"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download ""Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là"."

Transcript

1 Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore lentamente chi evita una passione, chi preferisce il nero su bianco e i puntini sulle "i" piuttosto che un insieme di emozioni, proprio quelle che fanno brillare gli occhi, quelle che fanno di uno sbadiglio un sorriso, quelle che fanno battere il cuore davanti all'errore e ai sentimenti. Lentamente muore chi non capovolge il tavolo, chi è infelice sul lavoro, chi non rischia la certezza per l'incertezza, per inseguire un sogno, chi non si permette almeno una volta nella vita di fuggire ai consigli sensati. Lentamente muore chi non viaggia, chi non legge, chi non ascolta musica, chi non trova grazia in se stesso. Muore lentamente chi distrugge l'amor proprio, chi non si lascia aiutare; chi passa i giorni a lamentarsi della propria sfortuna o della pioggia incessante. Lentamente muore chi abbandona un progetto prima di iniziarlo, chi non fa domande sugli argomenti che non conosce, chi non risponde quando gli chiedono qualcosa che conosce. Evitiamo la morte a piccole dosi, ricordando sempre che essere vivo richiede uno sforzo di gran lunga maggiore del semplice fatto di respirare. Soltanto l'ardente pazienza porterà al raggiungimento di una splendida felicità. P. Neruda

2 "Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là". Eugenio Montale

3 IL MAPPAGGIO GENETICO Caratteri mendeliani Caratteri complessi

4 IL MAPPAGGIO GENETICO Caratteri mendeliani Caratteri complessi

5 OBIETTIVO Determinare con quale frequenza due loci vengono separati dalla ricombinazione durante la meiosi

6 Ricombinazione Il mappaggio genetico

7 linkage

8 LOCI DISTANTI LOCI VICINI A a B b A B a b A a A a B B b b A B a b A B a b

9 DEFINIZIONE Due loci si dicono in linkage quando la loro frazione di ricombinazione è < 0.5

10 FRAZIONE DI RICOMBINAZIONE θ= numero di ricombinanti numero totale meiosi

11 Sono questi geni in linkage? 1. Dobbiamo analizzare un numero di famiglie che sono informative per i loci di interesse

12 Sono questi geni in linkage? 2. Noi dobbiamo capire la fase Aa Bb aa bb Aa Bb aa bb X

13 Sono questi geni in linkage? 3. Dobbiamo cercare di capire se ogni bambino ha una combinazione di alleli parentale o se è un ricombinante 3 generazioni!!!

14 Sono questi geni in linkage? 4. E più probabile che noi abbiamo osservato la particolare combinazione di alleli in quella famiglia perchè i geni sono in linkage piuttosto che per il solo caso dovuto ad assortimento indipendente dei cromosomi!!

15 Sono questi geni in linkage? 5. Usiamo il calcolo del lod score

16 Sono questi geni in linkage?

17 Sono questi geni in linkage?

18 Come capire l ordine dei geni e le distanze che li separano? A Il metodo più diretto sarebbe calcolare la frazione di ricombinazione tra geni malattia B C D Ma non avremmo i doppi eterozigoti!!! Abbiamo bisogno di marcatori a posizione nota e riferire la posizione dei geni rispetto a questi

19 MARCATORI Qualsiasi sequenza che consente di distinguere i cromosomi gli uni dagli altri Determinazione dei ricombinanti Più i marcatori sono ravvicinati, maggiore la possibilità di determinare la posizione dei geni con precisione

20 I marcatori genetici

21 STRs

22 4 ripetizioni AATG AATG AATG AATG 6 ripetizioni AATG AATG AATG AATG AATG AATG That s the startpoint for modern ability to perform human identity test

23 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

24 Se dimostro che un carattere in una o più famiglie è in linkage con uno o più marcatori a posizione nota la posizione del gene è prossima a quella del marcatore!

25 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

26 STUDIO DI LINKAGE

27 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

28

29 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

30

31 STUDIO DI LINKAGE A B C D E D14S258 D14S26 D14S257 D14S

32 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

33 Quali cloni nella regione di linkage?

34 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

35 Quali geni nella regione di linkage?

36 CLONAGGIO POSIZIONALE Reclutare famiglie estese Scansione dell intero genoma Testare più loci della stessa regione nelle stesse famiglie e usare i ricombinanti per definire l intervallo minimo dove cercare il gene Identificare i cloni di tutti l area Trovare tutti i geni dell area Trovare mutazioni presenti nei pazienti affetti "Eureka!"

37

38 Diagnosi indiretta per LINKAGE

39 IL MAPPAGGIO GENETICO Caratteri mendeliani Caratteri complessi

40 IL MAPPAGGIO GENETICO Caratteri mendeliani Caratteri complessi

41 STUDIO DI LINKAGE NON PARAMETRICO

42 AFFECTED SIB-PAIR (ASP)... Marker unlinked Marker linked IBD= 2 IBD= 1 IBD= 0 25% 50% 25% 40% 55% 5% TEST STATISTICO: ASP condividono più alleli al marker di quanto atteso il marker è in linkage con il locus del GDS

43 ATTENZIONE!!! Identici di fatto non è uguale a identici per discendenza IBD vs IBS allele 1 è IBD (e IBS) allele 1 è IBS (no IBD) allele 1 è IBS (IBD?) allele 1 è IBS (IBD?)

44 PSORS7 PSORS1 PSORS4 ATOD2 PSORS5 ATOD1 PSORS9 ATOD5 PSORS PSORS5 ATOD3 ATOD5 PSORS8 PSORS PSORS putativi ATOD ATOD putativi PSORS2 ATOD4

45 Mappatura fine della regione Si analizzano le regioni che hanno mostrato linkage (nella( scansione del genoma) Si incrementa il numero di marcatori della regione in studio Riduzione della regione da 10 a 5cM (=~ 5 Mbasi) Ulteriore evidenza di linkage

46 Association Studies Compare allele frequencies in a set of affected individuals to a set of controls The genetic Case-control association design is an important tool for mapping complex trait genes, but it may be influenced by population admixture / heterogeneity The control populations should be matched according to ethnicity as well as other potential confounding factors

47 Definizione del genotipo: la ricerca del gene Studi di associazione: affetti vs non affetti Family-based Caso-controllo

48 TDT Design A1 è trasmesso al malato ed è associato alla malattia

49 Associazione Genetica = Linkage Disequilibrium Più il gene malattia è vicino al marcatore,più a lungo l associazione allele marcatore/malattia persisterà Disease locus Locus 1 Locus 2 Differenti popolazioni possono avere differenti varianti al locus marcatore

50 Gli studi di associazione ricercano differenze tra un gruppo di soggetti affetti e un gruppo di soggetti sani Affetti Controlli Utilizzano il Linkage Disequilibrium per identificare segmenti ancestrali di cromosomi rimasti inalterati poichè non soggetti a ricombinazione

51 Il Linkage Disequilibrium LA MUTAZIONE AVVIENE SU UN CROMOSOMA ANCESTRALE ESPANSIONE DELLA POPOLAZIONE Utilizza le ricombinazioni che avvengono in un intera popolazione FRAMMENTAZIONE DEL CROMOSOMA ORIGINALE IN SEGUITO A RICOMBINA- ZIONE MUTAZIONE PRESENTE SUL CROMOSOMA FONDATORE REGIONE CRITICA

52 Il 65-85% del DNA è costituito da blocchi cromosomici inscindibili che contengono fino a SNPs Questi blocchi sono separati gli uni gli altri da hot spot di ricombinazione Ridotta variabilità (LD), maggiore facilità di mappare geni di suscettibilità Il numero di SNPs da caratterizzare diminuisce, poiché non sono indipendenti tra loro Hot Spot di ricombinazione Blocchi di LD Cromosoma

53 Ciascun blocco, in un individuo, può essere identificato da una specifica combinazione di alleli (SNPs). G G A C A AATATATCGCTATCCGTATACCTAATTGGGGGTGTGTGTACGTAATGCTAGCACGCGCGCCAGGATTAGCTGCCACA AATATATCGCTTTCCGTATACCTAATTTGGGGTGTGTGTACGTAATGCTAGCACGCGCGCCAGGATTAGCTGCCACA AATATATCGCTTTCCGTATACCTAATTTGGGGTGTGTGTACGTACTGCTAGCACGCGCGCCAGGATTAGCTGCCACA AATATATCGCTATCCGTATACCTAATTTGGGGTGTGTGTACGTACTGCTAGCACGCGCGCTAGGATTAGCTGCCACA AATATATCGCTATCCGTATACCTAATTGGGGGTGTGTGTACGTACTGCTAGCACGCGCGCTAGGATTAGCTGCCACA AATATATCGCTATCCGTATACCTAATTGGGGGTGTGTGTACGTACTGCTAGCACGCGCGCTAGGATTAGCTGCCACA A T T A A A G T T T G G A A C C C C C C C T T T A T T A A A G T T T G G A A C C C C C C C T T T

54 Una volta identificata una regione di suscettibilità, si selezionano i geni e le regioni regolative conservate e si analizzano solo gli SNPs in essi compresi Il numero degli SNPs da tipizzare si riduce ulteriormente GENE GENE GENE SNPs SNPs SNPs

55

56 Associazione Genetica = Linkage Disequilibrium Più il gene malattia è vicino al marcatore,più a lungo l associazione allele marcatore/malattia persisterà Disease locus Locus 1 Locus 2 Differenti popolazioni possono avere differenti varianti al locus marcatore

U.s.p.t,un business nel business. La nuova imprenditoria alla portata di tutti,una facile e concreta opportunità di guadagno

U.s.p.t,un business nel business. La nuova imprenditoria alla portata di tutti,una facile e concreta opportunità di guadagno U.s.p.t,un business nel business La nuova imprenditoria alla portata di tutti,una facile e concreta opportunità di guadagno Chi siamo? U.s.p.t. significa letteralmente «Un Sogno per tutti»,i suoi fondatori

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

ANALISI DI LINKAGE (CONCATENAZIONE)

ANALISI DI LINKAGE (CONCATENAZIONE) ANALISI DI LINKAGE (CONCATENAZIONE) L analisi di linkage permette di determinare la posizione cromosomica di un locus responsabile di una determinata malattia/carattere genetico rispetto a marcatori polimorfici

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Mappatura genetica. alberi genealogici (pedigree) stima del rischio genetico (counseling) analisi di linkage (lod score) Paolo Edomi - Genetica

Mappatura genetica. alberi genealogici (pedigree) stima del rischio genetico (counseling) analisi di linkage (lod score) Paolo Edomi - Genetica Mappatura genetica alberi genealogici (pedigree) stima del rischio genetico (counseling) analisi di linkage (lod score) Alberi genealogici Simbologia negli alberi genealogici Eredità autosomica recessiva

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

www.fisiokinesiterapia.biz LE LEGGI DI MENDEL

www.fisiokinesiterapia.biz LE LEGGI DI MENDEL www.fisiokinesiterapia.biz LE LEGGI DI MENDEL Gregor Johann Mendel (1822-1884) Comprese i principi che regolano la trasmissione dei caratteri ereditari alla progenie senza conoscere - l esistenza dei geni

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli

Nobiltà. Rivista di Araldica, Genealogia, Ordini Cavallereschi. Direttore Responsabile - Fondatore: Pier Felice degli Uberti

Nobiltà. Rivista di Araldica, Genealogia, Ordini Cavallereschi. Direttore Responsabile - Fondatore: Pier Felice degli Uberti ISSN 1122 6412 Nobiltà Rivista di Araldica, Genealogia, Ordini Cavallereschi PUBBLICAZIONE BIMESTRALE Direttore Responsabile - Fondatore: Pier Felice degli Uberti Direzione: Piazza Caiazzo, 2-20124 Milano

Dettagli

But remember throughout that no cause is efficient without a predisposition of the body itself, otherwise, external factors which affect one would

But remember throughout that no cause is efficient without a predisposition of the body itself, otherwise, external factors which affect one would But remember throughout that no cause is efficient without a predisposition of the body itself, otherwise, external factors which affect one would affect all. (Galen, 130-200 CE) Paradosso del valore K:

Dettagli

TEORIA CROMOSOMICA : ALLEGATI

TEORIA CROMOSOMICA : ALLEGATI TEORIA CROMOSOMICA : ALLEGATI FIG. 2 a pag. 1 FIG. 5 a pag. 3 FIG. 7 a pag. 5 FIG. 9 a pag. 7 FIG. 3 e 4 a pag. 2 FIG. 6 a pag. 4 FIG. 8 a pag. 6 FIG. 10 e 11 a pag. 8 1 FIGURA 2 Perché sono tutti maschi

Dettagli

IL MIGLIORAMENTO GENETICO ANIMALE E LA GENETICA MOLECOLARE

IL MIGLIORAMENTO GENETICO ANIMALE E LA GENETICA MOLECOLARE IL MIGLIORAMENTO GENETICO ANIMALE E LA GENETICA MOLECOLARE Il miglioramento genetico delle produzioni animali, realizzato sino ad ora, è frutto dell elaborazione elaborazione e applicazioni della teoria

Dettagli

Genetica delle Patologie ad Eredità Complessa

Genetica delle Patologie ad Eredità Complessa Genetica delle Patologie ad Eredità Complessa La maggior parte delle malattie comuni dell adulto (es. diabete mellito e ipertensione) e delle malformazioni congenite (palatoschisi, difetti del tubo neurale)

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

GENETICA GENERALE GENETICA UMANA E MOLECOLARE

GENETICA GENERALE GENETICA UMANA E MOLECOLARE GENETICA GENERALE GENETICA UMANA E MOLECOLARE Come si studiano i geni 1. Trasmissione genetica, studia i fenomeni del passaggio dei caratteri da generazione a generazione (sperimentale: in modelli animali

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione La mappatura dei geni umani SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione Un grande impulso alla costruzione di mappe genetiche è stato dato da le tecniche della

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Il Test dei Tre Filtri di Socrate da meditare e applicare. È Natale ogni volta che... di Madre Teresa di Calcutta

Il Test dei Tre Filtri di Socrate da meditare e applicare. È Natale ogni volta che... di Madre Teresa di Calcutta Il Test dei Tre Filtri di Socrate da meditare e applicare Nell antica Grecia, Socrate era stimato avere una somma conoscenza. Un giorno, un conoscente incontrò il grande filosofo e disse: "Socrate, sapete

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Esistono tre forme di diabete

Esistono tre forme di diabete Il Diabete mellito L insulina regola la captazione del glucosio Incapacità delle cellule di captare il glucosio in circolo iperglicemia e glucosuria Disponendo di meno glucosio le cellule degradano i grassi

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

Identificazione dei geni che causano malattia nell uomo (II) (importante sapere BENE mappatura fisica e genetica)

Identificazione dei geni che causano malattia nell uomo (II) (importante sapere BENE mappatura fisica e genetica) Identificazione dei geni che causano malattia nell uomo (II) (importante sapere BENE mappatura fisica e genetica) Capitolo 16 1 Strategia posizionale CLONAGGIO FUNZIONALE: le basi biochimiche della patogenesi

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Sommario. Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni

Sommario. Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni Sommario Diversità genetica a livello di sequenza Trovare gli SNP Genotipizzare gli SNP Principali applicazioni SNP: definizioni Polimorfismo al singolo nucleotide, in genere si intende la sostituzione

Dettagli

Lavorare con gli adolescenti: emergenze e domande formative di insegnanti ed educatori

Lavorare con gli adolescenti: emergenze e domande formative di insegnanti ed educatori Emanuela M. Torre Lavorare con gli adolescenti: emergenze e domande formative di insegnanti ed educatori Una ricerca tra scuola ed extrascuola ARACNE Copyright MMVIII ARACNE editrice S.r.l. www.aracneeditrice.it

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' PERSONE SOTTOPOSTE AL TEST QUESITO Campione Biologico Tampone

Dettagli

Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA

Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA Nicoletta Sacchi Italian Bone Marrow Donor Registry E.O. Ospedali

Dettagli

La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel La Genetica Il monaco Gregor Mendel (1822-1884) fu il primo a studiare in modo rigoroso il fenomeno della trasmissione dei caratteri ereditari. Per questo, pur non avendo

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 5. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 5. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 5 Domande concettuali C1. Ricombinazione genetica è un termine che si riferisce alla presenza di una nuova combinazione di alleli in un individuo della progenie. Il crossing-over

Dettagli

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2 fenotipo Dominante o recessivo? Scala fenotipica fenotipo A 1 A 1 A 2 A 2 fenotipo A 1 A 2 A 1 dominante A 1 e A 2. codominanti A 2 dominante A 1 dominanza incompleta A 2 dominanza incompleta Nei casi

Dettagli

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie TEST GENETICI INDIRETTI per la diagnosi di patologie genetiche ereditarie Diagnosi molecolare indiretta Quando non è nota la mutazione malattia, la diagnosi molecolare di quella malattia in una data famiglia

Dettagli

Erosione genetica e biodiversità

Erosione genetica e biodiversità Erosione genetica e biodiversità Caratteri qualitativi e quantitativi 5 4 3 2 1 VF = VG + VA h 2 = VG/VF QTL (Quantitative trait loci) Locus genetico in corrispondenza del quale alleli diversi da un punto

Dettagli

Esercitazione corso di Biodiversità Animale e Genetica Molecolare

Esercitazione corso di Biodiversità Animale e Genetica Molecolare Esercitazione corso di Biodiversità Animale e Genetica Molecolare Archiviazione dei dati genotipici: I genotipi di ciascun individuo ai loci analizzati possono essere salvati in un foglio excel come si

Dettagli

Genetica della Conservazione

Genetica della Conservazione Genetica della Conservazione Lezione 4 Genetica delle popolazioni a bassa numerosità Concetti generali Le popolazioni di interesse per la conservazione sono piccole e/o stanno diminuendo la loro numerosità.

Dettagli

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le tre leggi di Mendel, che descrivono la trasmissione dei caratteri ereditari da una generazione all altra, segnano l inizio della

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

La regina Vittoria d Inghilterra ( )

La regina Vittoria d Inghilterra ( ) Il caso emofilia La regina Vittoria d Inghilterra (1819-1901) Cromosoma X umano (Daltonismo Emofilia ) Daltonismo Cosa osservate di differente in questi due pedigree? Emofilia Daltonismo Emofilia Daltonismo

Dettagli

RB CALCOLO DELLE DISTANZE DI MAPPA. In assenza di linkage i fenotipi dovrebbero avere uguale frequenza

RB CALCOLO DELLE DISTANZE DI MAPPA. In assenza di linkage i fenotipi dovrebbero avere uguale frequenza CALCOLO DELLE DISTANZE DI MAPPA Gameti Numero progenie BCY 55 BCy 108 Bc h Y 276 Bc h y 7 bcy 16 bcy 275 bc h Y 125 In assenza di linkage i fenotipi dovrebbero avere uguale frequenza Ovviamente in questo

Dettagli

Polimorfismo: la presenza di due o più forme alleliche in una specie; ovvero la presenza di alleli che mostrano variazioni in una data posizione.

Polimorfismo: la presenza di due o più forme alleliche in una specie; ovvero la presenza di alleli che mostrano variazioni in una data posizione. Polimorfismo: la presenza di due o più forme alleliche in una specie; ovvero la presenza di alleli che mostrano variazioni in una data posizione. Polimorfismi della lunghezza dei frammenti di restrizione

Dettagli

Analisi QTL. Include materiale dal capitolo 20.6 (pag ), vol III, Barcaccia e Falcinelli

Analisi QTL. Include materiale dal capitolo 20.6 (pag ), vol III, Barcaccia e Falcinelli Analisi QTL Include materiale dal capitolo 20.6 (pag 984-1000), vol III, Barcaccia e Falcinelli Interpretazione della distribuzione continua dei caratteri nelle popolazioni naturali e sperimentali Tre

Dettagli

Principi di mappatura genetica. Paolo Edomi - Genetica

Principi di mappatura genetica. Paolo Edomi - Genetica Principi di mappatura genetica Mappa genetica o di associazione cromosoma = mappa lineare posizione dei geni = punti sulla mappa loci genici frequenza di ricombinazione A B A B distanza dei geni > distanza

Dettagli

4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA

Dettagli

La nostra esistenza è attraversata da luci ed ombre:

La nostra esistenza è attraversata da luci ed ombre: La nostra esistenza è attraversata da luci ed ombre: Caratterizzata da numerosi passaggi giovinezza e anzianità salute e malattia crescita e decadenza, Forza e debolezza Gioia e tristezza Sole e nuvole

Dettagli

Sinossi dei disegni di studio

Sinossi dei disegni di studio Sinossi dei disegni di studio di intervento osservazionali serie di casi trasversale ecologici individuali quasisperimentali sperimentali (RCT) coorte caso-controllo Studi caso-controllo Il punto di partenza

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

SOMIGLIANZA TRA INDIVIDUI

SOMIGLIANZA TRA INDIVIDUI SOMIGLIANZA TRA INDIVIDUI Si riferisce alla possibilità di riconoscere delle caratteristiche fenotipiche comuni tra animali diversi, dovute alla loro parentela. PARENTELA Due individui si dicono parenti

Dettagli

Lezione 2: come si descrive il trascorrere del tempo

Lezione 2: come si descrive il trascorrere del tempo Lezione 2 - pag.1 Lezione 2: come si descrive il trascorrere del tempo 2.1. Il tempo: un concetto complesso Che cos è il tempo? Sembra una domanda tanto innocua, eppure Sembra innocua perché, in fin dei

Dettagli

La variabilità genetica: tipi e metodi per studiarla e misurarla

La variabilità genetica: tipi e metodi per studiarla e misurarla La variabilità genetica: tipi e metodi per studiarla e misurarla La variabilità genetica (V.G.) 1. V.G. somatica 2. V.G. gametica intraindividuo 3. V.G. gametica intrapopolazione (polimorfismo) 4. V.G.

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 2. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 2. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 2 Domande concettuali C1. Il lavoro di Mendel dimostrò che i determinanti genetici vengono ereditati con modalità dominante/recessiva. Questo era evidente in molti dei

Dettagli

Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica

Dettagli

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA INDICE pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA 1.1. Il concetto d identificazione... 9 1.2. L identificazione nella storia....

Dettagli

Introduzione al Model-View-Controller (MVC)

Introduzione al Model-View-Controller (MVC) Introduzione al Model-View-Controller (MVC) Maurizio Cozzetto 9 Luglio 2009 Indice 1 Model-View-Controller 1 1.1 Definizione.................................................. 1 1.2 Soluzione...................................................

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI:

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Durante la meiosi, i membri di una coppia allelica si separano in modo simmetrico nelle uova e negli spermatozoi. Questa separazione

Dettagli

Polimorfismi del DNA e loro applicazioni

Polimorfismi del DNA e loro applicazioni Polimorfismi del DNA e loro applicazioni WWW.FISIOKINESITERAPIA.BIZ Lo sviluppo dei marcatori genetici nell uomo TIPO DI MARCATORE N DI LOCI CARATTERISTICHE Gruppi sanguigni ~ 20 Può esserci bisogno di

Dettagli

Abitudini: solo inerzia o un possibile fattore di crescita?

Abitudini: solo inerzia o un possibile fattore di crescita? Abitudini: solo inerzia o un possibile fattore di crescita? Riflessioni sul processo di costruzione delle abitudini e implicazioni per i brand Ivana Ventura Qualitative Business Director Di cosa parliamo?

Dettagli

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari

Dettagli

GENETICA GENERALE ED UMANA LA GENETICA E LA SCIENZA DELL EREDITARIETA, CIOE STUDIA LA TRASMISSIONE DELLE CARATTERISTICHE EREDITARIE, CHE DISTINGUONO UN SOGGETTO DALL ALTRO. NEGLI ULTIMI DECENNI LA GENETICA,

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

l intervento, la ricerca che si sta progettando)

l intervento, la ricerca che si sta progettando) Definizione delle motivazioni che richiedono l attuazione del progetto (contesto e target) Il motivo è quello di lasciare a tutti un pensiero sull essere felici. Definizione chiara e coerente degli obiettivi

Dettagli

LA GENETICA MENDELIANA

LA GENETICA MENDELIANA LA GENETICA MENDELIANA A partire dal 1856, Johann Gregor Mendel (1822 1884) iniziò una lunga serie di esperimenti sulle piante di pisello (Pisum sativum), con le quali era facile effettuare incroci ed

Dettagli

Capitolo 5 Associazione e mappatura genetica negli eucarioti

Capitolo 5 Associazione e mappatura genetica negli eucarioti Capitolo 5 Associazione e mappatura genetica negli eucarioti 5.1 Il gene recessivo sh ( shrunken ) produce nel seme del granturco un endosperma raggrinzito; il suo allele dominante sh + produce, invece,

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Analisi di varianti strutturali e di sequenza in geni candidati per l autismo sul cromosoma 2q

Analisi di varianti strutturali e di sequenza in geni candidati per l autismo sul cromosoma 2q Alma Mater Studiorum - Università di Bologna TESI DI DOTTORATO IN BIOCHIMICA Settore Scientifico Disciplinare MED/03 (GENETICA MEDICA) Analisi di varianti strutturali e di sequenza in geni candidati per

Dettagli

CORSO INTEGRATO DI GENETICA a.a. 2012-2013. Genetica molecolare in medicina: Analisi di Mutazioni. Cristina Bombieri 6 novembre 2012

CORSO INTEGRATO DI GENETICA a.a. 2012-2013. Genetica molecolare in medicina: Analisi di Mutazioni. Cristina Bombieri 6 novembre 2012 CORSO INTEGRATO DI GENETICA a.a. 2012-2013 Genetica molecolare in medicina: Analisi di Mutazioni Cristina Bombieri 6 novembre 2012 APPLICAZIONI DEI POLIMORFISMI DEL DNA IDENTIFICATORI INDIVIDUALITA Controllo

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel Genetica: scienza che studia la trasmissione dei caratteri ereditari (che si trasmettono di generazione in generazione) Carattere: caratteristica esterna, interna o comportamentale

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

Il gioco si evolve. 1-12 mesi: gioco sensomotorio. manipolazione e mantenimento della presa dei giochi, sbattere e lasciare cadere i giochi per terra.

Il gioco si evolve. 1-12 mesi: gioco sensomotorio. manipolazione e mantenimento della presa dei giochi, sbattere e lasciare cadere i giochi per terra. Il gioco si evolve 1-12 mesi: gioco sensomotorio manipolazione e mantenimento della presa dei giochi, sbattere e lasciare cadere i giochi per terra. Il gioco 12-14 mesi: gioco funzionale uso di oggetti

Dettagli

Le strategie mendeliane

Le strategie mendeliane Le strategie mendeliane Il punto di partenza: il rompicapo sull eredità e come l approccio sperimentale innovativo di Mendel aiutò a risolverlo. Il lavoro vero e proprio: l analisi genetica secondo Mendel,compresa

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

"Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple VIII Incontro-Convegno A.C.A.R 2006-2016: DIECI ANNI DI A.C.A.R. Montecatini Terme (PT), 16 Aprile 2016 A.C.A.R "Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

Verso la terapia personalizzata

Verso la terapia personalizzata Verso la terapia personalizzata M.G.Tibiletti Genetista Ospedale di Circolo-Università dell Insubria Varese Soroptimist Club Varese Varese 20 aprile 2013 Test genetici DIAGNOSTICI PRESINTOMATICI PREDITTIVI,

Dettagli

GLI STRUMENTI DI PROMO-COMMERCIALIZZAZIONE PER VALORIZZARE LE PROPOSTE DEL TERRITORIO

GLI STRUMENTI DI PROMO-COMMERCIALIZZAZIONE PER VALORIZZARE LE PROPOSTE DEL TERRITORIO GLI STRUMENTI DI PROMO-COMMERCIALIZZAZIONE PER VALORIZZARE LE PROPOSTE DEL TERRITORIO FEDERICO BELLONI Formatore TEAMWORK Obiettivi della giornata Sviluppare: La comprensione dei principali strumenti per

Dettagli

Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini

Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Dipartimento di Ingegneria della Informazione Via Diotisalvi, 2 56122 PISA ALGORITMI GENETICI (GA) Sono usati per risolvere problemi di ricerca

Dettagli

Progetto Cluster TIPIZZAZIONE GENETICA DELLA POPOLAZIONE SARDA

Progetto Cluster TIPIZZAZIONE GENETICA DELLA POPOLAZIONE SARDA Progetto Cluster TIPIZZAZIONE GENETICA DELLA POPOLAZIONE SARDA 30 Dicembre 2009 1 2 A. INQUADRAMENTO E DATI SALIENTI PREMESSA Sardegna Ricerche ha avviato la realizzazione e organizzazione di un insieme

Dettagli

(LEZIONI 15-21) AA 2014-2015

(LEZIONI 15-21) AA 2014-2015 TERZA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 15-21) AA 2014-2015 1. Il fenomeno dell anticipazione è: A) quel fenomeno per cui in una data famiglia un certo fenotipo patologico si presenta in età

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli