La biologia molecolare In Anatomia Patologica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La biologia molecolare In Anatomia Patologica"

Transcript

1 La biologia molecolare In Anatomia Patologica Parravicini C, Rossi R, Tonello C, Tosoni A, Lauri E A.O. Luigi Sacco - Milano 12 dicembre 2014

2 La biologia molecolare in Anatomia Patologica Certification and training in molecular pathology. Arber DA, Battifora H, Brynes RK, Chang KL, Weiss LM, Wilczynski SP. Hum Pathol. 1996;27(4): Certification in molecular pathology in the United States: an update from the Association for Molecular Pathology Training and Education Committee. Mackinnon AC Jr, Wang YL, Sahota A, Yeung CC, Weck KE. J Mol Diagn. 2012;14(6): (doi: /j.jmoldx ). Certification in Molecular Pathology in the United States (Training and Education Committee, the Association for Molecular Pathology) Killeen AA, Leung WC, Payne D, Sabath DE, Snow K, Tsongalis GJ, Van Deerlin V, Weck K. J Mol Diagn. 2012;14(6): (doi: /j.jmoldx ). Certification in Molecular Diagnostics Medical Doctors: M.D. certified in anatomic pathology and/or clinical pathology Doctoral-Level Clinical Scientists: M.D. or a Ph.D. degree (or the equivalent) in genetics, molecular biology, or a related biological field. Supervisors and Technologists: MD, PhD, Master, Bachelor s degree

3 since 1995 Affiliate organizations since 1999 FASEB APC ASCO ABP CAP ACMG AMA IASLC ASCP IOM AACC ICPI SLAS CLC IPC ASM ASHI ASCLS ASH ASIP USCAP CCCLW and many others

4 Since million monthly page views CLINICAL PATHOLOGY - MOLECULAR DNA purification DNA sequencing FISH Microarray PCR introduction analyzing purity basic protocol anion exchange chromatography cesium chloride density gradient centrifugation commercial DNA extraction machines ethanol precipitation organic extraction PCR inhibitors RNA purification silica adsorption tissue preparation history Maxam-Gilbert sequencing Sanger sequencing capillary electrophoresis other innovations real time pyroseqencing nanotechnology Roche 454 FLX pyrosequencer Illumina Genome Analyzer HeliScope Sequencer general probes protocol probe patterns images introduction history basics considerations errors variations:antibody bead based cellular CGH solid phase tissue (TMA) definition history basics Taq polymerase reaction stages thermocyclers applications variations:general methylation specific multiplex nested real-time reverse transcriptase

5 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella & C.) DNA/RNA extraction-purification; PCR (multiplex, nested, real-time, RT-PCR); DNA sequencing (capillary, pyrosequencing); In-situ hybridization (non radioactive); FISH

6 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella & C.)

7 Diagnostica delle patologie infettive Riconoscimento di lesioni specifiche Dimostrazione intralesionale dell agente eziologico Diagnosi coerente con clinica e dati di laboratorio Sforzo diagnostico proporzionato alle ricadute terapeutiche, economiche e/o di salute pubblica

8 Diagnostica anatomopatologica su vetrino delle patologie infettive Istochimica PAS, ZN, Grocott Immunoistochimica Ab. Mono- e policlonali Ibridazione in situ Sonde a RNA e DNA (oligo non radioattivi)

9 CASO #1

10 Biopsia lingua Inviato da: Odonto CLINICA M / 20 aa Italia HIV-pos. Leucoplachia bordo linguale dx QUESITO Carcinoma? EBV/EBER Diagnosi : Hairy leukoplakia, EBV-correlata

11 CASO #2

12 Biopsie rettali Inviato da: Amb. Gastro Malattie infettive CLINICA M / 34 aa - IT HIV+ (HAART) Omosex Pregressa Castleman + KS Condilomatosi anale HPV+ Sifilide: T.pallidum ab 10,260; RPR neg. Diarrea mucosa Ulcera rettale QUESITO Colite dndd

13 Biopsie rettali Infiammazione acuta e cronica Banda basofila (Giemsa+) alla superficie luminale anti-treponema pallidum positiva (Spirochete) Spirochetosi intestinale

14 CASO #3

15 Biopsia linfonodale (ascella) Inviato da: Consulenza altro Ente (IT) Malattie infettive CLINICA M / 41 aa - IT HIV + (in HAART) KS cutaneo e mucoso Febbre, perdita di peso, pancitopenia KSHV viremia > genomi/µg -1 EBV viremia = 300 genomi/µg - QUESITO Sospetta malattia linfoproliferativa KSHV-correlata

16 Biopsia linfonodale

17 Biopsia linfonodale KS Orf73 Sarcoma di Kaposi pericapsulare KSHV/Orf73 + Plasmablasti CD20, CD30, CD138 - / KSHV/Orf73+

18 Biopsia linfonodale T1.1 T1.1 Plasmablasti positivi per T1.1 early-rna e vil6, virf early-proteins

19 Biopsia linfonodale Plasmablasti con restrizione clonale di espressione delle catene leggere, in assenza di monoclonalità dimostrabile dopo PCR per IgH

20 Biopsia linfonodale Diagnosi Colonizzazione dei centri germinativi da proliferazione plasmablastica (CD20,CD30, CD138-) con restrizione di espressione delle catene leggere delle Ig, associata a infezione replicativa da KSHV/HHV8. Quadro coerente con diagnosi di disordine linfoproliferativo germinotropico KSHV-correlato. (Du MQ, et al. KSHV- and EBV-associated germinotropic lymphoproliferative disorder. Blood Nov 1; 100(9): )

21 Diagnostica delle patologie infettive Immunoistochimica Ab. Mono- e policlonali Ibridazione in situ Sonde a RNA e DNA (oligo non radioattivi) Disponibilità commerciale

22 Diagnostica delle patologie infettive PCR IN FASE LIQUIDA SU DNA/RNA ESTRATTO DA CAMPIONI INCLUSI IN PARAFFINA Unico limite la disponibilità di sequenze in GeneBank

23 Diagnostica molecolare delle patologie infettive Quesito diagnostico clinico-patologico ISTOLOGIA ISTOCHIMICA IMMUNOISTOCHIMICA PCR Rappresentatività del campione SEZIONI SERIATE Estrazione (controlli negativi) Verifica di amplificabilità e competenza MULTIPLEX (housekeeping genes) PCR mirata (controlli positivi) SCELTA DEI PRIMERS Analisi del prodotto di amplificazione GEL, ANALISI DI SEQUENZA DIAGNOSI COERENZA TRA ISTOLOGIA, CLINICA E DATO MOLECOLARE

24 CONTROLLO DI AMPLIFICABILITA e COMPETENZA Multiplex PCR per house keeping genes con amplificati di diversa lunghezza bp house keeping genes Human AF4 gene (exon 3; GenBank accession no. Z83679) Human AF4 gene (exon 11; GenBank accession no. Z83687) Human promyelocytic leukemia zincfinger gene (PLZF, exon 1; GenBank accession no. AF060568) Human recombination activating gene (RAG1, exon 2; GenBank accession no. M29474) Human thromboxane synthase gene (TBXAS1, exon 9; GenBank accession no. D34621) Leukemia (2003) 17, (Report of the BIOMED-2 Concerted Action BMH4-CT )

25 Diagnostica molecolare delle patologie infettive Scelta dei primers Primers specifici Primers pan-specie Sequenze uniche e specifiche per un singolo microorganismo Sequenze conservate comuni a tutti i microorganismi di una specie Conservata Conservata Conservata Primer F Sequenze variabili specifiche Conservata Conservata Conservata Primer R ANALISI DI SEQUENZA

26 Diagnostica molecolare delle patologie infettive Istologia (immunoistochimica, in-situ) e/o storia clinica Quesito diagnostico mirato PCR con primers specifici

27 CASO #4

28 Biopsia esofago Inviato da: Gastroenterologia CLINICA M / 20 aa Italia. HIV-pos. Leukoplakia. QUESITO Sospetta candida Diagnosi Esofagite / ulcera da HSV I

29 CASO #5

30 Caso # Consulenza altro Ente (Besta-MI) Maschio, 54 aa. biopsia cerebrale lesione temporale posteriore dx Quesito diagnostico Lesione necrotizzante cerebrale. Presenza di inclusi citoplasmatici PAS+ sospetti per morbo di Whipple cerebrale.

31 Caso # Consulenza altro Ente (Besta-MI) Maschio, 54 aa. biopsia cerebrale lesione temporale posteriore dx

32 CASO #6

33 Biopsia linfonodale (ascella) Inviato da: Consulenza altro ente (IT) F / 76 aa - IT Febbre (regredisce con cortisone). Decadimento neurologico (da1 anno). Vive in campagna. Madre di collega

34 Biopsia linfonodale (ascella) Linfoadenite granulomatosa necrotizzante Granulociti Cellule giganti assenti Lesioni figurate Vive in campagna. Diagnosi Linfoadenite granulomatosa necrotizzante, morfologicamente compatibile con malattia da graffio di gatto. PCR per Bartonella spp (JCM 2000, 38(5): ): positiva (dimensioni del frammento amplificato consistenti con Bartonella henselae).

35 CASO #7

36 Biopsie gastriche 1) Antro 2) Bordo d ulcera Inviato da: Amb. Gastro Malattie infettive CLINICA M / 48 aa - IT HIV, HCV, HBV + QUESITO Pregressa diagnosi di Leishmaniosi (biopsia linfonodale)

37 Diagnosi Gastrite cronica granulomatosa associata alla focale presenza di forme protozoarie, in parte intracellulari, morfologicamente suggestive per Leishmania/Toxoplasma. Immunoistochimica per Toxoplasma:negativa. PCR per Leishmania spp: positiva. Quadro morfologigico e risultati delle indagini immunoistochimiche e molecolari depongono per una diagnosi di gastrite granulomatosa da Leishmania spp.

38 Diagnostica molecolare delle patologie infettive LESIONI GRANULOMATOSE a sospetta/possibile eziologia micobatterica e fungina PAS, ZN, Grocott e anti-tbcomplex negative Istochimica e immunoistochimica ambigue PCR con primers pan-specie

39 DIAGNOSTICA MOLECOLARE DELLE LESIONI GRANULOMATOSE Sistemi di PCR per micobatteri gene b.p. ref. Pan-Myco 16S 100 J Clin Microb 2002 Pan-Myco 16S 484 J Clin Microb 2000 TBcomplex IS J Clin Microb 1998

40 CASO #8

41 Caso # Biopsia cutanea (gamba) Inviato da: Malattie infettive CLINICA F / 36 aa AFRICA Centr. HIV-neg. Lesioni nodulari iperemiche, dolenti, presenti da molti anni. PPD e Quantiferum +++. QUESITO Eritema nodoso? Panniculite? Ipodermite? BK?

42 Panniculite granulomatosa con cellule giganti

43 286163

44 Caso # Analisi di sequenza del prodotto di amplificazione condotta su un frammento di 480bp: omologia del 99% con Mycobacterium gordonae. Diagnosi Quadro istologico e risultati delle indagini molecolari coerenti con panniculite lobulare granulomatosa gigantocellulare da Mycobacterium gordonae (Cases J Jul 31;2:6828)(J Cutan Pathol 2000 Mar; 27(3):124-9)

45 CASO #9

46 Caso # Biopsia cutanea (braccio) Inviato da: Consulenza altro Ente (Melegnano) CLINICA M / 12 aa Brasile / Italia. Da 8 anni in Italia HIV-neg. Lesioni cutanee braccia, gambe,volto QUESITO Lesione da micobatteri?

47 Caso #

48 Caso # PAS ZN TB-complex Fenotipo istochimico e immunoistochimico ambiguo

49 Caso # Diagnosi: Lebbra lepromatosa

50 CASO #10

51 Caso # H&E Maschio, 29aa. Lesioni ossee (colonna), polmonari, cerebrali, cutanee HIV-negativo CD4: 8 cell/µl H&E Biopsia cutanea H&E PAS Grocott

52 Caso # Giemsa PAS Biopsia ossea H&E

53 Caso # Filobasidiella neoformans Cryptococcus neoformans Identities = 198/198 (100%) CCGTAGGTGAACCTGCGGAAGGATCAG TAGAGAATATTGGACTTTGGTCCATTTAT CTACCCATCTACACCTGTGAACTGTTTAT GTGCTTCGGCACGTTTTACACAAACTTCT AAATGTAATGAATGTAATCATATTATAAC AATAATAAAACTTTCAACAACGGATCTCT TGGCTTCCGCATCGATGAAGAACGCA 145 bp 198 bp Candida rugosa Identities = 140/141 (99%) CCGTAGGTGAACCTGCGGAAGGATCATTA GAACACTGTTTAACACTGTGTCTGAGCAC GATACACGCAAACCGATCATCAACACGCT AAACAAAACTTTCAACAACGGATCTCTAG GTTCTCGCATCGATGAAGAACGCAG Diagnosi Criptococcosi cutanea Verificare (emocoltura) possibile coinfezione da Candida

54 CASO #11

55 Resezione colica (massa) Inviato da: Consulenza altro Ente (IT) Malattie infettive CLINICA M / 25 aa IT Cuoco in Irlanda (ristorante etnico) HIV-neg. Febbre da 3 mesi (antipiretici), Perdita di peso (18Kg) Massa addominale QUESITO Patologia granulomatosa a sospetta eziologia micotica

56 Caso # Massa addominale QUESITO DIAGNOSTICO (DIAGNOSI PROVVISORIA) Patologia granulomatosa a sospetta eziologia micotica TERAPIA Amfotericina liposomiale

57 Caso # Patologia granulomatosa a sospetta eziologia micotica EOSINOFILI

58 Caso # Patologia granulomatosa a sospetta eziologia micotica Grocott PAS Fenomeno di Splendore-Hoeppli

59 Caso # Patologia granulomatosa a sospetta eziologia micotica Diagnosi Basidiobolomicosi intestinale

60 Caso # Diagnosi Patologia granulomatosa a sospetta eziologia micotica Basidiobolomicosi intestinale Terapia I.V. - ricovero 1000/2000/die cps. x os - casa 2/die

61 Approccio biomolecolare alla patologia infettiva VANTAGGI Flessibilità Ottimizzazione della potenzialità diagnostica di campioni bioptici non ripetibili (archivio) Tempi e costi Diagnosi eziologica per una terapia mirata

62 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella)

63 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Ematologia (linfomi) PCR per riarrangiamento Ig e TcR BIOMED-2 Concerted Action Clonality detectable in 99% of all B-cell malignancies and 94% of all T-cell malignancies Improved reliability of lymphoma diagnostics via PCR-based clonality testing: Report of BIOMED-2 Concerted Action BMH4 CT ; Leukemia (2007); 21-2; EuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations. Leukemia Oct;26(10): doi: /leu

64 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Ematologia (linfomi) Anno Casi (totale) Linfomi (totale) Riarrangiamento Ig - TcR (totale) (agosto)

65 CASO #12

66 Caso Femmina, 53 anni, HIV-negativa. Non immunodeficienze note Non terapie immunosoppressive in corso. Linfoadenopatia generalizzata (incluso retroperitoneo)+ lesioni spleniche. Astenia, esantema e modesta eosinofilia. LDH in aumento

67 CD20 Caso H&E Linfonodo inguinale CD3

68 caso Linfonodo inguinale CD35 CD23 CD5 H&E

69 CD138 caso Linfonodo inguinale dd: linfoma plasmablastico Mum1 Bcl6 CD30

70 Alk1 caso Linfonodo inguinale dd: Anaplastic large cell lymphoma B EMA CD30

71 CD15 caso Linfonodo inguinale dd: Hodgkin lymphoma CD45 CD30

72 caso Ig-Fr1 Ig-Fr2 Linfonodo inguinale Ig-Fr3

73 EBV EBER caso Linfonodo inguinale EBV LMP KSHV Orf73 CD30

74 Diagnosi Sezioni linfonodali sostituite da una proliferazione polimorfa di blasti B CD20+, in parte a carattere plasmablastico, con fenotipo consistente per una differenziazione memory postgerminal center (CD10-; Bcl6-; Mum1+; CD138+/-). Tali elementi sono positivi per EBV/EBER e, in parte, esprimono EBV LMP. Sono presenti residui di centri germinativi CD23+ e una quota diffusa di piccoli T linfociti CD3+. Il riarrangiamento per le immunoglobuline mostra picchi monoclonali in Fr1 e Fr2, nel contesto di una attivazione oligoclonale, più evidente in Fr3. La carica virale su sangue periferico risulta di 30 copie/1µg di DNA. Nell'insieme i dati morfologici, immunoistochimici e molecolari orientano per una diagnosi di linfoma non-hodgkin B CD20+ diffuso a grandi cellule, EBV correlato. L'associazione con EBV suggerisce di investigare/escludere una possibile coesistente causa di immunodeficienza.

75 CASO #13

76 Caso Linfonodo inguinale Maschio, 25 anni, HIV-positivo. Linfoadenopatia generalizzata. Multiorgan failure. KSHV/ORF73

77 Caso Linfonodo inguinale Ki67 CD20 PAX5 EBV/EBER CD30 CD79a MUM1

78 Caso Linfonodo inguinale Diagnosi Sezioni linfonodali con quadri di subtotale sostituzione da linfoma non-hodgkin ad alto grado (Ki67>95%), diffuso a grandi cellule anaplastiche CD30 e CD45+, con fenotipo B (CD20, Pax5+) a differenziazione post-germinal center (Mum1+, CD138 +/-; CD10, Bcl2, CD15, CD3, ALK1-), EBVcorrelato (EBV/EBER+).Riarrangiamento IgH: presenza di picchi monoclonali in FR1 e FR2. Coesiste microfocolaio intranodale di sarcoma di Kaposi KSHV/Orf73+.

79 CASO #14

80 Caso / Femmina, 47 anni, HIV-negativa. Linfoadenopatia ltc. (2009) Noduli cute spalla e mammella dx (2011)

81 Caso / Linfonodo (2009) DLBCL Cute (2011) Linfoma follicolare

82 Caso / FR1 FR2 FR3 DLBCL - Linfonodo (2009) Linf. Follicolare - Cute (2011)

83 Caso / Linf. Follicolare - Cute (2011) DLBCL - Linfonodo (2009) FR1 FR2 FR3 La PCR per il riarrangiamento IgH condotta in parallelo su DNA estratto dalla lesione cutanea mammaria e su DNA estratto dalla precedente biopsia linfonodale mostra amplificati di dimensione diversa in FR1 e FR2, con coincidenza dei picchi in FR3. Il dato non consente di escludere l'ipotesi che le lesioni cutanee rappresentino una ripresa di malattia e suggeriscono una attenta valutazione clinica della paziente in ambito specialistico oncoematologico.

84 CASO #15

85 Caso Femmina, 69 anni, HIV-negativa. Nazionalità peruviana Linfoadenopatia inguinale + retrop. LDH elevate Non immunodeficienze note

86 Caso Linfonodo inguinale Necrosi coagulativa Necrosi massiva Picnosi e apoptosi

87 Caso Linfonodo inguinale (+) (-) CD3, CD4, Mum1, Bcl2, CD30 CD7, CD8, CD5, ALK1,TdT, EMA, TIA1, Perforin, Granzyme B, EBV/EBER, KSHV/Orf73 TcR - p TcR - g

88 Caso Linfonodo inguinale (+) (-) (*) CD3, CD4, Mum1, Bcl2, CD30 CD7, CD8, CD5, ALK1,TdT, EMA, TIA1, Perforin, Granzyme B, EBV/EBER, KSHV/Orf73 Ipercalcemia

89 Caso Linfonodo inguinale Diagnosi 10/7/2013 Localizzazione linfonodale da linfoma a fenotipo T (CD3+), a grandi cellule, ampiamente necrotico, con rari elementi CD30+. Indice di proliferazione: Ki67>90%. 16/7/2013 La popolazione neoplastica appare costituita da blasti T di media e grossa taglia, a volte plurinucleati e con marcato pleomorfismo nucleare, a fenotipo CD3, CD4, Mum1, Bcl2+/CD7, CD8 e CD5-. Sono presenti numerosi corpi apoptotici e mitosi atipiche. Negativa l immunoistochimica per ALK1, TdT, EMA, TIA1, Perforina e GranzymeB. Negativa l ibridazione in situ per EBV/EBER e il marcaggio per KSHV/Orf73. Il quadro Istologico dominato da fenomeni di necrosi massiva, il profilo immunoistochimico caratterizzato dalla negatività per CD7 degli elementi neoplastici positivi per CD3 e CD$, La notizia anamnestica di ipercalcemia e l origine/provenienza della paziente da area endemica, nell insieme sono altamente sospetti per un possibile leucemia/linfoma a cellule T dell adulto. Ulteriori indagini molecolari in corso 17/7/2013 PCR per riarrangiamento TCR su DNA estratto da sezioni in paraffina (amplificabilità>300bp): presenza di picco diclonale in P con G policlonale PCR per HTLV I/II: positiva DIAGNOSI DEFINITIVA: localizzazione linfonodale di linfoma/leucemia a cellule T dell adulto, HTLV I/II-correlato

90 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella)

91

92 If you do not ask the right questions, you do not get the right answers. A question asked in the right way often points to its own answer. Asking questions is the A-B-C of diagnosis. Edward Hodnett American poet

93 POSTULATI DI KOCH 1. L agente deve essere presente in ogni caso di malattia 2. L agente non deve essere trovato in casi di malattia differente 3.L agente si deve ritrovare nelle forme di malattia prodotte sperimentalmente

94

95 Mutation EGFR gene L858R Lung adenoca. exon 19 BRAF V600E Papillary thyroid ca., Melanoma Bcl2 Translocation Ciclin D1 Rearrangement ALK1 XP11 c-myc B-CLL, Follicular lymphoma Mantle Zone Lymphoma Lung adenoca., anaplastic lymph. Renal cell Ca. Burkitt lymphoma Deletion or Loss of gene function Gene amplificati on INI-1 E-cadherin MLH1, MSH2, MSH6, PMS2 Her2 MDM2, CKD4 Epithelioid sarcomas, renal Breast medullary lobular ca., ca., Gastric microsatellite signet ring ca. instability (Colon ca.) breast ca. and gastroesophageal ca. Liposarcomas

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli

I linfomi non-hodgkin

I linfomi non-hodgkin LINFOMA NON HODGKIN I linfomi non-hodgkin (LNH) sono un eterogeneo gruppo di malattie neoplastiche che tendono a riprodurre le caratteristiche morfologiche e immunofenotipiche di una o più tappe dei processi

Dettagli

I fattori predittivi e prognostici: il nuovo orizzonte della diagnostica anatomo patologica

I fattori predittivi e prognostici: il nuovo orizzonte della diagnostica anatomo patologica I fattori predittivi e prognostici: il nuovo orizzonte della diagnostica anatomo patologica I Edizione 28 Settembre 2012 II Edizione 23 Novembre 2012 Martinengo - Sala Congressi Diapath L evento è stato

Dettagli

La biopsia del linfonodo sentinella nel carcinoma. Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it

La biopsia del linfonodo sentinella nel carcinoma. Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it La biopsia del linfonodo sentinella nel carcinoma duttale in situ: : si,no, forse Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it Definizione Il carcinoma duttale in situ della mammella è una

Dettagli

Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia. Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia

Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia. Documento 02 Tipologia di Prodotto/Servizio Sezione Ematologia Pag. 1 di 6 Rev Data Redatto e elaborato Approvato Firma 0 04/03/2011 Coord.Infermieristico M.Renovi Dirigente Medico Resp. Dr. A. Stefanelli Direttore U.O.C. Medicina Generale Dott.ssa P. Lambelet Direttore

Dettagli

Conduzione di uno studio epidemiologico (osservazionale)

Conduzione di uno studio epidemiologico (osservazionale) Conduzione di uno studio epidemiologico (osservazionale) 1. Definisco l obiettivo e la relazione epidemiologica che voglio studiare 2. Definisco la base dello studio in modo che vi sia massimo contrasto

Dettagli

LA REFERTAZIONE DELLA PET-TC ONCOLOGICA con 18F-FDG: istruzioni pratiche per un referto standardizzato e di qualità

LA REFERTAZIONE DELLA PET-TC ONCOLOGICA con 18F-FDG: istruzioni pratiche per un referto standardizzato e di qualità LA REFERTAZIONE DELLA PET-TC ONCOLOGICA con 18F-FDG: istruzioni pratiche per un referto standardizzato e di qualità Maria Lucia Calcagni, Paola Castaldi, Alessandro Giordano Università Cattolica del S.

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Date da 10/2003 a 01/2004 Lavoro o posizione ricoperti Dirigente medico ex I livello, a tempo determinato, Disciplina di Medicina Interna

Date da 10/2003 a 01/2004 Lavoro o posizione ricoperti Dirigente medico ex I livello, a tempo determinato, Disciplina di Medicina Interna Principali attività e medico presso la Medicina e Chirurgia di Accettazione ed Urgenza (MCAU) del Pronto Soccorso Generale P.O. Garibaldi Centro. Attività svolta presso gli ambulatori di Medicina del Pronto

Dettagli

Deceduti Regione LOMBARDIA

Deceduti Regione LOMBARDIA Tumore della vescica Di maggior rilievo nei maschi (più di 3/4 dei casi), presenta variazioni geografiche di entità modestissima, minori di ogni altro tipo di carcinoma. Il 9-95% circa è costituito da

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

Curriculum Vitae Europass

Curriculum Vitae Europass Curriculum Vitae Europass Informazioni personali Nome(i) / Cognome(i) Indirizzo(i) Roberto CARUSO Corso Mazzini, 11-87100 Cosenza, Italia Telefono(i) Tel. + 39 0984681824 Fax+ 39 0984681322 E-mail Cittadinanza

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

La richiesta di materiale biologico da struttura a struttura: «second opinion»

La richiesta di materiale biologico da struttura a struttura: «second opinion» A.O. S.Antonio Abate, Gallarate Segreteria Scientifica dr. Filippo Crivelli U.O. di Anatomia Patologica Corso di Aggiornamento per Tecnici di Laboratorio di Anatomia Patologica AGGIORNAMENTI 2011 I edizione:

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

VADEMECUM PER MISURA DELLA VITAMINA D (25-idrossivitamina D e 1,25-diidrossivitamina D)

VADEMECUM PER MISURA DELLA VITAMINA D (25-idrossivitamina D e 1,25-diidrossivitamina D) DAI Diagnostica di Laboratorio - Laboratorio Generale - Direttore Dr. Gianni Messeri Gentile Collega, negli ultimi anni abbiamo assistito ad un incremento delle richieste di dosaggio di vitamina D (25-

Dettagli

La Salute dei denti e della bocca nel paziente oncologico.

La Salute dei denti e della bocca nel paziente oncologico. La Salute dei denti e della bocca nel paziente oncologico. Per migliorare il grado di informazione dei pazienti su alcuni importanti argomenti (quali ad esempio le terapie svolte, l alimentazione da seguire

Dettagli

Il sistema immunitario

Il sistema immunitario QUADERNI SULLE IMMUNODEFICIENZE PRIMITIVE N. 2 Il sistema immunitario ASSOCIAZIONE IMMUNODEFICIENZE PRIMITIVE ONLUS Quaderni pubblicati da AIP ONLUS N.1 La sindrome di Wiskott Aldrich (WAS) N.2 Il sistema

Dettagli

ANEMIE DEL II GRUPPO

ANEMIE DEL II GRUPPO ANEMIE DEL II GRUPPO Per incapacità dell eritrone midollare di produrre normalmente eritrociti a causa di difetti della: Proliferazione cellulare ESALTATA ERITROPOIESI INEFFICACE (ERITROBLASTOLISI MIDOLLARE)

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Quello che dovete sapere sulle INTERSTIZIOPATIE POLMONARI (MALATTIE INTERSTIZIALI POLMONARI)

Quello che dovete sapere sulle INTERSTIZIOPATIE POLMONARI (MALATTIE INTERSTIZIALI POLMONARI) Quello che dovete sapere sulle INTERSTIZIOPATIE POLMONARI (MALATTIE INTERSTIZIALI POLMONARI) Cosa sono le malattie interstiziali polmonari? Le malattie interstiziali polmonari sono dette anche interstiziopatie

Dettagli

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona

CIN 2 3: CHE FARE? P Cattani. Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona CIN 2 3: CHE FARE? P Cattani Centro Ginecologia Oncologica Preventiva ULSS 20 - Verona Istologia: diagnosi e gradi della CIN biopsia cervicale o escissione maturazione cell stratificazione cell anormalità

Dettagli

TUMORI DELLA MAMMELLA

TUMORI DELLA MAMMELLA TUMORI DELLA MAMMELLA INFORMAZIONI GENERALI La mammella Struttura e funzione della mammella La mammella è costituita da grasso (tessuto adiposo), tessuto connettivo e tessuto ghiandolare. Quest'ultimo

Dettagli

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Pædiatric Rheumatology InterNational Trials Organisation. Sindrome di Behçet

Pædiatric Rheumatology InterNational Trials Organisation. Sindrome di Behçet Pædiatric Rheumatology InterNational Trials Organisation Sindrome di Behçet Che cos è? La sindrome di Behçet (BS), o malattia di Behçet, è una vasculite sistemica (infiammazione dei vasi sanguigni) la

Dettagli

Oncologici: Iniziative e sostenibilità della Regione. Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana

Oncologici: Iniziative e sostenibilità della Regione. Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana Oncologici: Iniziative e sostenibilità della Regione Valeria Fadda Unità di HTA di ESTAV centro, Regione Toscana 2.760.000.000 Euro 14.4% della spesa farmaceutica 32.8% della spesa farmaceutica ospedaliera

Dettagli

TRATTAMENTI. Elaborazione piani di trattamento in radioterapia con fasci esterni e 30

TRATTAMENTI. Elaborazione piani di trattamento in radioterapia con fasci esterni e 30 TRATTAMENTI 1 Accesso e custodia C/C DH 2 Accesso e custodia dati pazienti informatizzati 3 Accesso e custodia faldoni cartacei referti 4 Agenda prenotazione esami interni 5 Agenda prenotazione visite

Dettagli

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria?

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria? DOMANDE E RISPOSTE 1. Che cos è un vaccino? Un vaccino è un prodotto la cui somministrazione è in grado di indurre una risposta immunitaria specifica contro un determinato microrganismo (virus, batterio

Dettagli

Dipartimento Medicina Interna e Specialità Mediche Reumatologia Dott. Carlo Salvarani - Direttore ARTRITI DA

Dipartimento Medicina Interna e Specialità Mediche Reumatologia Dott. Carlo Salvarani - Direttore ARTRITI DA Dipartimento Medicina Interna e Specialità Mediche Reumatologia Dott. Carlo Salvarani - Direttore LA GOTTA ED ALTRE ARTRITI DA CRISTALLI REGGIO EMILIA,, APRILE 2007 La Gotta ed altre Artriti da Cristalli

Dettagli

BORTEZOMIB (Velcade)

BORTEZOMIB (Velcade) BORTEZOMIB (Velcade) POTENZIALI EFFETTI COLLATERALI Le informazioni contenute in questo modello sono fornite in collaborazione con la Associazione Italiana Malati di Cancro, parenti ed amici ; per maggiori

Dettagli

Altre informazioni sul virus HPV: informazioni approfondite per le utenti

Altre informazioni sul virus HPV: informazioni approfondite per le utenti Altre informazioni sul virus HPV: informazioni approfondite per le utenti Questo è un documento di approfondimento sull HPV. Prima di leggerlo consultate il documento Alcune informazioni sul virus HPV

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

IMAGING BIO_MOLECOLARE con DaTSCAN

IMAGING BIO_MOLECOLARE con DaTSCAN IMAGING BIO_MOLECOLARE con DaTSCAN Stelvio Sestini, MD, PhD Unità di Medicina Nucleare - USL4 Prato Università degli Studi di Firenze Concetto 1. Le M. Neurodegenerative sono in aumento Concetto 2. Le

Dettagli

Hotel Cascina Scova Cityspa, Via Vallone, 18-27100 Pavia - 9 maggio 2015

Hotel Cascina Scova Cityspa, Via Vallone, 18-27100 Pavia - 9 maggio 2015 Ble Consulting srl id. 363 BISFOSFONATI E VITAMINA D: RAZIONALI D'USO - 119072 Hotel Cascina Scova Cityspa, Via Vallone, 18-27100 Pavia - 9 maggio 2015 Dr. Gandolini Giorgio Medici chirurghi 8,8 crediti

Dettagli

nelle prime linee di trattamento del carcinoma del colon-retto per una terapia personalizzata nuovi paradigmi 31 gennaio 2014 Genova

nelle prime linee di trattamento del carcinoma del colon-retto per una terapia personalizzata nuovi paradigmi 31 gennaio 2014 Genova Genova 31 gennaio 2014 CORSO RESIDENZIALE nuovi paradigmi per una terapia personalizzata nelle prime linee di trattamento del carcinoma del colon-retto CON IL PATROCINIO DI Obiettivi Il trattamento del

Dettagli

IL RUOLO DEL LABORATORIO NELL IPOVITAMINOSI D

IL RUOLO DEL LABORATORIO NELL IPOVITAMINOSI D IL RUOLO DEL LABORATORIO NELL IPOVITAMINOSI D Manuela Caizzi (1); Giorgio Paladini (2) 1. S.C. Ematologia Clinica; Azienda Ospedaliero-Universitaria, Ospedali Riuniti di Trieste 2. S.C. Ematologia Clinica

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE

SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE Studio prospettico, non interventistico, di coorte, sul rischio di tromboembolismo venoso (TEV) in pazienti sottoposti a un nuovo trattamento chemioterapico per

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

LE DOMANDE POSSIBILI PER LO SCREENING MAMMOGRAFICO VADEMECUM PER GLI OPERATORI DI SCREENING DELLA ASL RMC

LE DOMANDE POSSIBILI PER LO SCREENING MAMMOGRAFICO VADEMECUM PER GLI OPERATORI DI SCREENING DELLA ASL RMC LE DOMANDE POSSIBILI PER LO SCREENING MAMMOGRAFICO VADEMECUM PER GLI OPERATORI DI SCREENING DELLA ASL RMC (*risponde l infermiera / l ostetrica/ il medico) AGGIORNATO A Maggio 2009 1 CHE COSA E UN PROGRAMMA

Dettagli

ELENCO DRG AD ALTO RISCHIO DI NON APPROPRIATEZZA IN REGIME DI DEGENZA ORDINARIA

ELENCO DRG AD ALTO RISCHIO DI NON APPROPRIATEZZA IN REGIME DI DEGENZA ORDINARIA ELENCO DRG AD ALTO RISCHIO DI NON APPROPRIATEZZA IN REGIME DI DEGENZA ORDINARIA Codice Descrizione DRG 006 Decompressione tunnel carpale Allegato 6 A 008 INTERVENTI SU NERVI PERIFERICI E CRANICI E ALTRI

Dettagli

VAD O VED POTENZIALI EFFETTI COLLATERALI

VAD O VED POTENZIALI EFFETTI COLLATERALI VAD O VED POTENZIALI EFFETTI COLLATERALI 1 Questo schema di cura impiega i seguenti farmaci: vincristina, doxorubicina (adriamicina) o epidoxorubicina, cortisone. Le informazioni contenute in questo modello

Dettagli

MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA. pertinenza dermatologica. e nei confronti di loro conviventi o contatti

MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA. pertinenza dermatologica. e nei confronti di loro conviventi o contatti MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA Fonte: Ministero della Salute Circolare n 4 del 13 marzo 1998 del MINISTERO DELLA SALUTE Provvedimenti da adottare nei confronti di

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

PROGETTO MULTIDISCIPLANARE di PROCREAZIONE MEDICALMENTE ASSISTITA (PMA) e GENITORIALITA RESPONSABILE PER le COPPIE con INFEZIONE DA HIV/HCV

PROGETTO MULTIDISCIPLANARE di PROCREAZIONE MEDICALMENTE ASSISTITA (PMA) e GENITORIALITA RESPONSABILE PER le COPPIE con INFEZIONE DA HIV/HCV Arcispedale S. Maria Nuova Dipartimento Ostetrico Ginecologico e Pediatrico Prof. Giovanni Battista La Sala - Direttore PROGETTO MULTIDISCIPLANARE di PROCREAZIONE MEDICALMENTE ASSISTITA (PMA) e GENITORIALITA

Dettagli

ESENZIONI PER MOTIVI DI ETA' e/o REDDITO

ESENZIONI PER MOTIVI DI ETA' e/o REDDITO Il nucleo familiare è composto da : - Il richiedente l esenzione - il coniuge (non legalmente ed effettivamente separato) indipendentemente dalla sua situazione reddituale - dai familiari a carico fiscalmente

Dettagli

Lo screening cervicale.

Lo screening cervicale. Lo screening cervicale. Per migliorare il grado di informazione dei pazienti su alcuni importanti argomenti (quali ad esempio le terapie svolte, l alimentazione da seguire e gli esercizi di riabilitazione)

Dettagli

ISTITUTO ONCOLOGICO VENETO Istituto di ricovero e cura a carattere scientifico. Linea di ricerca. Via Gattamelata, 64 35128 Padova

ISTITUTO ONCOLOGICO VENETO Istituto di ricovero e cura a carattere scientifico. Linea di ricerca. Via Gattamelata, 64 35128 Padova ISTITUTO ONCOLOGICO VENETO Istituto di ricovero e cura a carattere scientifico Linea di ricerca Via Gattamelata, 64 35128 Padova Linea di ricerca 8 Immunologia dei tumori e approcci terapeutici Innovativi

Dettagli

Castrazione e sterilizzazione

Castrazione e sterilizzazione Centro veterinario alla Ressiga Castrazione e sterilizzazione Indicazioni, controindicazioni, effetti collaterali ed alternative Dr. Roberto Mossi, medico veterinario 2 Castrazione e sterilizzazione Castrazione

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine VITAMINA D: SINTESI, METABOLISMO E CARENZA Il 40-50% della

Dettagli

E SE MI CHIAMANO... DOPO IL PAP TEST?

E SE MI CHIAMANO... DOPO IL PAP TEST? E SE MI CHIAMANO... DOPO IL PAP TEST? Informazioni sui percorsi di approfondimento diagnostico e di cura PROGRAMMA REGIONALE PER LA PREVENZIONE DEI TUMORI FEMMINILI Coordinamento editoriale e di redazione:

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 Cisteina di 3 gruppo (176) Unità ripetute ricche di leucina Cisteine di 2 gruppo

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

UPDATE E SECOND OPINION IN CHIRURGIA VASCOLARE

UPDATE E SECOND OPINION IN CHIRURGIA VASCOLARE L EVENTO ASSEGNERÀ CREDITI ECM Sabato 16 giugno 2012 ore 8,30 UPDATE E SECOND OPINION IN CHIRURGIA VASCOLARE SEDE DEL CORSO Via Masaccio, 19 MILANO PER ISCRIZIONI www.chirurgiavascolaremilano.it Il Convegno

Dettagli

Manuale Utente IMPORT IATROS XP

Manuale Utente IMPORT IATROS XP Manuale Utente IMPORT IATROS XP Sommario Prerequisiti per l installazione... 2 Installazione del software IMPORT IATROS XP... 2 Utilizzo dell importatore... 3 Report della procedura di importazione da

Dettagli

Cos è l epatite? 1.1 Riassunto. L epatite

Cos è l epatite? 1.1 Riassunto. L epatite I. L epatite 11 1. Informazioni generali Cos è l epatite? 1.1 Riassunto L epatite L epatite è un infiammazione del fegato. Viene spesso chiamata ittero ma si tratta di un errore, poiché la colorazione

Dettagli

I TUMORI COLORETTALI GIOVANILI ( 40 ANNI) IN 25 ANNI DI UN REGISTRO SPECIALIZZATO

I TUMORI COLORETTALI GIOVANILI ( 40 ANNI) IN 25 ANNI DI UN REGISTRO SPECIALIZZATO Università degli studi di Modena e Reggio Emilia I TUMORI COLORETTALI GIOVANILI ( 40 ANNI) IN 25 ANNI DI UN REGISTRO SPECIALIZZATO Domati F., Maffei S., Kaleci S., Di Gregorio C., Pedroni M., Roncucci

Dettagli

La banca dati contiene oltre 10000 quiz dei concorsi svolti sino ad ora in tutta Italia.

La banca dati contiene oltre 10000 quiz dei concorsi svolti sino ad ora in tutta Italia. QUIZ TEM: Ulcere da decubito Quiz estratti dalla banca dati del sito e La banca dati contiene oltre 10000 quiz dei concorsi svolti sino ad ora in tutta Italia. 1) I germi responsabili di ulcere da pressione

Dettagli

TOTALE PERSONALE TOT. GG. LAVORATIVI 83,22 U.O. S.O. CHIRURGIE 80,29 U.O. AFFARI GENERALI E SEGRET. 79,44 U.O. ALLERGOLOGIA 95,51 U.O. A.L.P.I.

TOTALE PERSONALE TOT. GG. LAVORATIVI 83,22 U.O. S.O. CHIRURGIE 80,29 U.O. AFFARI GENERALI E SEGRET. 79,44 U.O. ALLERGOLOGIA 95,51 U.O. A.L.P.I. MOSCATI Tassi di assenza e di maggior presenza del personale in servizio presso Az. Osp. S.G. Moscati - Avellino nel mese 0/1. Pag. 1 di assenza ingiustificata, infortunio e permessi retribuiti vari (legge,

Dettagli

TOTALE PERSONALE TOT. GG. LAVORATIVI 75,36 U.O. S.O. CHIRURGIE 83,52 U.O. AFFARI GENERALI E SEGRET. 78,20 U.O. ALLERGOLOGIA 90,00 U.O. A.L.P.I.

TOTALE PERSONALE TOT. GG. LAVORATIVI 75,36 U.O. S.O. CHIRURGIE 83,52 U.O. AFFARI GENERALI E SEGRET. 78,20 U.O. ALLERGOLOGIA 90,00 U.O. A.L.P.I. MOSCATI Tassi di assenza e di maggior presenza del personale in servizio presso Az. Osp. S.G. Moscati - Avellino nel mese 2/. Pag. di assenza ingiustificata, infortunio e permessi retribuiti vari (legge,

Dettagli

dell epidermide. Compare soprattutto tra i 30 e i 60 anni, con una leggera prevalenza nelle donne, dove è spesso localizzato agli arti inferiori,

dell epidermide. Compare soprattutto tra i 30 e i 60 anni, con una leggera prevalenza nelle donne, dove è spesso localizzato agli arti inferiori, melanoma Il melanoma è il tumore che nasce dai melanociti, cellule responsabili della colorazione della pelle e che si trovano nello strato più profondo 2 dell epidermide. Compare soprattutto tra i 30

Dettagli

LA DONAZIONE DI SANGUE

LA DONAZIONE DI SANGUE CHE COSA è La donazione di sangue consiste nel prelievo di un determinato volume di sangue da un soggetto sano, chiamato donatore, al fine di trasfonderlo in un soggetto che ha bisogno di sangue o di uno

Dettagli

La Cartella Infermieristica quale strumento operativo di miglioramento della qualità

La Cartella Infermieristica quale strumento operativo di miglioramento della qualità La Cartella Infermieristica quale strumento operativo di miglioramento della qualità Dott. Mag. Nicola Torina Coordinatore infermieristico Unità Terapia Intensiva di Rianimazione Metodologie operative

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

di prossima pubblicazione

di prossima pubblicazione di prossima pubblicazione Volume 7 - Numero 9 Supplemento - SUPPLEMENTO DEL ISSN 9-9 (cartaceo) ISSN 7-9 (online) dell Istituto dell Istituto Superiore Superiore di di Sanità Sanità Poste italiane S.p.A.

Dettagli

Dipartimento Cure primarie ed attività distrettuali S.C. Medicina di base e specialistica. Evento Formativo Residenziale

Dipartimento Cure primarie ed attività distrettuali S.C. Medicina di base e specialistica. Evento Formativo Residenziale Dipartimento Cure primarie ed attività distrettuali S.C. Medicina di base e specialistica Evento Formativo Residenziale PREVENZIONE ONCOLOGICA IN MEDICINA GENERALE Savona Aulla Magna,, Pallazziina Viigiiolla,,

Dettagli

VADEMECUM SUL DOLORE. La Legge 38/2010. Perché NON SOFFRIRE È UN DIRITTO sancito dalla Legge. (terapia del dolore e cure palliative)

VADEMECUM SUL DOLORE. La Legge 38/2010. Perché NON SOFFRIRE È UN DIRITTO sancito dalla Legge. (terapia del dolore e cure palliative) VADEMECUM SUL DOLORE La Legge 38/2010 (terapia del dolore e cure palliative) Perché NON SOFFRIRE È UN DIRITTO sancito dalla Legge con il patrocinio istituzionale del MINISTERO della SALUTE La guida è stata

Dettagli

PROCEDURA MODALITA DI ACCESSO AGLI AMBULATORI

PROCEDURA MODALITA DI ACCESSO AGLI AMBULATORI AZIENDA OSPEDALIERA UNIVERSITA DI PADOVA PROCEDURA MODALITA DI ACCESSO AGLI AMBULATORI Preparato da Gruppo di Lavoro Ambulatori Clinica Ostetrico- Ginecologica Verificato da Servizio Qualità Verifica per

Dettagli

I NUMERI DEL CANCRO IN ITALIA 2013

I NUMERI DEL CANCRO IN ITALIA 2013 I NUMERI DEL CANCRO IN ITALIA 2013 I NUMERI DEL CANCRO IN ITALIA 2013 A cura di: Intermedia editore Via Malta 12/B 25124 Brescia Tel. 030.226105 fax. 030.2420472 intermedia@intermedianews.it www.medinews.it

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

TOTALE PERSONALE TOT. GG. LAVORATIVI 62,39 S.O. OCULISTICA 83,23 U.O. S.O. CHIRURGIE 64,58 U.O. AFFARI GENERALI E SEGRET. 76,74 U.O.

TOTALE PERSONALE TOT. GG. LAVORATIVI 62,39 S.O. OCULISTICA 83,23 U.O. S.O. CHIRURGIE 64,58 U.O. AFFARI GENERALI E SEGRET. 76,74 U.O. MOSCATI Tassi di assenza e di maggior presenza del personale in servizio presso Az. Osp. S.G. Moscati - Avellino nel mese 0/201. Pag. 1 di assenza ingiustificata, infortunio e permessi retribuiti vari

Dettagli

FIACCHEZZA, STANCHEZZA, MALESSERE MORALE. Carenza di ferro molto diffusa e spesso sottovalutata

FIACCHEZZA, STANCHEZZA, MALESSERE MORALE. Carenza di ferro molto diffusa e spesso sottovalutata FIACCHEZZA, STANCHEZZA, MALESSERE MORALE Carenza di ferro molto diffusa e spesso sottovalutata Cari pazienti! Vi sentite spesso fiacchi, stanchi, esauriti o giù di morale? Soffrite facilmente il freddo?

Dettagli

L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE.

L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE. L AUTOMAZIONE IN CITOLOGIA SU STRATO SOTTILE: CONTROLLO DELLE FASI OPERATIVE. C. Sintoni C. Galli Servizio di Anatomia Patologica - Presidio Ospedaliero S. M. delle Croci - Ravenna Attualmente nel nostro

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

I NUMERI DEL CANCRO IN ITALIA 2014

I NUMERI DEL CANCRO IN ITALIA 2014 I NUMERI DEL CANCRO IN ITALIA 2014 I NUMERI DEL CANCRO IN ITALIA 2014 2 A cura di: Via Malta 12/B 25124 Brescia Tel. 030.226105 fax. 030.2420472 intermedia@intermedianews.it www.medinews.it 3 Prefazione

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Papilloma virus umano (HPV): informazioni per gli operatori

Papilloma virus umano (HPV): informazioni per gli operatori Papilloma virus umano (HPV): informazioni per gli operatori Documento complementare al foglio per utenti Altre informazioni sul papilloma virus (HPV) Commenti alla sezione 1: PAP TEST E TEST HPV 1.1 Cos

Dettagli

INTERVENTO DI ARTROPROTESI D ANCA

INTERVENTO DI ARTROPROTESI D ANCA INTERVENTO DI ARTROPROTESI D ANCA Particolare dell incisione chirurgica Componenti di protesi d anca 2 Immagine di atrosi dell anca Sostituzione mediante artroprotesi La protesizzazione dell anca (PTA)

Dettagli

REaD REtina and Diabetes

REaD REtina and Diabetes Progetto ECM di formazione scientifico-pratico sulla retinopatia diabetica REaD REtina and Diabetes S.p.A. Via G. Spadolini 7 Iscrizione al Registro delle 20141 Milano - Italia Imprese di Milano n. 2000629

Dettagli

La programmazione di uno studio clinico: dalla domanda al disegno

La programmazione di uno studio clinico: dalla domanda al disegno Metodo epidemiologici per la clinica _efficacia / 1 La programmazione di uno studio clinico: dalla domanda al disegno La buona ricerca clinica Non è etico ciò che non è rilevante scientificamente Non è

Dettagli

A.I.S.F. ASSOCIAZIONE ITALIANA PER LO STUDIO DEL FEGATO TRATTAMENTO DELLA EPATITE DA HCV

A.I.S.F. ASSOCIAZIONE ITALIANA PER LO STUDIO DEL FEGATO TRATTAMENTO DELLA EPATITE DA HCV A.I.S.F. ASSOCIAZIONE ITALIANA PER LO STUDIO DEL FEGATO TRATTAMENTO DELLA EPATITE DA HCV A cura della Commissione Terapia Antivirale dell Associazione Italiana per lo Studio del Fegato (A.I.S.F.) Finito

Dettagli

Indicazioni per la certificazione

Indicazioni per la certificazione Il nuovo modello per la certificazione delle cause di morte: peculiarità e indicazioni per una corretta certificazione Indicazioni per la certificazione Stefano Brocco Coordinamento del Sistema Epidemiologico

Dettagli

DIAGNOSTICA CLINICA E STRUMENTALE. Dr.ssa Michela Marcon CDC NEUROLOGIA DIPARTIMENTO NEUROSCIENZE OSPEDALE SAN BORTOLO VICENZA

DIAGNOSTICA CLINICA E STRUMENTALE. Dr.ssa Michela Marcon CDC NEUROLOGIA DIPARTIMENTO NEUROSCIENZE OSPEDALE SAN BORTOLO VICENZA DIAGNOSTICA CLINICA E STRUMENTALE Dr.ssa Michela Marcon CDC NEUROLOGIA DIPARTIMENTO NEUROSCIENZE OSPEDALE SAN BORTOLO VICENZA 1984 I criteri NINCDS-ADRDA regole La diagnosi di AD è clinico-patologico:

Dettagli

Altre informazioni sul papilloma virus (HPV)

Altre informazioni sul papilloma virus (HPV) Altre informazioni sul papilloma virus (HPV) Questo è un documento di approfondimento sull HPV. Prima di leggerlo guardate le informazioni di base contenute in Alcune informazioni sull esame per il papilloma

Dettagli

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE D r. C a r l o D e s c o v i c h U.O.C. Governo Clinico Staff Direzione Aziendale AUSL Bologna Bologna 26 Maggio 2010 INDICATORE

Dettagli

EPATITE B. 50 domande e risposte. Dr. med. Eric Odenheimer, Prof. Dr. med. Beat Müllhaupt e Prof. Dr. med. Andreas Cerny

EPATITE B. 50 domande e risposte. Dr. med. Eric Odenheimer, Prof. Dr. med. Beat Müllhaupt e Prof. Dr. med. Andreas Cerny EPATITE B 50 domande e risposte Dr. med. Eric Odenheimer, Prof. Dr. med. Beat Müllhaupt e Prof. Dr. med. Andreas Cerny 2012 by SEVHep; 2 a edizione c/o Centro di Epatologia Clinica Luganese Moncucco Via

Dettagli

Catene Leggere Libere nel Siero

Catene Leggere Libere nel Siero Conoscere e capire il dosaggio delle Catene Leggere Libere nel Siero International Myeloma Foundation 12650 Riverside Drive, Suite 206 North Hollywood, CA 91607 USA Telephone: 800-452-CURE (2873) (USA

Dettagli

Esposizioni in condizioni complesse. Gian Marco Contessa grazie a Rosaria Falsaperla gianmarco.contessa@ispesl.it

Esposizioni in condizioni complesse. Gian Marco Contessa grazie a Rosaria Falsaperla gianmarco.contessa@ispesl.it Esposizioni in condizioni complesse Gian Marco Contessa grazie a Rosaria Falsaperla gianmarco.contessa@ispesl.it Valutazione dell esposizione a CEM La valutazione pratica dell esposizione ai campi elettrici

Dettagli

TASSI DI ASSENZA E MAGGIOR PRESENZA OTTOBRE 2014

TASSI DI ASSENZA E MAGGIOR PRESENZA OTTOBRE 2014 PRESIDIO BORRI VARESE ACCETTAZIONE RICOVERI 18,9 0 22,84 77,16 PRESIDIO BORRI VARESE AFFARI GENERALI E LEGALI 4,35 15,53 19,88 80,12 PRESIDIO BORRI VARESE AMBULANZE 15,78 1,77 20,03 79,97 PRESIDIO BORRI

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

PROGETTO DI STUDIO: Sistema informativo per lo studio delle patologie di sospetta origine professionale

PROGETTO DI STUDIO: Sistema informativo per lo studio delle patologie di sospetta origine professionale PROGETTO DI STUDIO: Sistema informativo per lo studio delle patologie di sospetta origine professionale Il territorio dell ASL 18 e 19 appartiene all area del Delta del Po di Polesine, dichiarata nel 1996

Dettagli

Raccomandazioni per l'impostazione di un Curriculum Globale in Oncologia Medica

Raccomandazioni per l'impostazione di un Curriculum Globale in Oncologia Medica Raccomandazioni per l'impostazione di un Curriculum Globale in Oncologia Medica ESMO-ASCO Task Force on Global Curriculum in Medical Oncology (Task Force ESMO-ASCO per il Curriculum Globale in Oncologia

Dettagli

Cosa dovrebbero sapere i genitori sulla sicurezza delle radiazioni per uso medico

Cosa dovrebbero sapere i genitori sulla sicurezza delle radiazioni per uso medico Cosa dovrebbero sapere i genitori sulla sicurezza delle radiazioni per uso medico Gli esami radiologici consentono ai medici di effettuare la diagnosi e decidere il corretto iter terapeutico dei loro pazienti.

Dettagli