Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica"

Transcript

1 CL3 - Biotecnologie

2 Esistono Open Tools di Microsoft per migliorare le attività di ricerca scientifica Le informazioni necessarie al progresso scientifico sono spesso difficili da trovare, sommerse nelle profondità del Web, o all'interno di banche dati che non possono essere facilmente accessibili o integrate. Come risultato, molti scienziati lavorano oggigiorno in relativo isolamento, incappando in vicoli ciechi e duplicando inutilmente ricerca esistente.

3 Consente la compilazione dei documenti di Word in base ai termini che appaiono in ontologie. Permette agli autori di aggiungere facilmente collegamenti ipertestuali scientifici come annotazioni semantiche, tratte da ontologie, ai loro documenti e articoli di ricerca.

4 Le ontologie sono creati e mantenuti da diversi ambiti accademici per modellare i loro campi di studio. Le pubblicazioni scientifiche abilitate all uso delle ontologie possono costituire un incentivo alla scoperta scientifica.

5 Ontologie e vocabolari controllati dallo NCBO (National Center for Biomedical Computing): Amphibian gross anatomy ; Biological imaging methods ; Biological process ; BRENDA tissue / enzyme source ; C. elegans development ; C. elegans phenotype ; Cell type ; Cellular component ; Cereal plant trait ; Dictyostelium discoideum anatomy ; Drosophila development ; Drosophila gross anatomy ; Environment Ontology ; Event (INOH pathway ontology) ; Fungal gross anatomy ; Human developmental anatomy, abstract version ; Human developmental anatomy, timed version ; Human disease ; Infectious disease ; Mammalian phenotype ; Mass spectrometry ; Molecular function ; Mosquito gross anatomy ; Mouse adult gross anatomy ; Mouse pathology ; Pathogen transmission ; Pathway ontology ; Physico-chemical methods and properties ; Physicochemical process ; Plant environmental conditions ; Plant growth and developmental stage ; Plant structure ; Protein-protein interaction ; Spider Ontology ; Teleost anatomy and development ; Tick gross anatomy ; Xenopus anatomy and development ; Zebrafish anatomy and development

6 Data base biologici: Protein Data Bank Una risorsa per Studiare macromolecole biologiche. L archivio PDB contiene informazioni riguardo strutture proteiche sperimentalmente determinate, acidi nucleici ecc UniProt Knowledgebase E composto da due sezioni: 1. Una sezione contiene record annotati manualmente con informazioni estratte dalla letteratura e analisi computazionali valutate dai curatori 2. L altra sezione contiene record analizzati computazionalmente e non ancora revisionati che aspettano di essere annotati manualmente. NCBI GenBank/RefSeq Dal National Center for Biotechnology Information: GenBank : database di sequenze genetiche. E una raccolta ragionata di tutte le sequenze di DNA a disposizione del pubblico. Ci sono circa basi in sequenze. RefSeq: raccolta completa ed integrata, non ridondante e commentata di sequenze, tra cui DNA genomico e proteine. RefSeq è utile in studi medici, funzionali e di diversità in quanto fornisce un punto di riferimento per l'annotazione del genoma, l'identificazione di geni e analisi di caratterizzazione, di mutazione e di polimorfismo, studi di espressione ed analisi comparitive. NCBI fornisce inoltre delle RefSeqs per gli organismi tassonomicamente diversi, tra cui eucarioti, batteri e virus. Documenti supplementari sono aggiunti alla collezione quando i dati diventano di dominio pubblico.

7 Il componente di Word 2007 per le Ontologie dovrebbe renderle più accessibili ad un vasto pubblico di autori, facendo in modo che il contenuto semantico sia integrato nell esperienza del redigere. L'obiettivo del componente aggiuntivo per le ontologie è quello di aiutare gli scienziati a scrivere manoscritti che siano facilmente integrabili con le risorse elettroniche esistenti. Per far questo l Ontology Add-in aggiunge al manoscritto informazioni semantiche sotto forma di una indicizzazione tipo mark-up XML allo stesso: i termini trovati, possono poi essere estratte dai file di Word, in cui sono memorizzati sotto forma di tag XML personalizzati. Vengono usate ontologie e vocabolari controllati (dallo NCBO) ed identificatori provenienti da importanti banche dati biologiche.

8 Il codice sorgente per l Add-in Ontology è disponibile sotto una licenza open source. Gli utenti possono migliorare l'add-in o anche di esportarlo in altri sistemi di pubblicazione, facilitando la crescita di editoria scientifica semantica, promuovendo una vasta gamma di attività nel campo della biologia, informatica, chimica e altri ambiti accademici. Di conseguenza, quando i ricercatori eseguiranno interrogazioni strutturate nel Web, sarà più facile trovare documenti strettamente correlati alla loro ricerca ed avere evidente come la scienza si evolve.

9 Ontology Add-in è un progetto fatto in collaborazione con Creative Commons. Creative Commons è un'organizzazione noprofit, fondata nel 2001, che promuove il riuso creativo delle opere intellettuali e artistiche. Le licenze Creative Commons forniscono una gamma flessibile di protezioni e libertà per autori, artisti ed educatori che si basano sul concetto di "tutti i diritti riservati" del diritto d'autore tradizionale per offrire un approccio volontario del tipo "alcuni diritti riservati.

10 Progetto che supporta l inserimento ed rendering di informazioni chimiche in documenti Word Introduce funzionalità come l editor per formule di struttura e altri tipi di rappresentazione.

11 La comunità bioinformatica ha una forte tradizione di open development, code sharing, e supporto cross-platform, e sono oggigiorno disponibili una serie di toolkit di bioinformatica lingua specifici. Questi toolkit promuono la condivisione del codice ed istituiscono standard de facto. Microsoft Biology Foundation (MBF) è un toolkit per la bioinformatica neutrale dal punta di vista linguistico, costruito come una estensione del.net Framework. Attualmente implementa una serie di parser per formati di file comuni in bioinformatica; una serie di algoritmi per la manipolazione del DNA, RNA, e di sequenze di proteine; e una serie di connettori a servizi Web per la biologia, come il servizio BLAST dell NCBI (National Center for Biotechnology Information). MBF è disponibile sotto licenza open source, e quindi gli eseguibili, il codice sorgente, le applicazioni demo, e la documentazione sono scaricabili liberamente.

12 The Comparative Analysis Toolkit (CAT) è un insieme di strumenti software per l'analisi e la visualizzazione di sequenze e strutture biologiche. Il software del toolkit si interfaccia con un sistema database, l'rna Comparative Analysis Database(RCAD). L'analisi comparata è stata usata con successo per decifrare la struttura delle molecole di RNA, e per identificare e caratterizzare nuove strutture RNA.

13 Il database RCAD è il primo sistema di database biologici in grado di immagazzinare sequenze di allineamenti fino alla risoluzione di singoli nucleotidi. Singole righe, colonne e celle di un allineamento possono essere incluse direttamente in istruzioni SQL. Unendo molteplici dimensioni di informazioni, RCAD consente analisi nuove ed Innovative sull RNA. Compie analisi quali statistiche di differenti Sequenze di RNA o l'evoluzione di elementi strutturali di RNA.

14 di Il secondo elemento questo progetto è un pacchetto di visualizzazione per l'analisi di sequenze biologiche e strutture utilizzando l'analisi comparativa. Gli utenti saranno in grado di esplorare le sequenze di allineamenti di sequenza, navigando per tassonomia o per struttura secondaria

15 Questo componente aggiuntivo di Word2007 per redigere articoli consente agli autori ed editori di aprire e salvare file Word nel formato XML della National Library of Medicine, un formato di file che viene utilizzato nella pubblicazione e l'archiviazione di articoli scientifici e tecnici. Oltre le funzionalità sul formato dei file, l'add-in consente che metadati aggiuntivi possano essere catturati in fase di scrittura e fa sì che le informazioni semantiche siano preservate durante il processo di pubblicazione, che è essenziale per attivare la ricerca e l'analisi semantica una volta che gli articoli sono archiviati nei repository informativi. L'add-in mira anche a semplificare la scrittura, la presentazione ed il processo di interazione tra autori e riviste.

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

Basi di dati. Basi di dati = database. Basi di dati

Basi di dati. Basi di dati = database. Basi di dati Basi di dati Da leggere: Cap. 6 Sawyer, Williams (testo A) Basi di dati = database Sono una delle applicazioni informatiche che hanno avuto il maggiore utilizzo in uffici, aziende, servizi -> oggi anche

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

InfoTecna ITCube Web

InfoTecna ITCube Web InfoTecna ITCubeWeb ITCubeWeb è un software avanzato per la consultazione tramite interfaccia Web di dati analitici organizzati in forma multidimensionale. L analisi multidimensionale è il sistema più

Dettagli

DBMS. Esempi di database. DataBase. Alcuni esempi di DBMS DBMS. (DataBase Management System)

DBMS. Esempi di database. DataBase. Alcuni esempi di DBMS DBMS. (DataBase Management System) (DataBase Management System) Sistemi di ges3one di basi di da3 Un Database Management System è un sistema software progettato per consentire la creazione e manipolazione efficiente di database (collezioni

Dettagli

Curriculum Vitae Piero Pignataro

Curriculum Vitae Piero Pignataro INFORMAZIONI PERSONALI Piero Pignataro Via G.Marconi, 39, Baronissi(SA) C.A.P. 84081 089-954317 340-1796552 piero.pignataro@gmail.com Sesso M Data di nascita 30/06/1987 Nazionalità Italiana POSIZIONE RICOPERTA

Dettagli

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati

Dettagli

Uso delle basi di dati DBMS. Cos è un database. DataBase. Esempi di database

Uso delle basi di dati DBMS. Cos è un database. DataBase. Esempi di database Uso delle basi di dati Uso delle Basi di Dati Il modulo richiede che il candidato comprenda il concetto di base dati (database) e dimostri di possedere competenza nel suo utilizzo. Cosa è un database,

Dettagli

Progetto Cluster. Sottoprogetto Bioinformatica

Progetto Cluster. Sottoprogetto Bioinformatica Progetto Cluster Sottoprogetto Bioinformatica CRS4 (Centro di Ricerca, Sviluppo e Studi Superiori in Sardegna) Società costituita nel 1990 svolge attività di ricerca e sviluppo basate sulle tecnologie

Dettagli

Organizzazione delle informazioni: Database

Organizzazione delle informazioni: Database Organizzazione delle informazioni: Database Laboratorio Informatico di base A.A. 2013/2014 Dipartimento di Scienze Aziendali e Giuridiche Università della Calabria Dott. Pierluigi Muoio (pierluigi.muoio@unical.it)

Dettagli

Open Publishing Made Easy!

Open Publishing Made Easy! Open Publishing Made Easy! Seminario Residenziale CIBER Università di Napoli, 11 novembre 2005 Che cos è HyperJournal è un software per creare e gestire riviste scientifiche elettroniche e cartacee. è

Dettagli

Alfresco ECM. La gestione documentale on-demand

Alfresco ECM. La gestione documentale on-demand Alfresco ECM La gestione documentale on-demand Alfresco 3.2 La gestione documentale on-demand Oltre alla possibilità di agire sull efficienza dei processi, riducendone i costi, è oggi universalmente conosciuto

Dettagli

La ricerca bibliografica in ambito infermieristico

La ricerca bibliografica in ambito infermieristico La ricerca bibliografica in ambito infermieristico Per i tutor del corso di laurea in infermieristica A cura di Annalisa Bardelli, su materiale di Annalisa Maiorano Pubmed Pubmed: http: www.pubmed.gov

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Microsoft Office 2007 Master

Microsoft Office 2007 Master Microsoft Office 2007 Master Word 2007, Excel 2007, PowerPoint 2007, Access 2007, Outlook 2007 Descrizione del corso Il corso è rivolto a coloro che, in possesso di conoscenze informatiche di base, intendano

Dettagli

INFORMATICA CORSI DELL'INDIRIZZO TECNICO CLASSI PRIME AMMINISTRAZIONE - FINANZA E MARKETING

INFORMATICA CORSI DELL'INDIRIZZO TECNICO CLASSI PRIME AMMINISTRAZIONE - FINANZA E MARKETING INFORMATICA CORSI DELL'INDIRIZZO TECNICO CLASSI PRIME AMMINISTRAZIONE - FINANZA E MARKETING Modulo propedeutico Le lezioni teoriche sono sviluppate sui seguenti argomenti: Struttura dell elaboratore: CPU,

Dettagli

Enrico Fagnoni BOTK IN A NUTSHELL

Enrico Fagnoni <e.fagnoni@e-artspace.com> BOTK IN A NUTSHELL Enrico Fagnoni BOTK IN A NUTSHELL 20/01/2011 1 Business Ontology ToolKit Business Ontology Toolkit (BOTK) è un insieme estensibile di strumenti per realizzare applicazioni basate

Dettagli

TO61: Applicazione di metodi della fisica teorica a sistemi biologici

TO61: Applicazione di metodi della fisica teorica a sistemi biologici TO61: Applicazione di metodi della fisica teorica a sistemi biologici Obiettivi: Offrire l opportunita ai vari gruppi che in questi ultimi anni, all interno dell INFN, hanno cominciato a lavorare al confine

Dettagli

La gestione dei risultati: ZOTERO, un programma gratuito

La gestione dei risultati: ZOTERO, un programma gratuito La gestione dei risultati: ZOTERO, un programma gratuito Ricerche, citazioni e bibliografie con Zotero Zotero è un estensione di Firefox che consente di raccogliere e gestire risorse bibliografiche e accademiche

Dettagli

Software per lo storage di contenuti multimediali Manuale d'uso

Software per lo storage di contenuti multimediali Manuale d'uso SP1 Software per lo storage di contenuti multimediali Manuale d'uso Il documento Sp1 rappresenta il manuale d'uso del prototipo software per lo storage dei contenuti multimediali. L'utente destinatario

Dettagli

AlboTop. Software di gestione Albo per Ordini Assistenti Sociali

AlboTop. Software di gestione Albo per Ordini Assistenti Sociali AlboTop Software di gestione Albo per Ordini Assistenti Sociali Introduzione AlboTop è il nuovo software della ISI Sviluppo Informatico per la gestione dell Albo professionale dell Ordine Assistenti Sociali.

Dettagli

e-science Bioinformatics

e-science Bioinformatics Luciano Milanesi Luciano Milanesi Institute of Biomedical Technology CNR ABSTRACT. The Bioinformatics community was an early adopter of the Internet and contributed to the e-science development by publishing

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Compilare e gestire bibliografie: i software gratuiti. a cura di Laura Perillo Sistema Bibliotecario di Ateneo Agg. ottobre 2014

Compilare e gestire bibliografie: i software gratuiti. a cura di Laura Perillo Sistema Bibliotecario di Ateneo Agg. ottobre 2014 Compilare e gestire bibliografie: i software gratuiti a cura di Laura Perillo Sistema Bibliotecario di Ateneo Agg. ottobre 2014 I software per la gestione di bibliografie Chiamati reference managers o

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

La soluzione software per la catalogazione, la ricerca e la gestione delle Opere d Arte

La soluzione software per la catalogazione, la ricerca e la gestione delle Opere d Arte La soluzione software per la catalogazione, la ricerca e la gestione delle Opere d Arte LG Software Viale del Lavoro, 21 37036 San Martino Buon Albergo, Verona Contatti Sito: www.lgsoftware.it www.eartgallery.it

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Alveo KML connector. Uno strumento per la pubblicazione di dati geografici in Google Earth.

Alveo KML connector. Uno strumento per la pubblicazione di dati geografici in Google Earth. Alveo KML connector Uno strumento per la pubblicazione di dati geografici in Google Earth. Autori Francesco Marucci, Claudio Zoppellari Settore GIS Cooperativa Alveo, Territorio e geoinformatica via Guerrazzi,

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

GENE ONTOLOGY. Classificare la materia vivente e comprenderla. fcordero@di.unito.it

GENE ONTOLOGY. Classificare la materia vivente e comprenderla. fcordero@di.unito.it GENE ONTOLOGY Classificare la materia vivente e comprenderla Francesca Cordero, Ph.D. Student fcordero@di.unito.it Numero di record nei diversi database / Anno Iazzetti & Cordero Slides Cosa si può chiedere

Dettagli

SVILUPPO ONTOLOGIE PER LA GESTIONE DOCUMENTALE E LORO INTEGRAZIONE ALL INTERNO DI UNA PIATTAFORMA WEB

SVILUPPO ONTOLOGIE PER LA GESTIONE DOCUMENTALE E LORO INTEGRAZIONE ALL INTERNO DI UNA PIATTAFORMA WEB Facoltà di Ingegneria Corso di Laurea Specialistica in Ingegneria Informatica SVILUPPO ONTOLOGIE PER LA GESTIONE DOCUMENTALE E LORO INTEGRAZIONE ALL INTERNO DI UNA PIATTAFORMA WEB Relatore Chiarissimo

Dettagli

WWW.ICTIME.ORG. NVU Manuale d uso. Cimini Simonelli Testa

WWW.ICTIME.ORG. NVU Manuale d uso. Cimini Simonelli Testa WWW.ICTIME.ORG NVU Manuale d uso Cimini Simonelli Testa Cecilia Cimini Angelo Simonelli Francesco Testa NVU Manuale d uso EDIZIONE Gennaio 2008 Questo manuale utilizza la Creative Commons License www.ictime.org

Dettagli

Opendoc DLS Digital Library System

Opendoc DLS Digital Library System Opendoc DLS Digital Library System Opendoc DLS - Digital Library System Chi siamo Opendoc Srl è una società milanese nata a seguito di un'importante esperienza per il Ministero per i Beni e le Attività

Dettagli

Presentazione e dimostrazione di utilizzo

Presentazione e dimostrazione di utilizzo L AMBIENTE OPEN SOURCE A SUPPORTO DELLE BEST PRACTICE DI ITIL un progetto open source per la gestione dei processi ICT Presentazione e dimostrazione di utilizzo Fabio Bottega f.bottega@tecnoteca.it MILANO,

Dettagli

Rappresentazione della Conoscenza. Lezione 10. Rappresentazione della conoscenza, D. Nardi, 2004, Lezione 10 0

Rappresentazione della Conoscenza. Lezione 10. Rappresentazione della conoscenza, D. Nardi, 2004, Lezione 10 0 Rappresentazione della Conoscenza Lezione 10 Rappresentazione della conoscenza, D. Nardi, 2004, Lezione 10 0 Sistemi ed applicazioni Sistemi di rappresentazione della conoscenza basati su logiche descrittive.

Dettagli

ARCHIVIA Plus. Archiviazione ottica e conservazione sostitutiva documenti

ARCHIVIA Plus. Archiviazione ottica e conservazione sostitutiva documenti ARCHIVIA Plus Archiviazione ottica e conservazione sostitutiva documenti ARCHIVIA Plus Archivia Plus è il software per la conservazione sostitutiva e per la gestione dell archivio informatico. Offre la

Dettagli

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)?

PER RIVISTO 18/03/05. Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? FAQ SULLA ICDL PER EDITORI, AUTORI, ILLUSTRATORI ED ALTRI DETENTORI DI DIRITTI RIVISTO 18/03/05 Che cos è la International Children s Library (ICDL - Biblioteca Internazionale Digitale per Bambini)? Chi

Dettagli

Software. Definizione, tipologie, progettazione

Software. Definizione, tipologie, progettazione Software Definizione, tipologie, progettazione Definizione di software Dopo l hardware analizziamo l altra componente fondamentale di un sistema di elaborazione. La macchina come insieme di componenti

Dettagli

CORSO INTEGRATO DI FISICA, INFORMATICA E STATISTICA MEDICA. Modulo di Informatica. test del 16/01/2012 - Polo A

CORSO INTEGRATO DI FISICA, INFORMATICA E STATISTICA MEDICA. Modulo di Informatica. test del 16/01/2012 - Polo A UNIVERSITA DEGLI STUDI di Catania Facoltà di Medicina anno accademico 2011-2012 Prof. Ing. Arena Paolo Prof. Ing. Caffarelli Giovanni CORSO INTEGRATO DI FISICA, INFORMATICA E STATISTICA MEDICA Modulo di

Dettagli

Rapporto tecnico contenente la selezione dei dataset per l addestramento e la convalida del caso di studio relativo all analisi web

Rapporto tecnico contenente la selezione dei dataset per l addestramento e la convalida del caso di studio relativo all analisi web Rapporto tecnico contenente la selezione dei dataset per l addestramento e la convalida del caso di studio relativo all analisi web 16 febbraio 2015 Indice 1 Individuazione dei dataset 1 2 Dataset Repositories

Dettagli

Laboratorio Matematico Informatico 2

Laboratorio Matematico Informatico 2 Laboratorio Matematico Informatico 2 (Matematica specialistica) A.A. 2006/07 Pierluigi Amodio Dipartimento di Matematica Università di Bari Laboratorio Matematico Informatico 2 p. 1/1 Informazioni Orario

Dettagli

L architettura del sistema può essere schematizzata in modo semplificato dalla figura che segue.

L architettura del sistema può essere schematizzata in modo semplificato dalla figura che segue. Il software DigitalRepository/AMBiblioweb (DRBW) è un sistema di gestione completo per repository digitali implementato secondo lo standard MAG 2.0 e successive revisioni, in accordo con il modello OAIS.

Dettagli

Breve descrizione del prodotto

Breve descrizione del prodotto Breve descrizione del prodotto 1. Il software AquaBrowser Library...2 1.1 Le funzioni di Search Discover Refine...3 1.2 Search: la funzione di ricerca e di presentazione dei risultati...3 1.2.1 La configurazione

Dettagli

Thea PDM. Cos è Thea PDM? Il PDM (Product Data Management)

Thea PDM. Cos è Thea PDM? Il PDM (Product Data Management) Thea PDM Il PDM (Product Data Management) Nell'industria manifatturiera il PDM è un software per la raccolta ed organizzazione dei file nelle divere fasi di ideazione, progettazione, produzione ed obsolescenza

Dettagli

principalmente un programma per la gestione di bibliografie: dalla raccolta dei riferimenti alla formattazione delle citazioni

principalmente un programma per la gestione di bibliografie: dalla raccolta dei riferimenti alla formattazione delle citazioni COS È? principalmente un programma per la gestione di bibliografie: dalla raccolta dei riferimenti alla formattazione delle citazioni un programma gratuito: la versione base offre 300 MB di spazio disco

Dettagli

Investing f or Growth

Investing f or Growth Investing for Growth Open Business Solution Software integrato e modulare per la gestione aziendale, OB One permette di soddisfare in maniera semplice ed intuitiva tutte le esigenze contabili, amministrative

Dettagli

Approfondimento: i sistemi di gestione delle basi di dati (DBMS)

Approfondimento: i sistemi di gestione delle basi di dati (DBMS) Approfondimento: i sistemi di gestione delle basi di dati (DBMS) Prerequisito essenziale della funzionalità delle basi di dati è il controllo e la fruibilità dell informazione in esse contenuta: a tale

Dettagli

Sistemi di biblioteche digitali per la ricerca e la didattica: l esperienza del CNR-ISTI

Sistemi di biblioteche digitali per la ricerca e la didattica: l esperienza del CNR-ISTI Sistemi di biblioteche digitali per la ricerca e la didattica: l esperienza del CNR-ISTI Stefania Biagioni e Donatella Castelli Istituto di Scienza e Tecnologie dell Informazione A Faedo CNR stefania.biagioni@isti.cnr.it

Dettagli

I programmi applicativi

I programmi applicativi I programmi applicativi Riferimenti: Curtin cap. 6-8 Console cap. 11.1, 11.3 Versione: 15/04/2007 Facoltà di Farmacia Corso di Informatica 1 Le applicazioni Per svariati compiti specifici Vari applicativi,

Dettagli

MODULO 5 Basi di dati (database)

MODULO 5 Basi di dati (database) MODULO 5 Basi di dati (database) I contenuti del modulo: questo modulo riguarda la conoscenza da parte del candidato dei concetti fondamentali sulle basi di dati e la sua capacità di utilizzarli. Il modulo

Dettagli

Database e Microsoft Access. Ing. Antonio Guadagno

Database e Microsoft Access. Ing. Antonio Guadagno Database e Microsoft Access Ing. Antonio Guadagno Database e Microsoft Access Un Database non è altro che un insieme di contenitori e di strumenti informatici che ci permette di gestire grossi quantitativi

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of

Dettagli

MANUALE D USO SOFTWARE POS DOC 2.0

MANUALE D USO SOFTWARE POS DOC 2.0 MANUALE D USO SOFTWARE POS DOC 2.0 Questo manuale illustra il funzionamento del software POS DOC 2.0. Manuale software POS DOC www.sicurezzapratica.it Pag. 1 COME INIZIARE AD UTILIZZARE IL SOFTWARE 1)

Dettagli

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE?

COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? COME VIENE REALIZZATA UNA RICERCA SPERIMENTALE IN BIOLOGIA MOLECOLARE? A Flusso di attività B - INPUT C Descrizione dell attività D RISULTATO E - SISTEMA PROFESSIONALE 0. RICHIESTA DI STUDIARE E/O INDIVIDUARE

Dettagli

Valutazione di varianti geniche per lo studio di patologie a trasmissione ereditaria, attraverso

Valutazione di varianti geniche per lo studio di patologie a trasmissione ereditaria, attraverso AVVISO DI SELEZIONE DI PERSONALE DOCENTE PER LO SVILUPPO DI SPECIFICI MODULI DIDATTICI PROGETTO DI FORMAZIONE: Formazione di giovani ricercatori esperti nell applicazione della biologia computazionale

Dettagli

potere I efficienza I produttività Drivve Image per scansioni efficienti e controllo dei documenti

potere I efficienza I produttività Drivve Image per scansioni efficienti e controllo dei documenti potere I efficienza I produttività Drivve Image per scansioni efficienti e controllo dei documenti Drivve Image: un modo di lavorare più intelligente Drivve Image è una suite di potenti strumenti software

Dettagli

ERP Commercio e Servizi

ERP Commercio e Servizi ERP Commercio e Servizi Sistema informativo: una scelta strategica In questi ultimi anni hanno avuto grande affermazione nel mercato mondiale i cosiddetti sistemi software ERP. Tali sistemi sono in grado

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Software NEWAGRI Guida rapida all utilizzo

Software NEWAGRI Guida rapida all utilizzo Software NEWAGRI Guida rapida all utilizzo Versione: 1 Autore: Andrea Bondi Data: 10/11/2009 1 Sommario Sommario... 2 1. Introduzione... 3 2. Caratteristiche tecniche ed architettura del sistema... 3 3.

Dettagli

L ARCHIVIAZIONE E LA GESTIONE DATI ATTRAVERSO L INTERAZIONE TRA MICROSOFT ACCESS ED EXCEL 1 INTRODUZIONE

L ARCHIVIAZIONE E LA GESTIONE DATI ATTRAVERSO L INTERAZIONE TRA MICROSOFT ACCESS ED EXCEL 1 INTRODUZIONE Roccatello Ing. Eduard L ARCHIVIAZIONE E LA GESTIONE DATI ATTRAVERSO L INTERAZIONE TRA MICROSOFT ACCESS ED EXCEL 1 INTRODUZIONE Agenda Presentazione docente Definizione calendario Questionario pre corso

Dettagli

Master in Evidence-Based Practice e Metodologia della Ricerca Clinico Assistenziale Mita Parenti. Introduzione ai Database Relazionali

Master in Evidence-Based Practice e Metodologia della Ricerca Clinico Assistenziale Mita Parenti. Introduzione ai Database Relazionali Master in Evidence-Based Practice e Metodologia della Ricerca Clinico Assistenziale Mita Parenti Introduzione ai Database Relazionali Obiettivo e Struttura del corso Comprendere i concetti e gli aspetti

Dettagli

BLUEOCEAN: UN FRAMEWORK PER LA REALIZZAZIONE DI CMS SEMANTICI. 1. La condivisione dell informazione nel Web 2.0: possibilità e limitazioni

BLUEOCEAN: UN FRAMEWORK PER LA REALIZZAZIONE DI CMS SEMANTICI. 1. La condivisione dell informazione nel Web 2.0: possibilità e limitazioni Archeologia e Calcolatori Supplemento 2, 2009, 245-249 BLUEOCEAN: UN FRAMEWORK PER LA REALIZZAZIONE DI CMS SEMANTICI 1. La condivisione dell informazione nel Web 2.0: possibilità e limitazioni L ultimo

Dettagli

Zotero è un estensione di Firefox che consente di raccogliere e gestire risorse bibliografiche e accademiche

Zotero è un estensione di Firefox che consente di raccogliere e gestire risorse bibliografiche e accademiche La gestione dei risultati: ZOTERO, un programma gratuito (vedi filmato su: http://www.screencast.com/users/librarymaniac/folders/default/media/3068bc0b-ec18-4001-8665-858e944bd274) Ricerche, citazioni

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Lezione 1. Introduzione e Modellazione Concettuale

Lezione 1. Introduzione e Modellazione Concettuale Lezione 1 Introduzione e Modellazione Concettuale 1 Tipi di Database ed Applicazioni Database Numerici e Testuali Database Multimediali Geographic Information Systems (GIS) Data Warehouses Real-time and

Dettagli

Dispense Corso Access

Dispense Corso Access Dispense Corso Access Introduzione La dispensa più che affrontare Access, dal punto di vista teorico, propone l implementazione di una completa applicazione Access, mettendo in risalto i punti critici

Dettagli

2.1 Introduzione ai linguaggi di marcatura

2.1 Introduzione ai linguaggi di marcatura Fondamenti di Informatica Sistemi di Elaborazione delle Informazioni Informatica Applicata 2.1 Introduzione ai linguaggi di marcatura Antonella Poggi Anno Accademico 2012-2013 DIPARTIMENTO DI SCIENZE DOCUMENTARIE

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

MODULO 5 Appunti ACCESS - Basi di dati

MODULO 5 Appunti ACCESS - Basi di dati MODULO 5 Appunti ACCESS - Basi di dati Lezione 1 www.mondopcnet.com Modulo 5 basi di dati Richiede che il candidato dimostri di possedere la conoscenza relativa ad alcuni concetti fondamentali sui database.

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Relazione Pinakes3 Analisi modello di business (BOZZA) di Valeriano Sandrucci 08/09/07

Relazione Pinakes3 Analisi modello di business (BOZZA) di Valeriano Sandrucci 08/09/07 Relazione Pinakes3 Analisi modello di business (BOZZA) di Valeriano Sandrucci 08/09/07 1. Introduzione...3 1.2. Application vs Tool... 3 2. Componenti logiche di un modello... 6 3. Ontologie e Semantic

Dettagli

MediaWiki. Giuseppe Frisoni

MediaWiki. Giuseppe Frisoni MediaWiki Giuseppe Frisoni MediaWiki: costruire insieme 1/2 L'enorme successo di Wikipedia, la nota enciclopedia online, è sotto gli occhi di tutti; cosa meno nota, invece, è la piattaforma con cui è progettata.

Dettagli

Configuratore di Prodotto Diapason

Configuratore di Prodotto Diapason Configuratore di Prodotto Diapason Indice Scopo di questo documento...1 Perché il nuovo Configuratore di Prodotto...2 Il configuratore di prodotto...3 Architettura e impostazione tecnica...5 Piano dei

Dettagli

ISTITUTO TECNICO ECONOMICO MOSSOTTI

ISTITUTO TECNICO ECONOMICO MOSSOTTI CLASSE III INDIRIZZO S.I.A. UdA n. 1 Titolo: conoscenze di base Conoscenza delle caratteristiche dell informatica e degli strumenti utilizzati Informatica e sistemi di elaborazione Conoscenza delle caratteristiche

Dettagli

2. Correttezza degli algoritmi e complessità computazionale.

2. Correttezza degli algoritmi e complessità computazionale. TEMI DI INFORMATICA GIURIDICA (attenzione: l elenco di domande non pretende di essere esaustivo!) L informatica giuridica 1. Illustrare i principali ambiti di applicazione dell informatica giuridica. 2.

Dettagli

C.R.M. Custom Relationship Management

C.R.M. Custom Relationship Management Web Solution C.R.M. Custom Relationship Management Overview La soluzione CRM Portal Builder è una piattaforma innovativa per la gestione delle relazioni con i clienti, basata su una struttura modulare

Dettagli

Novità di Crystal Reports XI

Novità di Crystal Reports XI Introduzione Introduzione Questa sezione offre una panoramica di dettagliata dei componenti, delle funzioni e dei vantaggi forniti dalla versione più recente di Crystal Reports. Alcuni tra i più importanti

Dettagli

Reti informatiche L O R E N Z O D I S I L V E S T R O

Reti informatiche L O R E N Z O D I S I L V E S T R O L O R E N Z O D I S I L V E S T R O w w w. d m i. u n i c t. i t / ~ d i s i l v e s t r o d i s i l v e s t r o @ d m i. u n i c t. i t Internet Internet è il nome con cui viene indicata una estesa rete

Dettagli

MICROSOFT WORD LA STAMPA UNIONE

MICROSOFT WORD LA STAMPA UNIONE La stampa unione è una funzione di Microsoft Word che permette di unire un documento Word, che contiene le informazioni destinate a restare invariate in tutte le stampe (il documento principale) con un

Dettagli

OpenOffice.org per tutti. Relatore: Romina Lobina E-mail: lobinar@gulch.crs4.it

OpenOffice.org per tutti. Relatore: Romina Lobina E-mail: lobinar@gulch.crs4.it OpenOffice.org per tutti. Relatore: Romina Lobina E-mail: lobinar@gulch.crs4.it Cos'è OpenOffice.org? È una suite per il lavoro, la scuola e il tempo libero. Installabile ed utilizzabile in tutte le sue

Dettagli

BASI DI DATI. Queste slides sono un adattamento di quelle di Luca Anselma e Gian Luca Pozzato, cui va il mio ringraziamento

BASI DI DATI. Queste slides sono un adattamento di quelle di Luca Anselma e Gian Luca Pozzato, cui va il mio ringraziamento BASI DI DATI Queste slides sono un adattamento di quelle di Luca Anselma e Gian Luca Pozzato, cui va il mio ringraziamento BASI DI DATI (DATABASE, DB) Una delle applicazioni informatiche più utilizzate,

Dettagli

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola

Dettagli

Un nuovo tassello per scoprire il lato oscuro del Genoma

Un nuovo tassello per scoprire il lato oscuro del Genoma Roma, 23 febbraio 2015 COMUNICATO STAMPA Un nuovo tassello per scoprire il lato oscuro del Genoma Un team del dipartimento di Biologia e Biotecnologie "Charles Darwin" della Sapienza, coordinato da Patrizio

Dettagli

3. Confronto tra due sequenze

3. Confronto tra due sequenze 3. Confronto tra due sequenze Esercizio 1: uso di DotLet Il programma DotLet è accessibile dal sito http://myhits.isb-sib.ch/cgi-bin/dotlet, dove può essere utilizzato attraverso un interfaccia utente

Dettagli

Sistemi Informativi Multimediali 1 - Introduzione

Sistemi Informativi Multimediali 1 - Introduzione Che cos è un sistema informativo multimediale? Sistemi Informativi li 1 - Introduzione Augusto Celentano Università Ca Foscari di Venezia Un sistema informativo multimediale (MMDBMS) è un framework che

Dettagli

Il DATABASE Access. Concetti Fondamentali

Il DATABASE Access. Concetti Fondamentali Il DATABASE Access Concetti Fondamentali Con la nascita delle comunità di uomini, si è manifestata la necessità di conservare in maniera ordinata informazioni per poi poterne usufruire in futuro. Basta

Dettagli

Kirey Re.Search 2.0. Piattaforma di ricerca Open Source

Kirey Re.Search 2.0. Piattaforma di ricerca Open Source Kirey Re.Search 2.0 Piattaforma di ricerca Open Source Le esigenze Quando si parla di motori di ricerca si tende a pensare istintivamente solo a quelli utilizzati per effettuare ricerche in Internet, come

Dettagli

COMPA Bologna 7/8/9 novembre 2006. ITIL / CMDBuild: un esempio di progetto di BPR e riuso in ambito ICT

COMPA Bologna 7/8/9 novembre 2006. ITIL / CMDBuild: un esempio di progetto di BPR e riuso in ambito ICT COMPA Bologna 7/8/9 novembre 2006 ITIL / CMDBuild: un esempio di progetto di BPR e riuso in ambito ICT 1 Motivazioni del progetto (1) Il Servizio Sistemi Informativi e Telematici del Comune di Udine è

Dettagli