ALCALINO (Single Cell Gel Electrophoresis) NORMAL GEL AGAROSE (1%): - SOLUZIONI (Preparazione e Conservazione) - 1,071g in 100ml di PBS - - --> si fanno sciogliere in agitazione a 100-150 C.


Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il


Elettroforesi in gel di Agarosio

Elettroforesi in gel di Agarosio Elettroforesi in gel di Agarosio Le molecole di DNA possono essere separate in base alla loro dimensione, facendole migrare attraverso una matrice polimerica sotto l attrazione di un campo elettrico 1


Ricerca Legionella nei campioni di acqua

Ricerca Legionella nei campioni di acqua 1 1. Scopo e campo di applicazione 2. Diagramma di flusso 3. Riferimenti normativi 4. Descrizione attività 5. Comunicazione dei risultati ed archiviazione 6. Allegati redatto da: R.Galdi verificato da:


ZytoLight SPEC ERG Dual Color Break Apart Probe

ZytoLight SPEC ERG Dual Color Break Apart Probe ZytoLight SPEC ERG Dual Color Break Apart Probe IVD Dispositivo medico-diagnostico in vitro Produttore: ZytoVision GmbH Codice: Z-2138-200 (0.2ml).. Per l identificazione della traslocazione che coinvolge


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare


Perche usare Gel di Poliacrilammide per separare le proteine?

Perche usare Gel di Poliacrilammide per separare le proteine? Perche usare Gel di Poliacrilammide per separare le proteine? I gel di poliacrilammide hanno una trama piu compatta I pori hanno dimensioni minori che nei gel di agarosio Le proteine sono molto piu piccole
