C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione."

Transcript

1 Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni non strutturali che codificano gli RNA degli SNRP e altri complessi. B. Il termine stampo è appropriato, perché uno dei due filamenti di DNA viene usato come stampo per la sintesi dell RNA. Il termine codificante è meno appropriato perché i geni non strutturali non codificano una sequenza polipeptidica. C. Sì C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. C3. Una sequenza consenso è quella più frequentemente osservata in un gruppo di sequenze correlate tra loro. Per esempio le sequenze consenso -35 e -10 si trovano nei promotori batterici. A - 35 la sequenza è TTGACA, ma in presenza di piccole differenze di uno o due nucleotidi funziona ancora efficacemente. Nelle sequenze consenso dei promotori batterici il sito -35 è il principale sito di riconoscimento del fattore sigma. Il sito -10 si chiama anche Pribnow box ed è la posizione in cui la doppia elica si dissocia e inizia la trascrizione. C4. GGCATTGTCA C5. Le mutazioni che rendono una sequenza più simile alla sequenza consenso dovrebbero essere mutazioni up, mentre quelle che deviano dalla sequenza consenso dovrebbero essere mutazioni down. Inoltre, alla regione -10 le coppie AT sono favorite rispetto a quelle GC, perché il ruolo di questa regione è la formazione del complesso aperto. Le coppie AT si separano più facilmente perché contengono due soli legami idrogeno contro i tre della coppia GC. A. Promotore up B. Promotore down C. Promotore up C6. Le posizioni maggiormente conservate sono la prima, la seconda, e la sesta. In generale, quando le sequenze del promotore sono conservate, è più probabile che siano importanti per il legame. Questo spiega perché non si trovano variazioni della sequenza in queste posizioni; se una mutazione altera una posizione conservata, probabilmente il promotore non lavorerà appropriatamente. In confronto, le variazioni della quarta posizione sono tollerate occasionalmente, e lo sono spesso quando cadono nella terza o nella quinta posizione. Le posizioni che tollerano le variazioni sono meno importanti per il legame del fattore sigma. C7. Ciascuna α elica occupa una regione che è pari a circa la metà di un giro completo dell elica. Siccome un giro comprende 10 bp, ogni α elica si lega a circa 5 bp del solco maggiore del DNA. 5 bp corrispondono a circa 1,7 nm, come si vede nella Figura 9.9 del Capitolo 9. Dividendo 1,7 nm per 0,15 nm/aminoacido, si ottiene un valore di 11,3 aminoacidi per elica. Ciò corrisponde a circa 3,15 giri di α elica; ci sono tre giri completi per ciascuna delle due α elica, per un totale di sei giri. C8. Questo non influenzerà la trascrizione, tuttavia influenzerà la traduzione impedendo l inizio della sintesi del polipeptide. C9. L oloenzima consiste del fattore sigma più il core, composto da cinque subunità: α 2 ββ ω.

2 Il fattore sigma ha il ruolo di riconoscere il promotore. Le subunità α sono necessarie per assemblare il core dell enzima e per indebolire il legame al DNA. Le subunità β e β catalizzano i legami covalenti tra ribonucleotidi adiacenti. La subunità ω è importante per l assemblaggio corretto del core dell enzima. C10. Il fattore sigma può scorrere lungo il solco maggiore del DNA. In questo modo, riesce a riconoscere le sequenze esposte nel solco. Quando incontra un promotore, il legame idrogeno tra le basi e il fattore sigma può promuovere una interazione salda e specifica. C11. La mutazione altererebbe le basi in modo che i legami idrogeno con il fattore sigma non potrebbero avvenire del tutto oppure avverrebbero in maniera scorretta. Se guardiamo alla regione - 35 della Figura 12.4 ci possiamo attendere che cambiando i primi due nucleotidi in qualunque modo eccetto T la trascrizione sarebbe inibita. Lo stesso cambiando la terza base in A e la quarta in G o T e l ultima in qualunque modo tranne A. C12. DNA-G/RNA-C DNA-C/RNA-G DNA-A/RNA-U DNA-T/RNA-A Il filamento stampo è: 3' CCGTACGTAATGCCGTAGTGTGATCCCTAG 5' e il filamento codificante è: 5' GGCATGCATTACGGCATCACACTAGGGATC 3'. Il promotore si trova alla sinistra del filamento stampo (nella direzione 3 ). C13. La polimerasi scorre lungo il DNA e forma il complesso aperto, poi si muove. Il complesso aperto è una bolla di circa 17 bp. Dentro il complesso aperto il filamento di DNA che corre in direzione 3 5 viene usato come stampo la sintesi di RNA. Ciò avviene perché singoli nucleotidi si legano allo stampo secondo le regole descritte nella precedente risposta. Fintanto che l RNA polimerasi scorre in avanti, alle spalle del complesso il DNA si riassocia in doppia elica. C14. La terminazione della trascrizione avviene quando vengono rotti i legami idrogeno tra DNA e la parte dell RNA neosintetizzato che si trova nel complesso aperto. C15. Nella terminazione dipendente da rho la proteina ρ si lega al sito rut del trascritto subito dopo che si è formato. La sequenza di RNA forma una struttura ad ansa che induce il blocco dell RNA polimerasi. Dopo questa fermata la proteina ρ, che funziona da elicasi, rompe i legami idrogeno tra DNA e RNA all interno del complesso aperto, e allontana l RNA polimerasi e il trascritto completo. Nella terminazione indipendente da rho non serve alcuna proteina. L RNA forma una forcina che blocca l RNA polimerasi. Durante questa fermata una regione ricca in uracile si lega allo stampo nel complesso aperto. Questo legame è piuttosto instabile, perché i legami idrogeno sono limitati. In questo modo la molecola si dissocia dal complesso aperto e la trascrizione termina. C16. La DNA elicasi e la proteina ρ legano un filamento dell acido nucleico e si muovono in direzione 5 3. Quando incontrano una regione a doppio filamento rompono i legami idrogeno tra i filamenti complementari. La proteina ρ differisce dalla DNA elicasi in quanto la prima scorre sull RNA, la seconda lungo un filamento di DNA. La funzione della DNA elicasi è di promuovere la replicazione del DNA, quella della proteina ρ di promuovere la terminazione della trascrizione. C17. Le somiglianze tra RNA e DNA polimerasi sono le seguenti: 1. Usano entrambe un filamento stampo.

3 2. Sintetizzano entrambe in direzione La sintesi avviene in modo analogo in quanto sono usati dei nucleosidi trifosfati e vengono prodotti dei legami fosfodiesterici tra il nucleotide precedente e quello da inserire. 4. Sono entrambi enzimi processivi che scorrono lungo il filamento stampo di DNA. C18. A. Le mutazioni che alterano la regione ricca in uracile intoducendo guanine e citosine, e le mutazioni che prevengono la formazione della struttura a forcina. B. Le mutazioni che alterano la sequenza di terminazione e le mutazioni che alterano il sito rut. C. Alla fine a valle del gene verrà trovata qualche sequenza di terminazione e la trascrizione terminerà. Questo secondo terminatore può trovarsi in una posizione casuale oppure al termine di un gene adiacente. C19. A. RNA ribosomale (5,8S, 18S, e 28S). B. Tutti gli mrna e alcuni geni per snrna. C. Tutti i geni trna e quelli dell rrna 5S. C20. Il profilo degli elementi di regolazione dei promotori eucariotici è variabile. Nel caso dei geni strutturali trascritti dall RNA polimerasi II, è comune avere un TATA box circa 25 bp a monte del sito di inizio. Il TATA box è importante per l identificazione del sito di inizio della trascrizione e per assemblare l RNA polimerasi con i vari fattori di trascrizione. Il sito di inizio definisce il punto in cui viene avviata la trascrizione. C21. A. L RNA polimerasi non si sarebbe legata al promotore centrale. B. TFIID contiene la proteina che si lega al TATA box. Se questo fattore fosse assente, l RNA polimerasi non si legherebbe al TATA box. C. La formazione del complesso aperto non potrebbe avvenire. C22. Principalmente si tratta di un problema di accessibilità. Quando il DNA è saldamente avvolto agli istoni, per le grandi proteine quali l RNA polimerasi e i fattori di trascrizione diventa difficile riconoscere la corretta sequenza nucleotidica nel DNA e catalizzare il movimento del complesso aperto. Si ritiene che perché avvenga la trascrizione sia necessario un rilassamento del nucleosoma oppure la sua totale disaggregazione. C23. TFIID e TFIIB avrebbero ruoli equivalenti al fattore sigma. Il fattore sigma svolge due azioni: riconosce il promotore (come fa TFIID) e recluta l RNA polimerasi al promotore (come fa TFIIB). C24. Il legame idrogeno è un interazione predominante quando proteine e DNA seguono un processo di assemblaggio e disassemblaggio. Inoltre, possono avvenire legami ionici e interazioni idrofobiche. Non possono avvenire interazioni covalenti. Temperature elevate e elevate concentrazioni saline tendono a rompere i legami idrogeno. Perciò queste condizioni inibirebbero l assemblaggio e favorirebbero il disassemblaggio. C25. Sarebbe rimosso soltanto il primo introne. L RNA maturo sarebbe: esone 1 esone 2 introne 2 esone 3. C26. Nei batteri, l estremità al 5 del trna viene tagliata dall enzima RNasi P. L estremità al 3 viene tagliata da un endonucleasi diversa, e poi alcuni nucleotidi sono digeriti da un esonucleasi che li rimuove fino a raggiungere una sequenza CCA.

4 C27. Lo spliceosoma è composto da molte subunità chiamate snrnp, che contengono snrna e proteine. La funzione dello spliceosoma è di tagliare l RNA in due posizioni, tenere insieme le estremità, e poi catalizzare la formazione del legame covalente tra le due estremità. Durante questo processo, piccole molecole di snrna potrebbero essere coinvolte nel legame del pre-rna e/o potrebbero avere un ruolo catalitico, come l RNA della RNasi P. C28. Un ribozima è un enzima la cui parte catalitica è costituita da RNA. Ne sono esempio RNasiP e gli introni di gruppo I e II. Si ritiene che anche lo spliceosoma contenga dell RNA catalitico. C29. Un gene è colineare quando la sequenza nucleotidica del filamento codificante del DNA (ossia il filamento complementare allo stampo della sintesi di RNA) e la sequenza dell mrna sono identiche. La maggior parte dei geni procariotici e molti geni eucariotici sono colineari. Perciò puoi controllare la sequenza del gene nel DNA e predire la sequenza aminoacidica del polipeptide. Molti geni eucariotici però non sono colineari, essi contengono introni che vengono rimossi dal premrna. C30. Autosplicing significa che una molecola di RNA può maturare se stessa senza il coinvolgimento di proteine. Gli introni di gruppo I e II possono effettuare l autosplicing, sebbene delle proteine possano migliorare la velocità del processo. C31. Negli eucarioti il pre-mrna può subire la formazione del cappuccio, della coda, essere sottoposto allo splicing, all editing, e infine esportato nel nucleo. C32. Nello splicing alternativo avvengono delle variazioni del profilo di rimozione di sequenze, tale per cui gli mrna conterranno diverse combinazioni esoniche. Il significato biologico è che un solo gene potrà produrre più di una proteina, rendendo più efficiente l utilizzo del materiale genetico. Negli organismi pluricellulari lo splicing alternativo è un processo specifico del tipo cellulare. C33. Non si tratta di splicing perché non avviene la ligazione dei frammenti maturi dopo il taglio del trascritto primario. C34. Come si vede nella parte sinistra della Figura 12.15, la guanosina che si lega al sito di legame per la guanosina non possiede un gruppo fosfato. Questo nucleoside si avvolge al 5 dell introne. Perciò l introne non avrà un gruppo fosfato alla sua estremità 5. C35. A. U1 e U4/U6 B. U5 C. U2 C36. U5 C37. La sequenza di 60 nucleotidi si troverebbe nell ansa chiusa, che è la regione tra il sito di splicing al 5 e il sito di ramificazione. Domande sperimentali S1. La posizione dell introne nel cdna è mostrata qui sotto. cdna: 5 -ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGC GGCCAGACTATCACCCAACTCG...INTRONE...GTTACCTACTAGTATATCCCATATA CTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA 3

5 Lo puoi dedurre verificando in che punto la sequenza del DNA genomico diverge da quella del cdna. Il DNA genomico ha i normali siti di splicing descritti nella Figura DNA genomico: 5 ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTAT CACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAA ATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTT TCTTTCTAGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAA TTTGTGTGTGGGTATACAGTATAATCATATA 3 I siti di splicing donatore e accettore sono sottolineati, così come il sito di ramificazione. La A in grassetto è quella che partecipa alla reazione di splicing. S2. Un ansa R è un ansa che si forma quando l RNA viene ibridato con la doppia elica di DNA. Se l RNA forma legami idrogeno con il filamento di DNA l altra elica, che non ha un filamento complementare con cui legarsi, formerà un ansa di estroflessione. L RNA è complementare al filamento stampo, per cui si lega a esso. S3. Introne Introne Introne RNA S4. La banda di 1100 nucleotidi si osserva nel caso del soggetto normale (corsia 1). La delezione che rimuove la regione tra 50 e 100 diminuisce notevolmente la trascrizione, per cui l omozigote produrrà poco o niente trascritto (solo una banda debole, come si vede nella corsia 2). L eterozigote produrrà metà del trascritto dell individuo normale. Il codone di stop non avrà effetti sulla trascrizione ma solo sulla traduzione, per cui la quantità di trascritto della corsia 4 è quella normale. Una mutazione che rimuove il sito accettore di splicing impedisce il processo, per cui l individuo produrrà un trascritto di 1550 nucleotidi circa. Il Northern blot è mostrato di seguito: S5. Quando il frammento di 900 bp viene mescolato con TFIID (corsia 1) la sua migrazione sarebbe ritardata perché TFIID si lega al DNA. Se mescolato con TFIIB (corsia 2) la migrazione non sarebbe ritardata perché TFIIB non può legarsi al DNA senza TFIID. In confronto alla corsia 1 il frammento di 900 bp sarebbe ulteriormente ritardato se mescolato con TFIID e TFIIB (corsia 3)

6 perché entrambi i fattori di trascrizione si legano al DNA. Non sarebbe ritardato quando mescolato a TFIIB e RNA polimerasi (corsia 4), perché manca TFIID che è necessario per il legame delle altre proteine. Infine, se mescolato con TFIID, TFIIB e RNA polimerasi/tfiif, il frammento di 900 bp migrerebbe con grande ritardo perché tutti i quattro fattori risulterebbero legati al DNA (corsia 5). S6. A. Non sarebbe ritardato perchè la proteina ρ non legherebbe l mrna codificato da un gene che viene terminato in maniera indipendente da rho. B. Sarebbe ritardato perché la proteina si legherebbe all mrna. C. Sarebbe ritardato perché U1 si legherebbe al pre-mrna. D. Non sarebbe ritardato perché U1 non si lega a un mrna che ha già rimosso gli introni, ma solo a un pre-mrna S7. A. La regione del gel che dovrebbe comprendere frammenti da 250 a 75 bp non contiene bande. Questa è la regione protetta, ed è lunga 175 coppie di basi. B. In un nucleosoma il DNA è avvolto due volte attorno al core istonico; un nucleosoma contiene 146 bp di DNA. La regione legata a RNA polimerasi/tfiid/tfiib sarebbe di poco più lunga. Perciò, queste proteine avrebbero ricoperto un nucleosoma nel quale era contenuto il DNA. E difficile immaginare (anche se possibile) che proteine grandi quali TFIID, TFIIB e RNA polimerasi II si siano trovate tutte attorno a un solo nucleosoma. Perciò questi risultati indicano più probabilmente che il DNA sia stato rilasciato dal core istonico mentre legato ai fattori di trascrizione e alla RNA polimerasi. S8. A. Una molecola di mrna si legherebbe alla colonna perché possiede la coda di polia, La sequenza di adenine nella coda è complementare alla stringa di timine nella colonna poli-dt, per cui si formano dei legami idrogeno tra loro. Per purificare gli mrna si inizia con un campione di cellule. Esse vengono rotte tramite omogeneizzazione o sonicazione, in modo da rilasciare le macromolecole tra cui gli RNA. Le grandi strutture cellulari come organelli, membrane, ecc, possono essere rimosse mediante un passaggio di centrifugazione, che lascerebbe nel pellet le strutture cellulari e nel sovranatante le molecole solubili. A questo punto usi concentrazioni saline elevate e ph neutrale e versi il sovranatante nella colonna di poli-dt. Gli mrna si legheranno alla colonna, mentre le altre molecole non lo fanno. Infine per rompere i legami idrogeno che legano gli mrna alla colonna aggiungi una soluzione con bassa concentrazione salina e/o ph basico. B. La strategia di base è di aggiungere alla matrice della colonna una stringa di nucleotidi complementare al tipo di RNA che desideri purificare. Per esempio se il tuo RNA contiene la sequenza 5' AUUCCUCCA 3' puoi sintetizzare un oligonucleotide 3' TAAGGAGGT 5' e attaccarlo alla colonna. Per purificare l RNA segui la strategia descritta in A.

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo

ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo INTRODUZIONE Acidi nucleici Gli acidi nucleici sono una famiglia eterogenea di macromolecole distribuite all interno di tutte le cellule

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente:

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente: Materiale Didattico Titolo modulo: Biologia applicata alla ricerca Biomedica LA TRASCRIZIONE Docente: FLUSSI DI INFORMAZIONE ATTRAVERSO LA CELLULA 1. Accessibilità del genoma 2. Assemblaggio del complesso

Dettagli

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti Dall RNA alle proteine La traduzione nei procarioti e negli eucarioti Codice genetico La sequenza dell mrna viene decodificata a gruppi di tre nucleotidi, e tradotta in una sequenza di amminoacidi 4 x

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

CAPITOLO 10. La biosintesi degli acidi nucleici: la replicazione. 10.1 Il flusso dell informazione genetica nella cellula

CAPITOLO 10. La biosintesi degli acidi nucleici: la replicazione. 10.1 Il flusso dell informazione genetica nella cellula La biosintesi degli acidi nucleici: la replicazione CAPITL 10 10.1 Il flusso dell informazione genetica nella cellula La sequenza di basi nel DNA codifica l informazione genetica. La duplicazione del DNA,

Dettagli

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi.

Figura 1. Rappresentazione della doppia elica di DNA e struttura delle differenti basi. Sommario La molecola di DNA è deputata a conservare le informazioni genetiche necessarie per lo sviluppo ed il funzionamento degli organismi viventi. Poiché contiene le istruzioni per la costruzione delle

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Costituzione dei viventi

Costituzione dei viventi Costituzione dei viventi La materia e costituita da elementi chimici in forma pura o in combinazioni dette composti 25 dei 92 elementi naturali sono costituenti essenziali dei viventi 4 (C, O,, N) costituiscono

Dettagli

Perché abbiamo deciso di sequenziare il genoma umano

Perché abbiamo deciso di sequenziare il genoma umano L'immagine sopra rappresenta le tappe fondamentali per la scoperta del genoma umano. Una versione più interattiva della mappa è disponibile nel sito del progetto genoma umano, nella sezione dedicata alla

Dettagli

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R unità 1. La funzione del DN negli organismi La funzione del DN L acido desossiribonucleico o DN (dall inglese deoxyribonucleic acid) è la molecola informazionale delle cellule. Essa contiene e trasmette

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano

trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano trna-ribosoma Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Struttura Acidi Nucleici RNA, DNA acidi nucleici = polinucleotidi (polimeri di nucleotidi) in cui

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli