History of DNA Sequencing

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "History of DNA Sequencing"

Transcript

1 History of DNA Sequencing Adapted from Eric Green, NIH; Adapted from Messing & Llaca, PNAS (1998) Efficiency (bp/person/year) Miescher: Discovers DNA Avery: Proposes DNA as Genetic Material Watson & Crick: Double Helix Structure of DNA Holley: Sequences Yeast trna Ala ,500 15,000 25,000 50, , Wu: Sequences λ Cohesive End DNA Sanger: Dideoxy Chain Termination Gilbert: Chemical Degradation Messing: M13 Cloning Hood et al.: Partial Automation Cycle Sequencing Improved Sequencing Enzymes Improved Fluorescent Detection Schemes 50,000, ,000,000, Next Generation Sequencing Improved enzymes and chemistry New image processing

2 2

3 (1) Produzione dello stampo a filamento singolo Evoluzione dei vettori d espressione Utilizzo della PCR (PCR asimmetrica Promotore/operatore M13 Shine-Dalgarno TAG laci BamHI Terminatore Utilizzo di fagemidi oric Ap ori Utilizzo di un fago helper Per M13 e produzione della Forma a singolo filamento Denaturazione del vettore 3

4 DNA sequencing by Capillary Electrophoresis (CE) Resa: circa pb/corsa

5

6 L Algoritmo Phred e l identificazione delle basi 1) I 4 tracciati fluorescenti sono fusi in un unico file 2) il computer calcola il punto dove si aspetta di trovare un picco, basandosi sulla distanza media dei picchi in certe parti della sequenza. La lettera N viene assegnata quando non è possibile individuare una base esatta. 3) calcola i valori massimi locali per ogni serie di tracciati e valuta se ogni picco cade nello spazio previsto 4) Per stabilire se un picco è reale viene indicato un valore soglia di altezza minima e massima 6

7 Le probabilità di errore (P) del programma Phred sono calcolate in base a 4 parametri: 1) la variazione di distanza del picco, al centro, in un intervallo di 7 picchi; 2) il rapporto fra il più alto e il più basso picco non identificato in un dato intervallo; 3) il rapporto fra il più alto e il più basso picco in un intervallo con tre picchi; 4) il n di basi tra quella in esame e quella più vicina non identificata

8 Determinazione della qualità delle sequenze: algoritmo Phred valore di affidabilità: Phred-score Phred-score = - 10 log10 P ( probabilità di errore) Phred-score = 10 P=1/10 Phred-score = 20 P=1/100 Phred-score = 30 P=1/1000 ok! Al termine dell analisi, Phred genera un file in cui ad ogni base è assegnato il corrispondente Phred-score

9 L Algoritmo Phred e l identificazione delle basi 1) I 4 tracciati fluorescenti sono fusi in un unico file 2) il computer calcola il punto dove si aspetta di trovare un picco, basandosi sulla distanza media dei picchi in certe parti della sequenza. La lettera N viene assegnata quando non è possibile individuare una base esatta. 3) calcola i valori massimi locali per ogni serie di tracciati e valuta se ogni picco cade nello spazio previsto 4) Per stabilire se un picco è reale viene indicato un valore soglia di altezza minima e massima 9

10 Le probabilità di errore (P) del programma Phred sono calcolate in base a 4 parametri: 1) la variazione di distanza del picco, al centro, in un intervallo di 7 picchi; 2) il rapporto fra il più alto e il più basso picco non identificato in un dato intervallo; 3) il rapporto fra il più alto e il più basso picco in un intervallo con tre picchi; 4) il n di basi tra quella in esame e quella più vicina non identificata

11 Determinazione della qualità delle sequenze: algoritmo Phred valore di affidabilità: Phred-score Phred-score = - 10 log10 P ( probabilità di errore) Phred-score = 10 P=1/10 Phred-score = 20 P=1/100 Phred-score = 30 P=1/1000 ok! Al termine dell analisi, Phred genera un file in cui ad ogni base è assegnato il corrispondente Phred-score

12 L Algoritmo Phred e l identificazione delle basi 1) I 4 tracciati fluorescenti sono fusi in un unico file 2) il computer calcola il punto dove si aspetta di trovare un picco, basandosi sulla distanza media dei picchi in certe parti della sequenza. La lettera N viene assegnata quando non è possibile individuare una base esatta. 3) calcola i valori massimi locali per ogni serie di tracciati e valuta se ogni picco cade nello spazio previsto 4) Per stabilire se un picco è reale viene indicato un valore soglia di altezza minima e massima 12

13 Le probabilità di errore (P) del programma Phred sono calcolate in base a 4 parametri: 1) la variazione di distanza del picco, al centro, in un intervallo di 7 picchi; 2) il rapporto fra il più alto e il più basso picco non identificato in un dato intervallo; 3) il rapporto fra il più alto e il più basso picco in un intervallo con tre picchi; 4) il n di basi tra quella in esame e quella più vicina non identificata

14 Determinazione della qualità delle sequenze: algoritmo Phred valore di affidabilità: Phred-score Phred-score = - 10 log10 P ( probabilità di errore) Phred-score = 10 P=1/10 Phred-score = 20 P=1/100 Phred-score = 30 P=1/1000 ok! Al termine dell analisi, Phred genera un file in cui ad ogni base è assegnato il corrispondente Phred-score

15 Next-gen sequencers From John McPherson, OICR 100 Gb 10 Gb AB/SOLiDv3, Illumina/GAII short-read sequencers (10+Gb in bp reads, >100M reads, 4-8 days) bases per machine run 1 Gb 100 Mb 10 Mb 1 Mb 454 GS FLX pyrosequencer ( Mb in bp reads, 0.5-1M reads, 5-10 hours) ABI capillary sequencer ( Mb in bp reads, 96 reads, 1-3 hours) 10 bp 100 bp 1,000 bp read length 15

16 Pyrosequencing - Solid Phase Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res

17 Pyrosequencing - Liquid Phase Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res

18 Pyrogram Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res

19 454 LifeSciences Sequencer

20 %5B77r5p8IBwJk%5D.cfm

21 SOLiD_video_final.html 21

22

23 APPLICAZIONI DELLE TECNICHE DI SEQUENZIAMENTO Whole Genome Sanger (old-gen) Sequencing Human (early drafts), model organisms, bacteria, viruses and mitochondria (chloroplast), low coverage Now-Gen Sequencing New human (!), individual genome, 1,000 normal, 25,000 cancer matched control pairs, rare-samples RNA cdna clones, ESTs, Full Length Insert cdnas, other RNAs RNA-Seq: Digitization of transcriptome, alternative splicing events, mirna Communities Environmental sampling, 16S RNA populations, ocean sampling, Human microbiome, deep environmental sequencing, Bar-Seq Other Epigenome, rearrangements, ChIP-Seq 23

24 Elenco dei siti che contengono informazioni sul Progetto Genoma Umano e sui frammenti di DNA sequenziati.

25 Sequenziamento: Applicazioni in ambito biomedico Sequenziamento di genomi umani individuali a scopo preventivo o farmacoterapeutico. Analisi dettagliata delle mutazioni presenti in cloni cancerosi Associazione Genotipo-Fenotipo Profilo di espressione genica complessivo in vitro e in situ a tutti gli stadi di sviluppo di un organismo multicellulare Diversità Microbica (studi metagenomici) Eteroplasmia Mitocondriale 25

26 454-based Mutation Detection DNA from X tumor samples Pooled with equal concentration PCR amplification with Y primer pairs Pool PCR products 454 sequencing SNP/Indel Detection Using ssahasnp and BreakPointRead Reads with G12 mutation in KRAS Reads with 15 bp deletion in EGFR 26

27 Solexa Approach to Exon Sequencing Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 gdna Fragment and hybridize to Solexa capture array Elute 454 Sequencing Analyze Exon sequences Courtesy of R.A. Gibbs 27

28 GBM (Glioblastoma multiforme): Somatic mutations (Shared 20 genes, 84 tumors; orthogonal validation pending) Samples *Indels included ASXL1 BMPR1A CDK4 CDK6 CDKN2A CDKN2B CHIC2 CYP27B1 EGFR FBXW7 FGFR1 KIT LRRN2 MDM4 MET PDGFRA Pink: 1 mutation Red: 2 mutations PLAG1 PTEN RB1 TP53 28

29 Studio del trascrittoma e ricerca di splicing alternativi Può essere usato per il sequenziamento massivo del trascrittoma, da cui dedurre la frequenza delle sequenze e quindi gli splicing alternativi

30 Analisi Metagenomica: una autostrada per la conoscenza di batteri che non sopravvivono in coltura. 30

31 Sequenziamento del tratto nucleotidico delle immunoglobuline (Ig) relativo al riarrangiamento della regione variabile CDR3, specifica di ogni clone tumorale: - da utilizzare nell analisi in neoplasie linfoidi di tipo B; - per il monitoraggio della malattia minima residua; - come base per la produzione di vaccini anti-idiotipici paziente-specifici.

32 HIV Software allinea sequenza con WT Rileva Mutazioni Singole o combinazioni di mutazioni in grado di dare resistenza ai farmaci Accesso a Banca Dati

33

34 Monitoring Changes in Genomic DNA Identify mutations Examine genomic instability such as in certain cancers and tumors (gene amplifications, translocations, deletions) Identify polymorphisms (SNPs) Diagnosis: chips have been designed to detect mutations in p53, HIV, and the breast cancer gene BRCA-1 Analizzare gli elementi che controllano l espressione genica

35 Applications in Drug Discovery Drug Discovery Identify appropriate molecular targets for therapeutic intervention (small molecule / proteins) Monitor changes in gene expression in response to drug treatments (up / down regulation) Analyze patient populations (SNPs) and response Targeted Drug Treatment Pharmacogenomics: individualized treatments Choosing drugs with the least probable side effects

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/

Biotecnologie Mediche. Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Cinzia Di Pietro 0953782055 dipietro@unict.it http://www.bgbunict.it/ Biotecnologie Mediche Tecnologie da applicare per la salute dell uomo Biotecnologie Mediche Prevenzione Diagnostica

Dettagli

RICERCA TRASNAZIONALE e TRASLAZIONALE

RICERCA TRASNAZIONALE e TRASLAZIONALE Roma, 3 dicembre 2012 RICERCA TRASNAZIONALE e TRASLAZIONALE Gianluca Gaidano, M.D., Ph.D Division of Hematology Department of Translational Medicine Amedeo Avogadro University of Eastern Piedmont Novara-Italy

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Progetto Genoma Umano

Progetto Genoma Umano Progetto Genoma Umano Perché il Progetto Genoma? La determinazione e la conoscenza dell intera sequenza genomica sembrano essere la condizione necessaria per comprendere la completa biologia di un determinato

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti

Dettagli

Oncologici: sistemi e politiche per la sostenibilità

Oncologici: sistemi e politiche per la sostenibilità Oncologici: sistemi e politiche per la sostenibilità Pierluigi Navarra Convegno Nazionale SIFEIT: Innovazione e sostenibilità delle politiche farmaceutiche: quale futuro? Roma, 19 Novembre 2014 Forecasting

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno

Dettagli

Biodiversità Molecolare: aspetti di base e nuove tecnologie

Biodiversità Molecolare: aspetti di base e nuove tecnologie Biodiversità Molecolare: aspetti di base e nuove tecnologie Graziano PESOLE Università di Bari & IBBE-CNR, Bari, Italy Seminari sulla Biodiversità Bari, 18 Febbraio 2011 La Biodiversità Per biodiversità

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI 1953: scoperta del DNA (Watson e Crick) CENNI STORICI 1977: metodo di Sanger per il sequenziamento del DNA (pubblicazione della

Dettagli

Commissione Studi Biologici

Commissione Studi Biologici Commissione Studi Biologici FIL-MRD Network Pier Paolo Piccaluga Ilaria Del Giudice, Sara Galimberti, Simone Ferrero, Marco Ladetto Marzia Cavalli, Elena Ciabatti, Irene Della Starza, Luciana De Novi,

Dettagli

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze

sara.graziano1985@libero.it Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Curriculum Vitae SARA GRAZIANO Informazioni personali Cognome Nome Indirizzo Telefono E-mail Cittadinanza Data di nascita Sesso Settore professionale Graziano Sara sara.graziano1985@libero.it Italiana

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

Tecniche biofisiche basate su nanopori

Tecniche biofisiche basate su nanopori Tecniche biofisiche basate su nanopori -Pori di dimensione nanometrica -Attraverso membrane lipidiche o inorganiche -Di natura proteica o scavati con tecnologie top-down Possono essere impiegati per -Studiare

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Bell, Nature 421: 414, 2003. Tratta da lezioni di genetica Prof. PF Pignatti

Bell, Nature 421: 414, 2003. Tratta da lezioni di genetica Prof. PF Pignatti La scoperta della doppia elica mezzo secolo fa ha coinvolto la pratica medica con lentezza, ma sono probabili trasformazioni significative nei prossimi 50 anni. Bisogna cambiare la pratica medica e la

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Unità tecnica UTAGRI Laboratori INN e GEN

Unità tecnica UTAGRI Laboratori INN e GEN Unità tecnica UTAGRI Laboratori INN e GEN FOODFLAVOUR PL 77.2 Metodologie diagnostiche innovative per la caratterizzazione delle comunità microbiche Responsabile: Annamaria Bevivino Partecipanti: Patrizia

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Polimorfismi del DNA e loro applicazioni

Polimorfismi del DNA e loro applicazioni Polimorfismi del DNA e loro applicazioni WWW.FISIOKINESITERAPIA.BIZ Lo sviluppo dei marcatori genetici nell uomo TIPO DI MARCATORE N DI LOCI CARATTERISTICHE Gruppi sanguigni ~ 20 Può esserci bisogno di

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Associazione Giuseppe Dossetti Terapia Personalizzata. Giampaolo Tortora

Associazione Giuseppe Dossetti Terapia Personalizzata. Giampaolo Tortora Associazione Giuseppe Dossetti La Terapia Personalizzata Terapia Personalizzata Il Laboratorio applicato alla Clinica Giampaolo Tortora Cattedra di Oncologia Medica e UOC di Oncologia Medica Facoltà di

Dettagli

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY) http://www.molecularstation.com/molecular-biology-images/data/502/human-genome-gene.png

Dettagli

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it)

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it) La Tecnologia dei Microarray Tor Vergata Aprile 2011 (Susana.Bueno@caspur.it) SH Friend and RB Stoughton, The Magic of Microarray, Scientific American, February. 2002, pp. 44-49 Vogliamo sapere velocemente

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Cytologic, cytogenetic and genomic study of tumor stem cell lines from glioblastoma multiforme and evaluation of antineoplastic drugs effects

Cytologic, cytogenetic and genomic study of tumor stem cell lines from glioblastoma multiforme and evaluation of antineoplastic drugs effects Cytologic, cytogenetic and genomic study of tumor stem cell lines from glioblastoma multiforme and evaluation of antineoplastic drugs effects GLIOBLASTOMA CANCER STEM MULTIFORME CELLS (CSCs) (GBM) Tumore

Dettagli

Analisi di dati RNA-Seq. Alberto Ferrarini

Analisi di dati RNA-Seq. Alberto Ferrarini Analisi di dati RNA-Seq Alberto Ferrarini Il dogma centrale della biologia molecolare DNA Replicazione RNA Trascrizione Traduzione PROTEIN Geni sono trascritti da DNA ad mrnache lascia il nucleo e viene

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Mutazioni di EGFR nel carcinoma polmonare: epidemiologia e metodi di valutazione

Mutazioni di EGFR nel carcinoma polmonare: epidemiologia e metodi di valutazione Mutazioni di EGFR nel carcinoma polmonare: epidemiologia e metodi di valutazione Ludovini Vienna Laboratorio di biologia molecolare SC Oncologia Medica Azienda Ospedaliera-Universitaria Perugia Il tumore

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

La biologia molecolare nell'era delle target therapies: perchè è necessario un feedback continuo tra la clinica ed il laboratorio?

La biologia molecolare nell'era delle target therapies: perchè è necessario un feedback continuo tra la clinica ed il laboratorio? IV Edizione Cors o ECM ROMA 9-10 Maggio 2013 Hotel Shangri-La Corsetti La Biologia Molecolare applicata alla pratica clinica La biologia molecolare nell'era delle target therapies: perchè è necessario

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

Cancer mutations and targeted therapies in cells, mice and patients. Alberto Bardelli

Cancer mutations and targeted therapies in cells, mice and patients. Alberto Bardelli Cancer mutations and targeted therapies in cells, mice and patients Alberto Bardelli Institute for Cancer Research and Treatment University of Torino - Medical School Le analisi molecolari sui tumori umani,

Dettagli

Studi genomici nei microorganismi

Studi genomici nei microorganismi Studi genomici nei microorganismi Edoardo Puglisi Istituto di Microbiologia Facoltà di Agraria Università Cattolica del Sacro Cuore Piacenza, Italy BioDNA Workshop La genomica al servizio dell agricoltura

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti

Dettagli

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA 1 I PROGETTI OMICI Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA Studia il contenuto in mrna di una cellula (in differenti fasi di sviluppo, in risposta a vari stimoli o a

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

SETTIMANA 05 24-03-2014 25-03-2014 26-03-2014 27-03-2014 28-03-2014 LUN MAR MER GIO VEN

SETTIMANA 05 24-03-2014 25-03-2014 26-03-2014 27-03-2014 28-03-2014 LUN MAR MER GIO VEN SETTIMANA 01 24-02-2014 25-02-2014 26-02-2014 27-02-2014 28-02-2014 05-S:Introduzione al seq. Solanacee 18-S:Introduzione al seq. Drupacee 10-11 INTRODUZIONE GIORNATEGENOMICHE 06-S: Sequenziamento Solanacee

Dettagli

Scheda di presentazione del progetto. Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica

Scheda di presentazione del progetto. Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica Scheda di presentazione del progetto Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica Obiettivi del progetto Lo scopo di questo progetto e quello di

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

ABI-7700 User Bulletin #5

ABI-7700 User Bulletin #5 ABI-7700 User Bulletin #5 1. halogen tungsten lamp 2b. emission filters 3. intensifier 5. ccd detector 350,000 pixels 2a. excitation filters 4. sample plate www.biorad.com 3 Real-time qpcr - La fluorescenza

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome)

particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome) particolare sequenza di purine e pirimidine elica localmente sinistrorsa andamento a zig-zag (da cui il nome) i due solchi, maggiore e minore, dell'elica B sono qui sostituiti da un singolo (profondo)

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori

Dettagli

Elenco dei test di patologia cromosomica e molecolare

Elenco dei test di patologia cromosomica e molecolare Elenco dei test di patologia cromosomica e molecolare Test Metodo utilizzato Osservazioni, indicazioni Amplificazione genica Her2/neu nei carcinoma mammari e gastrici L amplificazione genica di Her2/neu

Dettagli

CONGRESSO NAZIONALE TUMORI EREDITARI: dalla biologia molecolare al trattamento Modena, 18-19 Novembre 2010

CONGRESSO NAZIONALE TUMORI EREDITARI: dalla biologia molecolare al trattamento Modena, 18-19 Novembre 2010 CONGRESSO NAZIONALE TUMORI EREDITARI: dalla biologia molecolare al trattamento Modena, 18-19 Novembre 2010 TEST FUNZIONALE EX VIVO DI SPLICING PER LA DIAGNOSTICA MOLECOLARE DEL CARCINOMA DEL SENO E DELL

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

(Agro)Biodiversità e miglioramento genetico delle piante: : la rivoluzione genomica. M. Enrico Pè. Scuola Superiore Sant Anna.

(Agro)Biodiversità e miglioramento genetico delle piante: : la rivoluzione genomica. M. Enrico Pè. Scuola Superiore Sant Anna. (Agro)Biodiversità e miglioramento genetico delle piante: : la rivoluzione genomica M. Enrico Pè Scuola Superiore Sant Anna di Pisa Variazione e Somiglianza Tra Specie Risultato di centinaia di milioni

Dettagli

Lezione 4. Il sequenziamento del DNA, Sanger e il progetto genoma umano

Lezione 4. Il sequenziamento del DNA, Sanger e il progetto genoma umano Lezione 4 Il sequenziamento del DNA, Sanger e il progetto genoma umano Stranneheim and Lundeberg 2012 Un po di storia 25 Aprile 1953 James D. Watson e Francis Crick pubblicano la struttura del DNA (Watson

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Next-generation sequencing : dalla ricerca di base alla diagnostica*

Next-generation sequencing : dalla ricerca di base alla diagnostica* Next-generation sequencing : dalla ricerca di base alla diagnostica* Karl V. Voelkerding 1,2, Shale A. Dames 1, Jacob D. Durtschi 1 1ARUP Institute for Experimental and Clinical Pathology, Salt Lake City,

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Giorgio v. Scagliotti Dipartimento di Oncologia Università di Torino

Giorgio v. Scagliotti Dipartimento di Oncologia Università di Torino ANALISI DI NUOVI BIO-MARCATORI PREDITTIVI DI RISPOSTA ALLA CHEMIOTERAPIA CON TECNICHE DI ESPRESSIONE GENICA E PROTEICA AD ALTA RISOLUZIONE PER UNA MIGLIORE DEFINIZIONE DELLA STRATEGIA TERAPEUTICA IN PAZIENTI

Dettagli

Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare

Dettagli