La biologia molecolare In Anatomia Patologica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La biologia molecolare In Anatomia Patologica"

Transcript

1 La biologia molecolare In Anatomia Patologica Parravicini C, Rossi R, Tonello C, Tosoni A, Lauri E A.O. Luigi Sacco - Milano 12 dicembre 2014

2 La biologia molecolare in Anatomia Patologica Certification and training in molecular pathology. Arber DA, Battifora H, Brynes RK, Chang KL, Weiss LM, Wilczynski SP. Hum Pathol. 1996;27(4): Certification in molecular pathology in the United States: an update from the Association for Molecular Pathology Training and Education Committee. Mackinnon AC Jr, Wang YL, Sahota A, Yeung CC, Weck KE. J Mol Diagn. 2012;14(6): (doi: /j.jmoldx ). Certification in Molecular Pathology in the United States (Training and Education Committee, the Association for Molecular Pathology) Killeen AA, Leung WC, Payne D, Sabath DE, Snow K, Tsongalis GJ, Van Deerlin V, Weck K. J Mol Diagn. 2012;14(6): (doi: /j.jmoldx ). Certification in Molecular Diagnostics Medical Doctors: M.D. certified in anatomic pathology and/or clinical pathology Doctoral-Level Clinical Scientists: M.D. or a Ph.D. degree (or the equivalent) in genetics, molecular biology, or a related biological field. Supervisors and Technologists: MD, PhD, Master, Bachelor s degree

3 since 1995 Affiliate organizations since 1999 FASEB APC ASCO ABP CAP ACMG AMA IASLC ASCP IOM AACC ICPI SLAS CLC IPC ASM ASHI ASCLS ASH ASIP USCAP CCCLW and many others

4 Since million monthly page views CLINICAL PATHOLOGY - MOLECULAR DNA purification DNA sequencing FISH Microarray PCR introduction analyzing purity basic protocol anion exchange chromatography cesium chloride density gradient centrifugation commercial DNA extraction machines ethanol precipitation organic extraction PCR inhibitors RNA purification silica adsorption tissue preparation history Maxam-Gilbert sequencing Sanger sequencing capillary electrophoresis other innovations real time pyroseqencing nanotechnology Roche 454 FLX pyrosequencer Illumina Genome Analyzer HeliScope Sequencer general probes protocol probe patterns images introduction history basics considerations errors variations:antibody bead based cellular CGH solid phase tissue (TMA) definition history basics Taq polymerase reaction stages thermocyclers applications variations:general methylation specific multiplex nested real-time reverse transcriptase

5 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella & C.) DNA/RNA extraction-purification; PCR (multiplex, nested, real-time, RT-PCR); DNA sequencing (capillary, pyrosequencing); In-situ hybridization (non radioactive); FISH

6 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella & C.)

7 Diagnostica delle patologie infettive Riconoscimento di lesioni specifiche Dimostrazione intralesionale dell agente eziologico Diagnosi coerente con clinica e dati di laboratorio Sforzo diagnostico proporzionato alle ricadute terapeutiche, economiche e/o di salute pubblica

8 Diagnostica anatomopatologica su vetrino delle patologie infettive Istochimica PAS, ZN, Grocott Immunoistochimica Ab. Mono- e policlonali Ibridazione in situ Sonde a RNA e DNA (oligo non radioattivi)

9 CASO #1

10 Biopsia lingua Inviato da: Odonto CLINICA M / 20 aa Italia HIV-pos. Leucoplachia bordo linguale dx QUESITO Carcinoma? EBV/EBER Diagnosi : Hairy leukoplakia, EBV-correlata

11 CASO #2

12 Biopsie rettali Inviato da: Amb. Gastro Malattie infettive CLINICA M / 34 aa - IT HIV+ (HAART) Omosex Pregressa Castleman + KS Condilomatosi anale HPV+ Sifilide: T.pallidum ab 10,260; RPR neg. Diarrea mucosa Ulcera rettale QUESITO Colite dndd

13 Biopsie rettali Infiammazione acuta e cronica Banda basofila (Giemsa+) alla superficie luminale anti-treponema pallidum positiva (Spirochete) Spirochetosi intestinale

14 CASO #3

15 Biopsia linfonodale (ascella) Inviato da: Consulenza altro Ente (IT) Malattie infettive CLINICA M / 41 aa - IT HIV + (in HAART) KS cutaneo e mucoso Febbre, perdita di peso, pancitopenia KSHV viremia > genomi/µg -1 EBV viremia = 300 genomi/µg - QUESITO Sospetta malattia linfoproliferativa KSHV-correlata

16 Biopsia linfonodale

17 Biopsia linfonodale KS Orf73 Sarcoma di Kaposi pericapsulare KSHV/Orf73 + Plasmablasti CD20, CD30, CD138 - / KSHV/Orf73+

18 Biopsia linfonodale T1.1 T1.1 Plasmablasti positivi per T1.1 early-rna e vil6, virf early-proteins

19 Biopsia linfonodale Plasmablasti con restrizione clonale di espressione delle catene leggere, in assenza di monoclonalità dimostrabile dopo PCR per IgH

20 Biopsia linfonodale Diagnosi Colonizzazione dei centri germinativi da proliferazione plasmablastica (CD20,CD30, CD138-) con restrizione di espressione delle catene leggere delle Ig, associata a infezione replicativa da KSHV/HHV8. Quadro coerente con diagnosi di disordine linfoproliferativo germinotropico KSHV-correlato. (Du MQ, et al. KSHV- and EBV-associated germinotropic lymphoproliferative disorder. Blood Nov 1; 100(9): )

21 Diagnostica delle patologie infettive Immunoistochimica Ab. Mono- e policlonali Ibridazione in situ Sonde a RNA e DNA (oligo non radioattivi) Disponibilità commerciale

22 Diagnostica delle patologie infettive PCR IN FASE LIQUIDA SU DNA/RNA ESTRATTO DA CAMPIONI INCLUSI IN PARAFFINA Unico limite la disponibilità di sequenze in GeneBank

23 Diagnostica molecolare delle patologie infettive Quesito diagnostico clinico-patologico ISTOLOGIA ISTOCHIMICA IMMUNOISTOCHIMICA PCR Rappresentatività del campione SEZIONI SERIATE Estrazione (controlli negativi) Verifica di amplificabilità e competenza MULTIPLEX (housekeeping genes) PCR mirata (controlli positivi) SCELTA DEI PRIMERS Analisi del prodotto di amplificazione GEL, ANALISI DI SEQUENZA DIAGNOSI COERENZA TRA ISTOLOGIA, CLINICA E DATO MOLECOLARE

24 CONTROLLO DI AMPLIFICABILITA e COMPETENZA Multiplex PCR per house keeping genes con amplificati di diversa lunghezza bp house keeping genes Human AF4 gene (exon 3; GenBank accession no. Z83679) Human AF4 gene (exon 11; GenBank accession no. Z83687) Human promyelocytic leukemia zincfinger gene (PLZF, exon 1; GenBank accession no. AF060568) Human recombination activating gene (RAG1, exon 2; GenBank accession no. M29474) Human thromboxane synthase gene (TBXAS1, exon 9; GenBank accession no. D34621) Leukemia (2003) 17, (Report of the BIOMED-2 Concerted Action BMH4-CT )

25 Diagnostica molecolare delle patologie infettive Scelta dei primers Primers specifici Primers pan-specie Sequenze uniche e specifiche per un singolo microorganismo Sequenze conservate comuni a tutti i microorganismi di una specie Conservata Conservata Conservata Primer F Sequenze variabili specifiche Conservata Conservata Conservata Primer R ANALISI DI SEQUENZA

26 Diagnostica molecolare delle patologie infettive Istologia (immunoistochimica, in-situ) e/o storia clinica Quesito diagnostico mirato PCR con primers specifici

27 CASO #4

28 Biopsia esofago Inviato da: Gastroenterologia CLINICA M / 20 aa Italia. HIV-pos. Leukoplakia. QUESITO Sospetta candida Diagnosi Esofagite / ulcera da HSV I

29 CASO #5

30 Caso # Consulenza altro Ente (Besta-MI) Maschio, 54 aa. biopsia cerebrale lesione temporale posteriore dx Quesito diagnostico Lesione necrotizzante cerebrale. Presenza di inclusi citoplasmatici PAS+ sospetti per morbo di Whipple cerebrale.

31 Caso # Consulenza altro Ente (Besta-MI) Maschio, 54 aa. biopsia cerebrale lesione temporale posteriore dx

32 CASO #6

33 Biopsia linfonodale (ascella) Inviato da: Consulenza altro ente (IT) F / 76 aa - IT Febbre (regredisce con cortisone). Decadimento neurologico (da1 anno). Vive in campagna. Madre di collega

34 Biopsia linfonodale (ascella) Linfoadenite granulomatosa necrotizzante Granulociti Cellule giganti assenti Lesioni figurate Vive in campagna. Diagnosi Linfoadenite granulomatosa necrotizzante, morfologicamente compatibile con malattia da graffio di gatto. PCR per Bartonella spp (JCM 2000, 38(5): ): positiva (dimensioni del frammento amplificato consistenti con Bartonella henselae).

35 CASO #7

36 Biopsie gastriche 1) Antro 2) Bordo d ulcera Inviato da: Amb. Gastro Malattie infettive CLINICA M / 48 aa - IT HIV, HCV, HBV + QUESITO Pregressa diagnosi di Leishmaniosi (biopsia linfonodale)

37 Diagnosi Gastrite cronica granulomatosa associata alla focale presenza di forme protozoarie, in parte intracellulari, morfologicamente suggestive per Leishmania/Toxoplasma. Immunoistochimica per Toxoplasma:negativa. PCR per Leishmania spp: positiva. Quadro morfologigico e risultati delle indagini immunoistochimiche e molecolari depongono per una diagnosi di gastrite granulomatosa da Leishmania spp.

38 Diagnostica molecolare delle patologie infettive LESIONI GRANULOMATOSE a sospetta/possibile eziologia micobatterica e fungina PAS, ZN, Grocott e anti-tbcomplex negative Istochimica e immunoistochimica ambigue PCR con primers pan-specie

39 DIAGNOSTICA MOLECOLARE DELLE LESIONI GRANULOMATOSE Sistemi di PCR per micobatteri gene b.p. ref. Pan-Myco 16S 100 J Clin Microb 2002 Pan-Myco 16S 484 J Clin Microb 2000 TBcomplex IS J Clin Microb 1998

40 CASO #8

41 Caso # Biopsia cutanea (gamba) Inviato da: Malattie infettive CLINICA F / 36 aa AFRICA Centr. HIV-neg. Lesioni nodulari iperemiche, dolenti, presenti da molti anni. PPD e Quantiferum +++. QUESITO Eritema nodoso? Panniculite? Ipodermite? BK?

42 Panniculite granulomatosa con cellule giganti

43 286163

44 Caso # Analisi di sequenza del prodotto di amplificazione condotta su un frammento di 480bp: omologia del 99% con Mycobacterium gordonae. Diagnosi Quadro istologico e risultati delle indagini molecolari coerenti con panniculite lobulare granulomatosa gigantocellulare da Mycobacterium gordonae (Cases J Jul 31;2:6828)(J Cutan Pathol 2000 Mar; 27(3):124-9)

45 CASO #9

46 Caso # Biopsia cutanea (braccio) Inviato da: Consulenza altro Ente (Melegnano) CLINICA M / 12 aa Brasile / Italia. Da 8 anni in Italia HIV-neg. Lesioni cutanee braccia, gambe,volto QUESITO Lesione da micobatteri?

47 Caso #

48 Caso # PAS ZN TB-complex Fenotipo istochimico e immunoistochimico ambiguo

49 Caso # Diagnosi: Lebbra lepromatosa

50 CASO #10

51 Caso # H&E Maschio, 29aa. Lesioni ossee (colonna), polmonari, cerebrali, cutanee HIV-negativo CD4: 8 cell/µl H&E Biopsia cutanea H&E PAS Grocott

52 Caso # Giemsa PAS Biopsia ossea H&E

53 Caso # Filobasidiella neoformans Cryptococcus neoformans Identities = 198/198 (100%) CCGTAGGTGAACCTGCGGAAGGATCAG TAGAGAATATTGGACTTTGGTCCATTTAT CTACCCATCTACACCTGTGAACTGTTTAT GTGCTTCGGCACGTTTTACACAAACTTCT AAATGTAATGAATGTAATCATATTATAAC AATAATAAAACTTTCAACAACGGATCTCT TGGCTTCCGCATCGATGAAGAACGCA 145 bp 198 bp Candida rugosa Identities = 140/141 (99%) CCGTAGGTGAACCTGCGGAAGGATCATTA GAACACTGTTTAACACTGTGTCTGAGCAC GATACACGCAAACCGATCATCAACACGCT AAACAAAACTTTCAACAACGGATCTCTAG GTTCTCGCATCGATGAAGAACGCAG Diagnosi Criptococcosi cutanea Verificare (emocoltura) possibile coinfezione da Candida

54 CASO #11

55 Resezione colica (massa) Inviato da: Consulenza altro Ente (IT) Malattie infettive CLINICA M / 25 aa IT Cuoco in Irlanda (ristorante etnico) HIV-neg. Febbre da 3 mesi (antipiretici), Perdita di peso (18Kg) Massa addominale QUESITO Patologia granulomatosa a sospetta eziologia micotica

56 Caso # Massa addominale QUESITO DIAGNOSTICO (DIAGNOSI PROVVISORIA) Patologia granulomatosa a sospetta eziologia micotica TERAPIA Amfotericina liposomiale

57 Caso # Patologia granulomatosa a sospetta eziologia micotica EOSINOFILI

58 Caso # Patologia granulomatosa a sospetta eziologia micotica Grocott PAS Fenomeno di Splendore-Hoeppli

59 Caso # Patologia granulomatosa a sospetta eziologia micotica Diagnosi Basidiobolomicosi intestinale

60 Caso # Diagnosi Patologia granulomatosa a sospetta eziologia micotica Basidiobolomicosi intestinale Terapia I.V. - ricovero 1000/2000/die cps. x os - casa 2/die

61 Approccio biomolecolare alla patologia infettiva VANTAGGI Flessibilità Ottimizzazione della potenzialità diagnostica di campioni bioptici non ripetibili (archivio) Tempi e costi Diagnosi eziologica per una terapia mirata

62 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella)

63 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Ematologia (linfomi) PCR per riarrangiamento Ig e TcR BIOMED-2 Concerted Action Clonality detectable in 99% of all B-cell malignancies and 94% of all T-cell malignancies Improved reliability of lymphoma diagnostics via PCR-based clonality testing: Report of BIOMED-2 Concerted Action BMH4 CT ; Leukemia (2007); 21-2; EuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations. Leukemia Oct;26(10): doi: /leu

64 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Ematologia (linfomi) Anno Casi (totale) Linfomi (totale) Riarrangiamento Ig - TcR (totale) (agosto)

65 CASO #12

66 Caso Femmina, 53 anni, HIV-negativa. Non immunodeficienze note Non terapie immunosoppressive in corso. Linfoadenopatia generalizzata (incluso retroperitoneo)+ lesioni spleniche. Astenia, esantema e modesta eosinofilia. LDH in aumento

67 CD20 Caso H&E Linfonodo inguinale CD3

68 caso Linfonodo inguinale CD35 CD23 CD5 H&E

69 CD138 caso Linfonodo inguinale dd: linfoma plasmablastico Mum1 Bcl6 CD30

70 Alk1 caso Linfonodo inguinale dd: Anaplastic large cell lymphoma B EMA CD30

71 CD15 caso Linfonodo inguinale dd: Hodgkin lymphoma CD45 CD30

72 caso Ig-Fr1 Ig-Fr2 Linfonodo inguinale Ig-Fr3

73 EBV EBER caso Linfonodo inguinale EBV LMP KSHV Orf73 CD30

74 Diagnosi Sezioni linfonodali sostituite da una proliferazione polimorfa di blasti B CD20+, in parte a carattere plasmablastico, con fenotipo consistente per una differenziazione memory postgerminal center (CD10-; Bcl6-; Mum1+; CD138+/-). Tali elementi sono positivi per EBV/EBER e, in parte, esprimono EBV LMP. Sono presenti residui di centri germinativi CD23+ e una quota diffusa di piccoli T linfociti CD3+. Il riarrangiamento per le immunoglobuline mostra picchi monoclonali in Fr1 e Fr2, nel contesto di una attivazione oligoclonale, più evidente in Fr3. La carica virale su sangue periferico risulta di 30 copie/1µg di DNA. Nell'insieme i dati morfologici, immunoistochimici e molecolari orientano per una diagnosi di linfoma non-hodgkin B CD20+ diffuso a grandi cellule, EBV correlato. L'associazione con EBV suggerisce di investigare/escludere una possibile coesistente causa di immunodeficienza.

75 CASO #13

76 Caso Linfonodo inguinale Maschio, 25 anni, HIV-positivo. Linfoadenopatia generalizzata. Multiorgan failure. KSHV/ORF73

77 Caso Linfonodo inguinale Ki67 CD20 PAX5 EBV/EBER CD30 CD79a MUM1

78 Caso Linfonodo inguinale Diagnosi Sezioni linfonodali con quadri di subtotale sostituzione da linfoma non-hodgkin ad alto grado (Ki67>95%), diffuso a grandi cellule anaplastiche CD30 e CD45+, con fenotipo B (CD20, Pax5+) a differenziazione post-germinal center (Mum1+, CD138 +/-; CD10, Bcl2, CD15, CD3, ALK1-), EBVcorrelato (EBV/EBER+).Riarrangiamento IgH: presenza di picchi monoclonali in FR1 e FR2. Coesiste microfocolaio intranodale di sarcoma di Kaposi KSHV/Orf73+.

79 CASO #14

80 Caso / Femmina, 47 anni, HIV-negativa. Linfoadenopatia ltc. (2009) Noduli cute spalla e mammella dx (2011)

81 Caso / Linfonodo (2009) DLBCL Cute (2011) Linfoma follicolare

82 Caso / FR1 FR2 FR3 DLBCL - Linfonodo (2009) Linf. Follicolare - Cute (2011)

83 Caso / Linf. Follicolare - Cute (2011) DLBCL - Linfonodo (2009) FR1 FR2 FR3 La PCR per il riarrangiamento IgH condotta in parallelo su DNA estratto dalla lesione cutanea mammaria e su DNA estratto dalla precedente biopsia linfonodale mostra amplificati di dimensione diversa in FR1 e FR2, con coincidenza dei picchi in FR3. Il dato non consente di escludere l'ipotesi che le lesioni cutanee rappresentino una ripresa di malattia e suggeriscono una attenta valutazione clinica della paziente in ambito specialistico oncoematologico.

84 CASO #15

85 Caso Femmina, 69 anni, HIV-negativa. Nazionalità peruviana Linfoadenopatia inguinale + retrop. LDH elevate Non immunodeficienze note

86 Caso Linfonodo inguinale Necrosi coagulativa Necrosi massiva Picnosi e apoptosi

87 Caso Linfonodo inguinale (+) (-) CD3, CD4, Mum1, Bcl2, CD30 CD7, CD8, CD5, ALK1,TdT, EMA, TIA1, Perforin, Granzyme B, EBV/EBER, KSHV/Orf73 TcR - p TcR - g

88 Caso Linfonodo inguinale (+) (-) (*) CD3, CD4, Mum1, Bcl2, CD30 CD7, CD8, CD5, ALK1,TdT, EMA, TIA1, Perforin, Granzyme B, EBV/EBER, KSHV/Orf73 Ipercalcemia

89 Caso Linfonodo inguinale Diagnosi 10/7/2013 Localizzazione linfonodale da linfoma a fenotipo T (CD3+), a grandi cellule, ampiamente necrotico, con rari elementi CD30+. Indice di proliferazione: Ki67>90%. 16/7/2013 La popolazione neoplastica appare costituita da blasti T di media e grossa taglia, a volte plurinucleati e con marcato pleomorfismo nucleare, a fenotipo CD3, CD4, Mum1, Bcl2+/CD7, CD8 e CD5-. Sono presenti numerosi corpi apoptotici e mitosi atipiche. Negativa l immunoistochimica per ALK1, TdT, EMA, TIA1, Perforina e GranzymeB. Negativa l ibridazione in situ per EBV/EBER e il marcaggio per KSHV/Orf73. Il quadro Istologico dominato da fenomeni di necrosi massiva, il profilo immunoistochimico caratterizzato dalla negatività per CD7 degli elementi neoplastici positivi per CD3 e CD$, La notizia anamnestica di ipercalcemia e l origine/provenienza della paziente da area endemica, nell insieme sono altamente sospetti per un possibile leucemia/linfoma a cellule T dell adulto. Ulteriori indagini molecolari in corso 17/7/2013 PCR per riarrangiamento TCR su DNA estratto da sezioni in paraffina (amplificabilità>300bp): presenza di picco diclonale in P con G policlonale PCR per HTLV I/II: positiva DIAGNOSI DEFINITIVA: localizzazione linfonodale di linfoma/leucemia a cellule T dell adulto, HTLV I/II-correlato

90 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella)

91

92 If you do not ask the right questions, you do not get the right answers. A question asked in the right way often points to its own answer. Asking questions is the A-B-C of diagnosis. Edward Hodnett American poet

93 POSTULATI DI KOCH 1. L agente deve essere presente in ogni caso di malattia 2. L agente non deve essere trovato in casi di malattia differente 3.L agente si deve ritrovare nelle forme di malattia prodotte sperimentalmente

94

95 Mutation EGFR gene L858R Lung adenoca. exon 19 BRAF V600E Papillary thyroid ca., Melanoma Bcl2 Translocation Ciclin D1 Rearrangement ALK1 XP11 c-myc B-CLL, Follicular lymphoma Mantle Zone Lymphoma Lung adenoca., anaplastic lymph. Renal cell Ca. Burkitt lymphoma Deletion or Loss of gene function Gene amplificati on INI-1 E-cadherin MLH1, MSH2, MSH6, PMS2 Her2 MDM2, CKD4 Epithelioid sarcomas, renal Breast medullary lobular ca., ca., Gastric microsatellite signet ring ca. instability (Colon ca.) breast ca. and gastroesophageal ca. Liposarcomas

Ruolo dei test di clonalità nei disordini linfoproliferativi

Ruolo dei test di clonalità nei disordini linfoproliferativi XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Ruolo dei test di clonalità nei disordini linfoproliferativi Dr.ssa Claudia Mannu Laboratorio di Patologia Molecolare,

Dettagli

GIE - Gruppo Italiano di studio di Ematopatologia

GIE - Gruppo Italiano di studio di Ematopatologia INDAGINI DI CARATTERIZZAZIONE CITOFLUORIMETRICA E GENETICO- MOLECOLARE PREFAZIONE La diagnosi delle malattie linfoproliferative si basa sull integrazioni delle informazioni istomorfologiche con i dati

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Elenco degli esami molecolari prescrivibili e a carico del SSN

Elenco degli esami molecolari prescrivibili e a carico del SSN Fondazione IRCCS Istituto Nazionale dei Tumori 02 20133 milano - via venezian, 1 - tel. 02 23901 - telex 333290 tumist I - codice fiscale 80018230153 - partita i.v.a. 04376350155 Dipartimento di Patologia

Dettagli

I markers biologici come fattori predittivi di efficacia terapeutica nei tumori solidi: l esperienza di Varese

I markers biologici come fattori predittivi di efficacia terapeutica nei tumori solidi: l esperienza di Varese I markers biologici come fattori predittivi di efficacia terapeutica nei tumori solidi: l esperienza di Varese Daniela Furlan U.O. Anatomia Patologica, Ospedale di Circolo e Fondazione Macchi, Varese Il

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Elenco dei test di patologia cromosomica e molecolare

Elenco dei test di patologia cromosomica e molecolare Elenco dei test di patologia cromosomica e molecolare Test Metodo utilizzato Osservazioni, indicazioni Amplificazione genica Her2/neu nei carcinoma mammari e gastrici L amplificazione genica di Her2/neu

Dettagli

Scheda di presentazione del progetto. Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica

Scheda di presentazione del progetto. Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica Scheda di presentazione del progetto Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica Obiettivi del progetto Lo scopo di questo progetto e quello di

Dettagli

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi IV Congresso Regionale I Congresso del Middle Management di Area Tecnica Federazione Italiana Tecnici di Laboratorio Biomedico Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi Dott.ssa

Dettagli

Tecniche di patologia molecolare finalizzate all'analisi di mutazioni

Tecniche di patologia molecolare finalizzate all'analisi di mutazioni Tecniche di patologia molecolare finalizzate all'analisi di mutazioni dei geni predittivi di risposta alla terapia oncologica Carmelo Lupo Casa di Cura La Maddalena Palermo Test molecolari PREDITTIVI di

Dettagli

Corso di Laurea in TECNICHE DI LABORATORIO BIOMEDICO

Corso di Laurea in TECNICHE DI LABORATORIO BIOMEDICO Corso di Laurea in TECNICHE DI LABORATORIO BIOMEDICO Anno: 3 Semestre: 2 Corso integrato: TECNICHE DIAGNOSTICHE DI CITOPATOLOGIA ED ISTOPATOLOGIA Disciplina: BIOLOGIA MOLECOLARE APPLICATA ALL ANATOMIA

Dettagli

XIII RIUNIONE ANNUALE ASSOCIAZIONE ITALIANA REGISTRI TUMORI - AIRTUM Siracusa, 6/8 Maggio 2009. R. Sunseri 2,N. Romano 2.

XIII RIUNIONE ANNUALE ASSOCIAZIONE ITALIANA REGISTRI TUMORI - AIRTUM Siracusa, 6/8 Maggio 2009. R. Sunseri 2,N. Romano 2. XIII RIUNIONE ANNUALE ASSOCIAZIONE ITALIANA REGISTRI TUMORI - AIRTUM Siracusa, 6/8 Maggio 2009 Sottotipi di carcinoma della mammella identificati con markers immunoistochimici: dati del Registro Tumori

Dettagli

Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA

Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA SEZIONE LOMBARDA Aggiornamenti 2011 Corso di aggiornamento per Tecnici di Laboratorio Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA Azienda Ospedaliera S. Antonio Abate

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

Sede nazionale: Via Ravenna, 34 00161 Roma - Tel.: 06.4403763 www.ail.it

Sede nazionale: Via Ravenna, 34 00161 Roma - Tel.: 06.4403763 www.ail.it marsteller/ B-M Healthcare Sede nazionale: Via Ravenna, 34 00161 Roma - Tel.: 06.4403763 www.ail.it IN COLLABORAZIONE CON: SI RINGRAZIA: PER AVER SOSTENUTO L AIL NELLA DIFFUSIONE DI QUESTO MESSAGGIO. L

Dettagli

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI Alcune malattie infettive ad eziologia virale e andamento benigno nei soggetti immunocompetenti, se sono contratte durante la gravidanza, possono rappresentare

Dettagli

F ORMATO EUROPEO INFORMAZIONI PERSONALI MASI SERENA ISTRUZIONE E FORMAZIONE PER IL CURRICULUM VITAE. Nome Indirizzo Telefono Fax E-mail

F ORMATO EUROPEO INFORMAZIONI PERSONALI MASI SERENA ISTRUZIONE E FORMAZIONE PER IL CURRICULUM VITAE. Nome Indirizzo Telefono Fax E-mail F ORMATO EUROPEO PER IL CURRICULUM VITAE INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail MASI SERENA Nazionalità Italiana Data di nascita ISTRUZIONE E FORMAZIONE Date 2002 2007 (data conseguimento:

Dettagli

Strumenti e Tecniche di studio in patologia

Strumenti e Tecniche di studio in patologia Strumenti e Tecniche di studio in patologia Gli strumenti della patologia: Microscopia Biologia molecolare Indagini biochimiche Microscopia Ottica citopatologia ed istopatologia citochimica ed istochimica

Dettagli

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO Documento redatto da: Dott.ssa T.Venesio, Dr.ssa A. Balsamo - Laboratorio di Patologia

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Malattie ematologiche maligne

Malattie ematologiche maligne Malattie ematologiche maligne Sono tutte condizioni di crescita cellulare incontrollata di cellule emopoietiche. Malattie quindi di notevole gravità. CELLULA MIELOIDE CELLULA LINFOIDE Malattie mieloproliferative

Dettagli

Polipi. Sessili. Peduncolati

Polipi. Sessili. Peduncolati Polipi Sessili Peduncolati Polipi Intestinali Polipi iperplastici 25% Polipi amartomatosi

Dettagli

HPV metodiche molecolari e considerazioni su una casistica omogenea

HPV metodiche molecolari e considerazioni su una casistica omogenea XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012 HPV metodiche molecolari e considerazioni su una casistica omogenea Dott. Filippo Micheli HPV I Papillomavirus sono

Dettagli

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV ADULTS AND CHILDREN ESTIMATED TO BE LIVING WITH HIV/AIDS,

Dettagli

Unità Operativa Complessa ANATOMIA PATOLOGICA

Unità Operativa Complessa ANATOMIA PATOLOGICA Unità Operativa Complessa ANATOMIA PATOLOGICA sanitaria Descrizione L obiettivo fondamentale è fornire diagnosi corrette, complete, tempestive e clinicamente rilevanti. Gli esami istologici e citologici

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

UNA STRANA MASSA ADDOMINALE

UNA STRANA MASSA ADDOMINALE UNA STRANA MASSA ADDOMINALE Uomo di 50 anni Altezza 1,70m Peso 88 kg Professione impiegato Coniugato Due figli Anamnesi patologica remota 1997 Ernioplastica ombelicale Obesita Ipertensione arteriosa bolderline

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE

LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE UNA NUOVA FRONTIERA NELLA DIAGNOSI DI ALCUNI TUMORI La diagnostica molecolare ha l obiettivo di accertare un ampia varietà di patologie (infettive, oncologiche

Dettagli

CARCINOMA DELLA MAMMELLA

CARCINOMA DELLA MAMMELLA CARCINOMA DELLA MAMMELLA TRATTAMENTO LOCO REGIONALE e ADIUVANTE NEOPLASIE INTRAEPITELIALI DELLA MAMMELLA Neoplasia Lobulare Intraepiteliale (LIN 2-3) Nessun trattamento (dopo la diagnosi) Resezione mammaria

Dettagli

Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32

Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32 2 Workshop SIES di Ematologia traslazionale Verona, 21-22 Maggio 2009 Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32 Identificazione di una correlazione tra l'espressione

Dettagli

Domande relative alla specializzazione in: Oncologia medica

Domande relative alla specializzazione in: Oncologia medica Domande relative alla specializzazione in: Oncologia medica Domanda #1 (codice domanda: n.541) : Cosa caratterizza il grado T2 del colangiocarcinoma? A: Interessamento del connettivo periduttale B: Coinvolgimento

Dettagli

La diagnostica del carcinoma prostatico Girolamo Morelli

La diagnostica del carcinoma prostatico Girolamo Morelli La diagnostica del carcinoma prostatico Girolamo Morelli Ricercatore presso l Università di Pisa U.O. di Urologia Universitaria Generalità Neoplasia non cutanea più frequente nel maschio Malattia a lenta

Dettagli

XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012. Citoassistenza e Gestione del materiale biologico on site:

XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012. Citoassistenza e Gestione del materiale biologico on site: XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012 Citoassistenza e Gestione del materiale biologico on site: CASI CLINICI Dr.ssa Paola Baccarini, U.O. Anatomia Patologica

Dettagli

LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE.

LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE. LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE. Dott.ssa Marchi Barbara Biologa sanitaria COMBINAZIONE TRA LA BIOLOGIA MOLECOLARE

Dettagli

CATALOGO PRESTAZIONI PER I CLIENTI UTENTI ESTERNI

CATALOGO PRESTAZIONI PER I CLIENTI UTENTI ESTERNI U. O. ANATOMIA PATOLOGICA - LEGNANO Direttore Dott.ssa Agnese Assi Telefono segreteria: 0331/449358-449266 Fax:0331/449266 e-mail: anatomopatologialegnano@ao-legnano.it Indirizzo: Via Candiani,2-20025

Dettagli

Area Funzionale Omogenea Anatomia ed Istologia Patologica. 1.0 Carta dei servizi per il cittadino utente

Area Funzionale Omogenea Anatomia ed Istologia Patologica. 1.0 Carta dei servizi per il cittadino utente Area Funzionale Omogenea 1.0 Carta dei servizi per il cittadino utente Pag. 2 di 9 INDICE 1.1 Generalità 3 1.2 Missione 3 1.3 Il team 3 1.3.1. Come trovarci 4 1.3.2. Orario del servizio 4 1.4 Prodotti

Dettagli

Carta dei Servizi U.O.C. Laboratorio di Virologia Molecolare

Carta dei Servizi U.O.C. Laboratorio di Virologia Molecolare Carta dei Servizi U.O.C. Laboratorio di Virologia Molecolare Mission Il Policlinico Tor Vergata ha iniziato, dal 10 gennaio 2001, a costruire insieme con tutti i suoi professionisti l ospedale umano aperto

Dettagli

Il Nodulo Tiroideo. "Diagnostica Citologica"

Il Nodulo Tiroideo. Diagnostica Citologica Il Nodulo Tiroideo "Diagnostica Citologica" FNAC Con il termine di FNAC (Fine Needle Aspiration Cytology) si intende un prelievo citologico eseguito mediante un ago definito sottile (a partire da 22G ),

Dettagli

Splenomegalia cronica associata a pancitopenia in paziente con infezione da HIV-1. Prof. Ivano Mezzaroma

Splenomegalia cronica associata a pancitopenia in paziente con infezione da HIV-1. Prof. Ivano Mezzaroma Splenomegalia cronica associata a pancitopenia in paziente con infezione da HIV-1 Prof. Ivano Mezzaroma SPLENOMEGALIE e CITOPENIE Classificazione etiologica A) Flogistica Infezioni (setticemie, brucellosi,

Dettagli

Funzione della struttura di riferimento regionale per la gestione delle infezioni in gravidanza

Funzione della struttura di riferimento regionale per la gestione delle infezioni in gravidanza CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE Funzione della struttura di riferimento regionale per la gestione delle infezioni in gravidanza Dott.ssa Nadia Gussetti U.O. Malattie

Dettagli

Laura Catena Istituto di Oncologia Policlinico di Monza

Laura Catena Istituto di Oncologia Policlinico di Monza Oncologia epato-bilio-pancreatica Metastasi da tumore a sede primitiva ignota Monza, 06 Maggio 2011 Laura Catena Istituto di Oncologia Policlinico di Monza Epidemiologia Rappresentano meno del 5% di tutte

Dettagli

WWW.FISIOKINESITERAPIA.BIZ CRIOGLOBULINEMIA MISTA

WWW.FISIOKINESITERAPIA.BIZ CRIOGLOBULINEMIA MISTA WWW.FISIOKINESITERAPIA.BIZ CRIOGLOBULINEMIA MISTA CRIOGLOBULINEMIA MISTA La Crioglobulinemia mista (CM) è una vasculite dei vasi di piccolo e medio calibro descritta come malattia autonoma per la prima

Dettagli

Patologia e aspetti biologici nel carcinoma mammario metastatico

Patologia e aspetti biologici nel carcinoma mammario metastatico Patologia e aspetti biologici nel carcinoma mammario metastatico Cristina Riva Laura Cimetti Dipartimento di Morfologia Umana Università dell Insubria Varese Il 20-30% delle pazienti affette da carcinoma

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

CASO CLINICO carcinoma mammario ErbB2+ con M+ SNC

CASO CLINICO carcinoma mammario ErbB2+ con M+ SNC CASO CLINICO carcinoma mammario ErbB2+ con M+ SNC METASTASI CEREBRALI DA CA MAMMELLA 10-30% delle pazienti con tumore mammario in fase avanzata Insorgono tardivamente nella storia naturale della malattia

Dettagli

PRELIEVO DI LIQUIDO AMNIOTICO

PRELIEVO DI LIQUIDO AMNIOTICO PRELIEVO DI LIQUIDO AMNIOTICO ANALISI DEL DNA PRELIEVO DI VILLI CORIALI Ivilli coriali e tutte le strutture placentari sono di origine embrionale: di conseguenza la dotazione cromosomica dei singoli elementi

Dettagli

Disordini linfoproliferativi: leucemie linfoidi

Disordini linfoproliferativi: leucemie linfoidi DIAGNOSTICA CITO-ISTOLOGICA DELLE MALATTIE LINFO-EMATOPOIETICHE NEI PICCOLI ANIMALI seminario organizzato nell'ambito del corso di Diagnostica cito-istologica veterinaria a.a. 2005-2006 Udine, Venerdì

Dettagli

VEQ in Biologia Molecolare ciclo 2013. HBV DNA HIV RNA HCV RNA Genotipo HCV

VEQ in Biologia Molecolare ciclo 2013. HBV DNA HIV RNA HCV RNA Genotipo HCV VEQ in Biologia Molecolare ciclo 2013 HBV DNA HIV RNA HCV RNA Genotipo HCV Firenze 21 ottobre 2014 Maria Grazia Colao VEQ 2013 2 7 54 4 1 1 2 17 5 3 2 4 1 2 4 3 112 partecipanti Metodi utilizzati Gruppi

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B Diagnosi e tipizzazione di IPD in biologia molecolare direttamente da campione clinico in pazienti con terapia antibiotica in atto Cristina Massai Clinica Pediatrica II Ospedale Meyer Università di Firenze

Dettagli

I CARCINOMI DELLA MAMMELLA : CLASSIFICAZIONE T.N.M. CLASSIFICAZIONE CLINICA (prima del trattamento -preoperatoria)

I CARCINOMI DELLA MAMMELLA : CLASSIFICAZIONE T.N.M. CLASSIFICAZIONE CLINICA (prima del trattamento -preoperatoria) I CARCINOMI DELLA MAMMELLA : CLASSIFICAZIONE T.N.M A cura del Dott. G.Antonini RIASSUNTO La classificazione della Unione Internazionale Contro il Cancro ha proposto una classificazione in base alle dimensioni

Dettagli

CARCINOSARCOMA DELLA COLECISTI ALFAFETOPROTEINA SECERNENTE: PRESENTAZIONE DI UN CASO

CARCINOSARCOMA DELLA COLECISTI ALFAFETOPROTEINA SECERNENTE: PRESENTAZIONE DI UN CASO NUOVO OSPEDALE DI SANTORSO Unità Operativa Complessa di Chirurgia Direttore: Dott. Matteo Rebonato CARCINOSARCOMA DELLA COLECISTI ALFAFETOPROTEINA SECERNENTE: PRESENTAZIONE DI UN CASO Dott.ssa M. Fontana,

Dettagli

PATOLOGIA MOLECOLARE

PATOLOGIA MOLECOLARE Diagnosi rischio individuale diagnosi precoce PATOLOGIA MOLECOLARE prognosi therapia singolo paziente Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail.

Dettagli

MALATTIE INFETTIVE E PARASSITARIE

MALATTIE INFETTIVE E PARASSITARIE MALATTIE INFETTIVE E PARASSITARIE MALATTIE INFETTIVE 1) L organismo deve essere costantemente ritrovato nella lesione caratterizzante la malattia 2) Il microorganismo deve poter essere isolato da singole

Dettagli

SCHEDA DI VALUTAZIONE PER L INSERIMENTO DI FARMACI NON PRESENTI NEL PTR

SCHEDA DI VALUTAZIONE PER L INSERIMENTO DI FARMACI NON PRESENTI NEL PTR RICHIESTA DI INSERIMENTO IN PTR DI MARAVIROC ATC J05AX09 (Celsentri ) Presentata da Commissione Terapeutica Provinciale Sassari In data novembre 2008 Per le seguenti motivazioni: Trattamento dell infezione

Dettagli

CASO CLINICO. Resezione chirurgica e esame istologico: glioblastoma multiforme

CASO CLINICO. Resezione chirurgica e esame istologico: glioblastoma multiforme CASO CLINICO Bambina di 8 anni Manifestazione acuta: linguaggio incomprensibile e sguardo fisso per 10 minuti collasso di 30 secondi con attacco epilettico generalizzato tonico-clonico vomito e stato di

Dettagli

Mononucleosi infettiva

Mononucleosi infettiva Mononucleosi infettiva Dr. Gianluca Russo, Mingha Africa Onlus La mononucleosi infettiva è una malattia acuta ad andamento quasi sempre spontaneamente benigno che interessa il sistema reticolo-istiocitario,

Dettagli

11 Incontro di Oncologia ed Ematologia

11 Incontro di Oncologia ed Ematologia 11 Incontro di Oncologia ed Ematologia Sestri Levante, 18 maggio 2013 Maria Sironi C è ancora un ruolo per la citologia da agoaspirato con ago sottile nella diagnostica dei noduli mammari? 1 mm Quali tecniche

Dettagli

Implementazione del progetto di una Biobanca in Humanitas Mater Domini. Carlo Carnaghi

Implementazione del progetto di una Biobanca in Humanitas Mater Domini. Carlo Carnaghi Implementazione del progetto di una Biobanca in Humanitas Mater Domini Carlo Carnaghi UO Oncologia e Ematologia Servizio di Oncologia 8 Giornata Onco-Ematologica Varesina Le esperienze di eccellenza nel

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' PERSONE SOTTOPOSTE AL TEST QUESITO Campione Biologico Tampone

Dettagli

Breast Units / Centri di Senologia: verso gli standard europei

Breast Units / Centri di Senologia: verso gli standard europei Breast Units / Centri di Senologia: verso gli standard europei Approccio multidisciplinare e medicina personalizzata Roberto Labianca Direttore Cancer Center AO Papa Giovanni XXIII Direttore DIPO Bergamo

Dettagli

IL LABORATORIO IN GASTROENTEROLOGIA. www.fisiokinesiterapia.biz

IL LABORATORIO IN GASTROENTEROLOGIA. www.fisiokinesiterapia.biz IL LABORATORIO IN GASTROENTEROLOGIA www.fisiokinesiterapia.biz sangue feci espirato mucosa succo duodenale DIAGNOSTICA H. PYLORI Dosaggio Abs di classe IgG 13 C-Urea Breath Test Dosaggio Ag fecali Gastropanel

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo

Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo EPATITE B: DIAGNOSI. Il Laboratorio GA Niro, A Andriulli Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo La descrizione del meccanismo replicativo del virus

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Carta dei Servizi (v.1.4)

Carta dei Servizi (v.1.4) Carta dei Servizi (v.1.4) Cancer Genetic Test Laboratory (CGT Lab) Gentili Signori, Il Laboratorio Cancer Genetic Test (CGT Lab), Servizio di medicina di laboratorio specializzato senza punto di prelievo,

Dettagli

Sancta Maria Spes Nostra Ancilla Domini Sedes Sapientiae Ora Pro Nobis Dott. Carmelo Debilio

Sancta Maria Spes Nostra Ancilla Domini Sedes Sapientiae Ora Pro Nobis Dott. Carmelo Debilio Dirigente Medicina Interna Specialista in Reumatologia Viale Luigi Einaudi 6 93016 Riesi (Cl) Tel. 0934/922009 Cell. 331/2515580. - www.reumatologiadebilio.de Le Vasculiti Gruppo eterogeneo di malattie

Dettagli

TBNA Utilità della Citologia e aspetti metodologici Cristina Maddau

TBNA Utilità della Citologia e aspetti metodologici Cristina Maddau TBNA Utilità della Citologia e aspetti metodologici Cristina Maddau Istituto per lo Studio e la Prevenzione Oncologica Unità Operativa di Citopatologia La citologia polmonare riveste un ruolo rilevante

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

ABI-7700 User Bulletin #5

ABI-7700 User Bulletin #5 ABI-7700 User Bulletin #5 1. halogen tungsten lamp 2b. emission filters 3. intensifier 5. ccd detector 350,000 pixels 2a. excitation filters 4. sample plate www.biorad.com 3 Real-time qpcr - La fluorescenza

Dettagli

Università degli Studi di Catania MORBO DI CROHN. U.O. di Chirurgia Laparoscopica A.O.U. Policlinico G.Rodolico - Catania Direttore: Prof. V.

Università degli Studi di Catania MORBO DI CROHN. U.O. di Chirurgia Laparoscopica A.O.U. Policlinico G.Rodolico - Catania Direttore: Prof. V. Università degli Studi di Catania MORBO DI CROHN U.O. di Chirurgia Laparoscopica A.O.U. Policlinico G.Rodolico - Catania Direttore: Prof. V. Minutolo Crohn nel 1932 definì ILEITE TERMINALE un affezione

Dettagli

1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RESPONSABILITÀ...2 3. DEFINIZIONI E ABBREVIAZIONI...2 4. MODALITÀ DI INVIO DEI CAMPIONI AL LABORATORIO...

1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RESPONSABILITÀ...2 3. DEFINIZIONI E ABBREVIAZIONI...2 4. MODALITÀ DI INVIO DEI CAMPIONI AL LABORATORIO... Pagina 1 di 6 INDICE 1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RESPONSABILITÀ...2 3. DEFINIZIONI E ABBREVIAZIONI...2 3.1 Definizioni...2 3.2 Abbreviazioni...2 4. MODALITÀ DI INVIO DEI CAMPIONI AL LABORATORIO...2

Dettagli

Dirigente medico I livello Istituto Tumori-Fondazione Pascale-Napoli. f.tatangelo@istitutotumori.na.it

Dirigente medico I livello Istituto Tumori-Fondazione Pascale-Napoli. f.tatangelo@istitutotumori.na.it CURRICULUM VITAE INFORMAZIONI PERSONALI Cognome Nome TATANGELO FABIANA Data di nascita 25/02/1957 Qualifica Amministrazione Dirigente medico I livello Istituto Tumori-Fondazione Pascale-Napoli Incarico

Dettagli

Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare

Dettagli

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene I linfociti T sono le cellule dell immunità adattativa responsabili della protezione verso le infezioni ad opera dei microbi intracellulari. Essi derivano da cellule staminali del midollo osseo che si

Dettagli

La leishmaniosi è una malattia trasmessa da vettori, dovuta a numerose specie

La leishmaniosi è una malattia trasmessa da vettori, dovuta a numerose specie Leishmaniosi Dr. Gianluca Russo, Mingha Africa Onlus La leishmaniosi è una malattia trasmessa da vettori, dovuta a numerose specie del protozoo Leishmania spp, che si manifesta in tre forme cliniche principali:

Dettagli

Reparto - Analisi Anno Fornitore

Reparto - Analisi Anno Fornitore ISTITUTO CANTONALE DI PATOLOGIA 4.3.MO lista controlli qualità esterni 4 - Realizzazione di prestazioni 4.3 - Garanzia della qualità dei risultati Tipo: MO Versione: 1.17 Creato 10.12.2008 Redatto 06.06.2012

Dettagli

22-23 aprile Sestri Levante

22-23 aprile Sestri Levante 22-23 aprile Sestri Levante CORSO DI MORFOLOGIA DELLO STRISCIO PERIFERICO: lo striscio periferico ci può dire qualcosa? guardare con attenzione!!! ASL 4 CHIAVARESE LABORATORIO ANALISI SETTORE EMATOLOGIA,

Dettagli

06.08.2015. Le analisi di Patologia Molecolare in ICP: nuovo flusso di lavoro. A che punto siamo: riassunto. A che punto siamo: riassunto

06.08.2015. Le analisi di Patologia Molecolare in ICP: nuovo flusso di lavoro. A che punto siamo: riassunto. A che punto siamo: riassunto A che punto siamo: riassunto Analisi totali 1200 1000 Le analisi di Patologia Molecolare in ICP: nuovo flusso di lavoro N u m e ro te s ts 800 600 400 200 0 2007 2008 2009 2010 2011 2012 2013 2014* Pat.

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

a. 10 b. 0 a. 1 b. 1 Base multiplo CFU 1 Specifica CFU _25_/ 25 (almeno 15 e fino a 25 ore per tirocinio e restante per _10_/ 25 studio individuale)

a. 10 b. 0 a. 1 b. 1 Base multiplo CFU 1 Specifica CFU _25_/ 25 (almeno 15 e fino a 25 ore per tirocinio e restante per _10_/ 25 studio individuale) Scuola di specializzazione in Oncologia Medica Denominazione (denominazione in inglese) Area Sotto-area (solo per l area dei servizi clinici) Classe Obiettivi formativi e descrizione (da indicare quelli

Dettagli

LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI

LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI Il Consiglio Direttivo Nazionale LILT, nella seduta del 19 marzo 2015, ha formalmente approvato la documentazione relativa ai lavori della Commissione tecnico-scientifica

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

BIOLOGIA MOLECOLARE NELLA DIAGNOSTICA MOLECOLARE DIAGNOSI DIAGNOSI PRENATALE ONCOLOGICA PRELIEVO DI LIQUIDO AMNIOTICO

BIOLOGIA MOLECOLARE NELLA DIAGNOSTICA MOLECOLARE DIAGNOSI DIAGNOSI PRENATALE ONCOLOGICA PRELIEVO DI LIQUIDO AMNIOTICO BIOLOGIA MOLECOLARE NELLA DIAGNOSTICA MOLECOLARE DIAGNOSI PRENATALE PRELIEVO DI LIQUIDO AMNIOTICO ANALISI DEL DNA PRELIEVO DI VILLI CORIALI Ivilli coriali e tutte le strutture placentari sono di origine

Dettagli

Innovazioni tecnologiche ed applicazioni nel trattamento radioterapico dei tumori mammari: CASO CLINICO

Innovazioni tecnologiche ed applicazioni nel trattamento radioterapico dei tumori mammari: CASO CLINICO Innovazioni tecnologiche ed applicazioni nel trattamento radioterapico dei tumori mammari: CASO CLINICO O. Lora, F. Gregucci, A. Negri* U.O. di Radioterapia e Medicina Nucleare *U.O. Di Fisica Sanitaria

Dettagli

SLIDE SEMINAR CITOLOGIA DELLE VIE URINARIE

SLIDE SEMINAR CITOLOGIA DELLE VIE URINARIE SLIDE SEMINAR CITOLOGIA DELLE VIE URINARIE CASO N 1 STORIA CLINICA SINTESI ANAMNESTICA: maschio, 69 aa., follow-up in paziente con diagnosi di neoplasia uroteliale papillare a basso grado di malignità.

Dettagli

Il controllo di qualità in anatomia patologica e negli screening oncologici Torino 9-10 giugno 2008

Il controllo di qualità in anatomia patologica e negli screening oncologici Torino 9-10 giugno 2008 Il controllo di qualità in anatomia patologica e negli screening oncologici Torino 9-10 giugno 2008 HPV:qualità del test e del percorso diagnostico Massimo Confortini UO Citologia Analitica e Biomolecolare

Dettagli

Marcatori classici. Colon. Mammella. Polmone. CEA Ca19-9. Ca15.3 CEA. CEA (adenocarcinoma) Cyfra (spinocellulare) NSE (microcitoma)

Marcatori classici. Colon. Mammella. Polmone. CEA Ca19-9. Ca15.3 CEA. CEA (adenocarcinoma) Cyfra (spinocellulare) NSE (microcitoma) Markers tumorali Colon CEA Ca199 Mammella Ca15.3 CEA Polmone CEA (adenocarcinoma) Cyfra (spinocellulare) NSE (microcitoma) Marcatori classici Problemi di interpretazione Bassa sensibilità Marcatore negativo

Dettagli

Cancro del colon. Diagnosi del cancro del colon. Terapia del cancro del colon. [ Maurizio Pianezza 2008 - Tutti i diritti riservati]

Cancro del colon. Diagnosi del cancro del colon. Terapia del cancro del colon. [ Maurizio Pianezza 2008 - Tutti i diritti riservati] [ Maurizio Pianezza 2008 - Tutti i diritti riservati] Cancro del colon Il mio comportamento Diagnosi del cancro del colon - clisma Tc - coloscopia con biopsia - T-PET - markers tumorali Cea Ca 19.9 Ca

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Carcinoma basaloide della mammella: definizioni ed implicazioni cliniche. Luca Mazzucchelli SenoForum 2009, Lugano

Carcinoma basaloide della mammella: definizioni ed implicazioni cliniche. Luca Mazzucchelli SenoForum 2009, Lugano Carcinoma basaloide della mammella: definizioni ed implicazioni cliniche Luca Mazzucchelli SenoForum 2009, Lugano L inizio della storia... Perou CM et al. Molecular portraits of human breast tumors. Nature

Dettagli

COMPARAZIONE DELLA METODICA AUTOMATICA SISH

COMPARAZIONE DELLA METODICA AUTOMATICA SISH COMPARAZIONE DELLA METODICA AUTOMATICA SISH (Silver Enhanced In Situ Hybridization) CON LA METODICA MANUALE FISH (Fluorescence In Situ Hybridization) PER LA VALUTAZIONE DELLO STATO DEL GENE HER2 (neu)

Dettagli