La biologia molecolare In Anatomia Patologica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La biologia molecolare In Anatomia Patologica"

Transcript

1 La biologia molecolare In Anatomia Patologica Parravicini C, Rossi R, Tonello C, Tosoni A, Lauri E A.O. Luigi Sacco - Milano 12 dicembre 2014

2 La biologia molecolare in Anatomia Patologica Certification and training in molecular pathology. Arber DA, Battifora H, Brynes RK, Chang KL, Weiss LM, Wilczynski SP. Hum Pathol. 1996;27(4): Certification in molecular pathology in the United States: an update from the Association for Molecular Pathology Training and Education Committee. Mackinnon AC Jr, Wang YL, Sahota A, Yeung CC, Weck KE. J Mol Diagn. 2012;14(6): (doi: /j.jmoldx ). Certification in Molecular Pathology in the United States (Training and Education Committee, the Association for Molecular Pathology) Killeen AA, Leung WC, Payne D, Sabath DE, Snow K, Tsongalis GJ, Van Deerlin V, Weck K. J Mol Diagn. 2012;14(6): (doi: /j.jmoldx ). Certification in Molecular Diagnostics Medical Doctors: M.D. certified in anatomic pathology and/or clinical pathology Doctoral-Level Clinical Scientists: M.D. or a Ph.D. degree (or the equivalent) in genetics, molecular biology, or a related biological field. Supervisors and Technologists: MD, PhD, Master, Bachelor s degree

3 since 1995 Affiliate organizations since 1999 FASEB APC ASCO ABP CAP ACMG AMA IASLC ASCP IOM AACC ICPI SLAS CLC IPC ASM ASHI ASCLS ASH ASIP USCAP CCCLW and many others

4 Since million monthly page views CLINICAL PATHOLOGY - MOLECULAR DNA purification DNA sequencing FISH Microarray PCR introduction analyzing purity basic protocol anion exchange chromatography cesium chloride density gradient centrifugation commercial DNA extraction machines ethanol precipitation organic extraction PCR inhibitors RNA purification silica adsorption tissue preparation history Maxam-Gilbert sequencing Sanger sequencing capillary electrophoresis other innovations real time pyroseqencing nanotechnology Roche 454 FLX pyrosequencer Illumina Genome Analyzer HeliScope Sequencer general probes protocol probe patterns images introduction history basics considerations errors variations:antibody bead based cellular CGH solid phase tissue (TMA) definition history basics Taq polymerase reaction stages thermocyclers applications variations:general methylation specific multiplex nested real-time reverse transcriptase

5 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella & C.) DNA/RNA extraction-purification; PCR (multiplex, nested, real-time, RT-PCR); DNA sequencing (capillary, pyrosequencing); In-situ hybridization (non radioactive); FISH

6 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella & C.)

7 Diagnostica delle patologie infettive Riconoscimento di lesioni specifiche Dimostrazione intralesionale dell agente eziologico Diagnosi coerente con clinica e dati di laboratorio Sforzo diagnostico proporzionato alle ricadute terapeutiche, economiche e/o di salute pubblica

8 Diagnostica anatomopatologica su vetrino delle patologie infettive Istochimica PAS, ZN, Grocott Immunoistochimica Ab. Mono- e policlonali Ibridazione in situ Sonde a RNA e DNA (oligo non radioattivi)

9 CASO #1

10 Biopsia lingua Inviato da: Odonto CLINICA M / 20 aa Italia HIV-pos. Leucoplachia bordo linguale dx QUESITO Carcinoma? EBV/EBER Diagnosi : Hairy leukoplakia, EBV-correlata

11 CASO #2

12 Biopsie rettali Inviato da: Amb. Gastro Malattie infettive CLINICA M / 34 aa - IT HIV+ (HAART) Omosex Pregressa Castleman + KS Condilomatosi anale HPV+ Sifilide: T.pallidum ab 10,260; RPR neg. Diarrea mucosa Ulcera rettale QUESITO Colite dndd

13 Biopsie rettali Infiammazione acuta e cronica Banda basofila (Giemsa+) alla superficie luminale anti-treponema pallidum positiva (Spirochete) Spirochetosi intestinale

14 CASO #3

15 Biopsia linfonodale (ascella) Inviato da: Consulenza altro Ente (IT) Malattie infettive CLINICA M / 41 aa - IT HIV + (in HAART) KS cutaneo e mucoso Febbre, perdita di peso, pancitopenia KSHV viremia > genomi/µg -1 EBV viremia = 300 genomi/µg - QUESITO Sospetta malattia linfoproliferativa KSHV-correlata

16 Biopsia linfonodale

17 Biopsia linfonodale KS Orf73 Sarcoma di Kaposi pericapsulare KSHV/Orf73 + Plasmablasti CD20, CD30, CD138 - / KSHV/Orf73+

18 Biopsia linfonodale T1.1 T1.1 Plasmablasti positivi per T1.1 early-rna e vil6, virf early-proteins

19 Biopsia linfonodale Plasmablasti con restrizione clonale di espressione delle catene leggere, in assenza di monoclonalità dimostrabile dopo PCR per IgH

20 Biopsia linfonodale Diagnosi Colonizzazione dei centri germinativi da proliferazione plasmablastica (CD20,CD30, CD138-) con restrizione di espressione delle catene leggere delle Ig, associata a infezione replicativa da KSHV/HHV8. Quadro coerente con diagnosi di disordine linfoproliferativo germinotropico KSHV-correlato. (Du MQ, et al. KSHV- and EBV-associated germinotropic lymphoproliferative disorder. Blood Nov 1; 100(9): )

21 Diagnostica delle patologie infettive Immunoistochimica Ab. Mono- e policlonali Ibridazione in situ Sonde a RNA e DNA (oligo non radioattivi) Disponibilità commerciale

22 Diagnostica delle patologie infettive PCR IN FASE LIQUIDA SU DNA/RNA ESTRATTO DA CAMPIONI INCLUSI IN PARAFFINA Unico limite la disponibilità di sequenze in GeneBank

23 Diagnostica molecolare delle patologie infettive Quesito diagnostico clinico-patologico ISTOLOGIA ISTOCHIMICA IMMUNOISTOCHIMICA PCR Rappresentatività del campione SEZIONI SERIATE Estrazione (controlli negativi) Verifica di amplificabilità e competenza MULTIPLEX (housekeeping genes) PCR mirata (controlli positivi) SCELTA DEI PRIMERS Analisi del prodotto di amplificazione GEL, ANALISI DI SEQUENZA DIAGNOSI COERENZA TRA ISTOLOGIA, CLINICA E DATO MOLECOLARE

24 CONTROLLO DI AMPLIFICABILITA e COMPETENZA Multiplex PCR per house keeping genes con amplificati di diversa lunghezza bp house keeping genes Human AF4 gene (exon 3; GenBank accession no. Z83679) Human AF4 gene (exon 11; GenBank accession no. Z83687) Human promyelocytic leukemia zincfinger gene (PLZF, exon 1; GenBank accession no. AF060568) Human recombination activating gene (RAG1, exon 2; GenBank accession no. M29474) Human thromboxane synthase gene (TBXAS1, exon 9; GenBank accession no. D34621) Leukemia (2003) 17, (Report of the BIOMED-2 Concerted Action BMH4-CT )

25 Diagnostica molecolare delle patologie infettive Scelta dei primers Primers specifici Primers pan-specie Sequenze uniche e specifiche per un singolo microorganismo Sequenze conservate comuni a tutti i microorganismi di una specie Conservata Conservata Conservata Primer F Sequenze variabili specifiche Conservata Conservata Conservata Primer R ANALISI DI SEQUENZA

26 Diagnostica molecolare delle patologie infettive Istologia (immunoistochimica, in-situ) e/o storia clinica Quesito diagnostico mirato PCR con primers specifici

27 CASO #4

28 Biopsia esofago Inviato da: Gastroenterologia CLINICA M / 20 aa Italia. HIV-pos. Leukoplakia. QUESITO Sospetta candida Diagnosi Esofagite / ulcera da HSV I

29 CASO #5

30 Caso # Consulenza altro Ente (Besta-MI) Maschio, 54 aa. biopsia cerebrale lesione temporale posteriore dx Quesito diagnostico Lesione necrotizzante cerebrale. Presenza di inclusi citoplasmatici PAS+ sospetti per morbo di Whipple cerebrale.

31 Caso # Consulenza altro Ente (Besta-MI) Maschio, 54 aa. biopsia cerebrale lesione temporale posteriore dx

32 CASO #6

33 Biopsia linfonodale (ascella) Inviato da: Consulenza altro ente (IT) F / 76 aa - IT Febbre (regredisce con cortisone). Decadimento neurologico (da1 anno). Vive in campagna. Madre di collega

34 Biopsia linfonodale (ascella) Linfoadenite granulomatosa necrotizzante Granulociti Cellule giganti assenti Lesioni figurate Vive in campagna. Diagnosi Linfoadenite granulomatosa necrotizzante, morfologicamente compatibile con malattia da graffio di gatto. PCR per Bartonella spp (JCM 2000, 38(5): ): positiva (dimensioni del frammento amplificato consistenti con Bartonella henselae).

35 CASO #7

36 Biopsie gastriche 1) Antro 2) Bordo d ulcera Inviato da: Amb. Gastro Malattie infettive CLINICA M / 48 aa - IT HIV, HCV, HBV + QUESITO Pregressa diagnosi di Leishmaniosi (biopsia linfonodale)

37 Diagnosi Gastrite cronica granulomatosa associata alla focale presenza di forme protozoarie, in parte intracellulari, morfologicamente suggestive per Leishmania/Toxoplasma. Immunoistochimica per Toxoplasma:negativa. PCR per Leishmania spp: positiva. Quadro morfologigico e risultati delle indagini immunoistochimiche e molecolari depongono per una diagnosi di gastrite granulomatosa da Leishmania spp.

38 Diagnostica molecolare delle patologie infettive LESIONI GRANULOMATOSE a sospetta/possibile eziologia micobatterica e fungina PAS, ZN, Grocott e anti-tbcomplex negative Istochimica e immunoistochimica ambigue PCR con primers pan-specie

39 DIAGNOSTICA MOLECOLARE DELLE LESIONI GRANULOMATOSE Sistemi di PCR per micobatteri gene b.p. ref. Pan-Myco 16S 100 J Clin Microb 2002 Pan-Myco 16S 484 J Clin Microb 2000 TBcomplex IS J Clin Microb 1998

40 CASO #8

41 Caso # Biopsia cutanea (gamba) Inviato da: Malattie infettive CLINICA F / 36 aa AFRICA Centr. HIV-neg. Lesioni nodulari iperemiche, dolenti, presenti da molti anni. PPD e Quantiferum +++. QUESITO Eritema nodoso? Panniculite? Ipodermite? BK?

42 Panniculite granulomatosa con cellule giganti

43 286163

44 Caso # Analisi di sequenza del prodotto di amplificazione condotta su un frammento di 480bp: omologia del 99% con Mycobacterium gordonae. Diagnosi Quadro istologico e risultati delle indagini molecolari coerenti con panniculite lobulare granulomatosa gigantocellulare da Mycobacterium gordonae (Cases J Jul 31;2:6828)(J Cutan Pathol 2000 Mar; 27(3):124-9)

45 CASO #9

46 Caso # Biopsia cutanea (braccio) Inviato da: Consulenza altro Ente (Melegnano) CLINICA M / 12 aa Brasile / Italia. Da 8 anni in Italia HIV-neg. Lesioni cutanee braccia, gambe,volto QUESITO Lesione da micobatteri?

47 Caso #

48 Caso # PAS ZN TB-complex Fenotipo istochimico e immunoistochimico ambiguo

49 Caso # Diagnosi: Lebbra lepromatosa

50 CASO #10

51 Caso # H&E Maschio, 29aa. Lesioni ossee (colonna), polmonari, cerebrali, cutanee HIV-negativo CD4: 8 cell/µl H&E Biopsia cutanea H&E PAS Grocott

52 Caso # Giemsa PAS Biopsia ossea H&E

53 Caso # Filobasidiella neoformans Cryptococcus neoformans Identities = 198/198 (100%) CCGTAGGTGAACCTGCGGAAGGATCAG TAGAGAATATTGGACTTTGGTCCATTTAT CTACCCATCTACACCTGTGAACTGTTTAT GTGCTTCGGCACGTTTTACACAAACTTCT AAATGTAATGAATGTAATCATATTATAAC AATAATAAAACTTTCAACAACGGATCTCT TGGCTTCCGCATCGATGAAGAACGCA 145 bp 198 bp Candida rugosa Identities = 140/141 (99%) CCGTAGGTGAACCTGCGGAAGGATCATTA GAACACTGTTTAACACTGTGTCTGAGCAC GATACACGCAAACCGATCATCAACACGCT AAACAAAACTTTCAACAACGGATCTCTAG GTTCTCGCATCGATGAAGAACGCAG Diagnosi Criptococcosi cutanea Verificare (emocoltura) possibile coinfezione da Candida

54 CASO #11

55 Resezione colica (massa) Inviato da: Consulenza altro Ente (IT) Malattie infettive CLINICA M / 25 aa IT Cuoco in Irlanda (ristorante etnico) HIV-neg. Febbre da 3 mesi (antipiretici), Perdita di peso (18Kg) Massa addominale QUESITO Patologia granulomatosa a sospetta eziologia micotica

56 Caso # Massa addominale QUESITO DIAGNOSTICO (DIAGNOSI PROVVISORIA) Patologia granulomatosa a sospetta eziologia micotica TERAPIA Amfotericina liposomiale

57 Caso # Patologia granulomatosa a sospetta eziologia micotica EOSINOFILI

58 Caso # Patologia granulomatosa a sospetta eziologia micotica Grocott PAS Fenomeno di Splendore-Hoeppli

59 Caso # Patologia granulomatosa a sospetta eziologia micotica Diagnosi Basidiobolomicosi intestinale

60 Caso # Diagnosi Patologia granulomatosa a sospetta eziologia micotica Basidiobolomicosi intestinale Terapia I.V. - ricovero 1000/2000/die cps. x os - casa 2/die

61 Approccio biomolecolare alla patologia infettiva VANTAGGI Flessibilità Ottimizzazione della potenzialità diagnostica di campioni bioptici non ripetibili (archivio) Tempi e costi Diagnosi eziologica per una terapia mirata

62 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella)

63 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Ematologia (linfomi) PCR per riarrangiamento Ig e TcR BIOMED-2 Concerted Action Clonality detectable in 99% of all B-cell malignancies and 94% of all T-cell malignancies Improved reliability of lymphoma diagnostics via PCR-based clonality testing: Report of BIOMED-2 Concerted Action BMH4 CT ; Leukemia (2007); 21-2; EuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations. Leukemia Oct;26(10): doi: /leu

64 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Ematologia (linfomi) Anno Casi (totale) Linfomi (totale) Riarrangiamento Ig - TcR (totale) (agosto)

65 CASO #12

66 Caso Femmina, 53 anni, HIV-negativa. Non immunodeficienze note Non terapie immunosoppressive in corso. Linfoadenopatia generalizzata (incluso retroperitoneo)+ lesioni spleniche. Astenia, esantema e modesta eosinofilia. LDH in aumento

67 CD20 Caso H&E Linfonodo inguinale CD3

68 caso Linfonodo inguinale CD35 CD23 CD5 H&E

69 CD138 caso Linfonodo inguinale dd: linfoma plasmablastico Mum1 Bcl6 CD30

70 Alk1 caso Linfonodo inguinale dd: Anaplastic large cell lymphoma B EMA CD30

71 CD15 caso Linfonodo inguinale dd: Hodgkin lymphoma CD45 CD30

72 caso Ig-Fr1 Ig-Fr2 Linfonodo inguinale Ig-Fr3

73 EBV EBER caso Linfonodo inguinale EBV LMP KSHV Orf73 CD30

74 Diagnosi Sezioni linfonodali sostituite da una proliferazione polimorfa di blasti B CD20+, in parte a carattere plasmablastico, con fenotipo consistente per una differenziazione memory postgerminal center (CD10-; Bcl6-; Mum1+; CD138+/-). Tali elementi sono positivi per EBV/EBER e, in parte, esprimono EBV LMP. Sono presenti residui di centri germinativi CD23+ e una quota diffusa di piccoli T linfociti CD3+. Il riarrangiamento per le immunoglobuline mostra picchi monoclonali in Fr1 e Fr2, nel contesto di una attivazione oligoclonale, più evidente in Fr3. La carica virale su sangue periferico risulta di 30 copie/1µg di DNA. Nell'insieme i dati morfologici, immunoistochimici e molecolari orientano per una diagnosi di linfoma non-hodgkin B CD20+ diffuso a grandi cellule, EBV correlato. L'associazione con EBV suggerisce di investigare/escludere una possibile coesistente causa di immunodeficienza.

75 CASO #13

76 Caso Linfonodo inguinale Maschio, 25 anni, HIV-positivo. Linfoadenopatia generalizzata. Multiorgan failure. KSHV/ORF73

77 Caso Linfonodo inguinale Ki67 CD20 PAX5 EBV/EBER CD30 CD79a MUM1

78 Caso Linfonodo inguinale Diagnosi Sezioni linfonodali con quadri di subtotale sostituzione da linfoma non-hodgkin ad alto grado (Ki67>95%), diffuso a grandi cellule anaplastiche CD30 e CD45+, con fenotipo B (CD20, Pax5+) a differenziazione post-germinal center (Mum1+, CD138 +/-; CD10, Bcl2, CD15, CD3, ALK1-), EBVcorrelato (EBV/EBER+).Riarrangiamento IgH: presenza di picchi monoclonali in FR1 e FR2. Coesiste microfocolaio intranodale di sarcoma di Kaposi KSHV/Orf73+.

79 CASO #14

80 Caso / Femmina, 47 anni, HIV-negativa. Linfoadenopatia ltc. (2009) Noduli cute spalla e mammella dx (2011)

81 Caso / Linfonodo (2009) DLBCL Cute (2011) Linfoma follicolare

82 Caso / FR1 FR2 FR3 DLBCL - Linfonodo (2009) Linf. Follicolare - Cute (2011)

83 Caso / Linf. Follicolare - Cute (2011) DLBCL - Linfonodo (2009) FR1 FR2 FR3 La PCR per il riarrangiamento IgH condotta in parallelo su DNA estratto dalla lesione cutanea mammaria e su DNA estratto dalla precedente biopsia linfonodale mostra amplificati di dimensione diversa in FR1 e FR2, con coincidenza dei picchi in FR3. Il dato non consente di escludere l'ipotesi che le lesioni cutanee rappresentino una ripresa di malattia e suggeriscono una attenta valutazione clinica della paziente in ambito specialistico oncoematologico.

84 CASO #15

85 Caso Femmina, 69 anni, HIV-negativa. Nazionalità peruviana Linfoadenopatia inguinale + retrop. LDH elevate Non immunodeficienze note

86 Caso Linfonodo inguinale Necrosi coagulativa Necrosi massiva Picnosi e apoptosi

87 Caso Linfonodo inguinale (+) (-) CD3, CD4, Mum1, Bcl2, CD30 CD7, CD8, CD5, ALK1,TdT, EMA, TIA1, Perforin, Granzyme B, EBV/EBER, KSHV/Orf73 TcR - p TcR - g

88 Caso Linfonodo inguinale (+) (-) (*) CD3, CD4, Mum1, Bcl2, CD30 CD7, CD8, CD5, ALK1,TdT, EMA, TIA1, Perforin, Granzyme B, EBV/EBER, KSHV/Orf73 Ipercalcemia

89 Caso Linfonodo inguinale Diagnosi 10/7/2013 Localizzazione linfonodale da linfoma a fenotipo T (CD3+), a grandi cellule, ampiamente necrotico, con rari elementi CD30+. Indice di proliferazione: Ki67>90%. 16/7/2013 La popolazione neoplastica appare costituita da blasti T di media e grossa taglia, a volte plurinucleati e con marcato pleomorfismo nucleare, a fenotipo CD3, CD4, Mum1, Bcl2+/CD7, CD8 e CD5-. Sono presenti numerosi corpi apoptotici e mitosi atipiche. Negativa l immunoistochimica per ALK1, TdT, EMA, TIA1, Perforina e GranzymeB. Negativa l ibridazione in situ per EBV/EBER e il marcaggio per KSHV/Orf73. Il quadro Istologico dominato da fenomeni di necrosi massiva, il profilo immunoistochimico caratterizzato dalla negatività per CD7 degli elementi neoplastici positivi per CD3 e CD$, La notizia anamnestica di ipercalcemia e l origine/provenienza della paziente da area endemica, nell insieme sono altamente sospetti per un possibile leucemia/linfoma a cellule T dell adulto. Ulteriori indagini molecolari in corso 17/7/2013 PCR per riarrangiamento TCR su DNA estratto da sezioni in paraffina (amplificabilità>300bp): presenza di picco diclonale in P con G policlonale PCR per HTLV I/II: positiva DIAGNOSI DEFINITIVA: localizzazione linfonodale di linfoma/leucemia a cellule T dell adulto, HTLV I/II-correlato

90 La biologia molecolare nella U.O. di Anatomia Patologica dell Ospedale Sacco Malattie infettive (granulomi & c.) Ematologia (linfomi) Tumori solidi (colon, mammella)

91

92 If you do not ask the right questions, you do not get the right answers. A question asked in the right way often points to its own answer. Asking questions is the A-B-C of diagnosis. Edward Hodnett American poet

93 POSTULATI DI KOCH 1. L agente deve essere presente in ogni caso di malattia 2. L agente non deve essere trovato in casi di malattia differente 3.L agente si deve ritrovare nelle forme di malattia prodotte sperimentalmente

94

95 Mutation EGFR gene L858R Lung adenoca. exon 19 BRAF V600E Papillary thyroid ca., Melanoma Bcl2 Translocation Ciclin D1 Rearrangement ALK1 XP11 c-myc B-CLL, Follicular lymphoma Mantle Zone Lymphoma Lung adenoca., anaplastic lymph. Renal cell Ca. Burkitt lymphoma Deletion or Loss of gene function Gene amplificati on INI-1 E-cadherin MLH1, MSH2, MSH6, PMS2 Her2 MDM2, CKD4 Epithelioid sarcomas, renal Breast medullary lobular ca., ca., Gastric microsatellite signet ring ca. instability (Colon ca.) breast ca. and gastroesophageal ca. Liposarcomas

Ruolo dei test di clonalità nei disordini linfoproliferativi

Ruolo dei test di clonalità nei disordini linfoproliferativi XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Ruolo dei test di clonalità nei disordini linfoproliferativi Dr.ssa Claudia Mannu Laboratorio di Patologia Molecolare,

Dettagli

LA DIAGNOSI DEI LINFOMI MALIGNI ATTRAVERSO TECNICHE DI BIOLOGIA MOLECOLARE

LA DIAGNOSI DEI LINFOMI MALIGNI ATTRAVERSO TECNICHE DI BIOLOGIA MOLECOLARE LA DIAGNOSI DEI LINFOMI MALIGNI ATTRAVERSO TECNICHE DI BIOLOGIA MOLECOLARE Dott.ssa Cristina Colarossi Anatomia Patologica Istituto Oncologico del Mediterraneo Catania Linfomi I Linfomi sono malattie monoclonali

Dettagli

GIE - Gruppo Italiano di studio di Ematopatologia

GIE - Gruppo Italiano di studio di Ematopatologia INDAGINI DI CARATTERIZZAZIONE CITOFLUORIMETRICA E GENETICO- MOLECOLARE PREFAZIONE La diagnosi delle malattie linfoproliferative si basa sull integrazioni delle informazioni istomorfologiche con i dati

Dettagli

Le linfoadenopatie dal medico di famiglia all ematologo

Le linfoadenopatie dal medico di famiglia all ematologo Le linfoadenopatie dal medico di famiglia all ematologo Dott. Amalia De Renzo Ematologia, Università Federico II,Napoli 25 giugno 2011 Linfoadenopatia definizione: linfonodi di dimensioni anormali (>

Dettagli

DEFINIZIONI E CLASSIFICAZIONI

DEFINIZIONI E CLASSIFICAZIONI M. Landi DEFINIZIONI E CLASSIFICAZIONI 44% bambini sani di età < 5 anni possono presentare linfonodi palpabili in sede cervicale, ascellare ed inguinale. 24% neonati sani con linfonodi palpabili in sede

Dettagli

Le linfoadenopatie. nello studio del medico di famiglia. Giovanni PAGANA MMG - Catania Animatore di Formazione FIMMG METIS SIMG

Le linfoadenopatie. nello studio del medico di famiglia. Giovanni PAGANA MMG - Catania Animatore di Formazione FIMMG METIS SIMG Le linfoadenopatie nello studio del medico di famiglia Giovanni PAGANA MMG - Catania Animatore di Formazione FIMMG METIS SIMG motivi diversi per linfoadenopatia Medico decide se Riscontro di linfoadenopatia

Dettagli

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE

REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE REGIONE DEL VENETO AZIENDA UNITA LOCALE SOCIO SANITARIA N. 6 VICENZA PROVVEDIMENTO DEL DIRIGENTE RESPONSABILE Servizio Risorse Umane e Relazioni Sindacali delegato dal Direttore Generale dell Azienda con

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Elenco degli esami molecolari prescrivibili e a carico del SSN

Elenco degli esami molecolari prescrivibili e a carico del SSN Fondazione IRCCS Istituto Nazionale dei Tumori 02 20133 milano - via venezian, 1 - tel. 02 23901 - telex 333290 tumist I - codice fiscale 80018230153 - partita i.v.a. 04376350155 Dipartimento di Patologia

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

ESOFAGO: RAPPORTI ANATOMICI

ESOFAGO: RAPPORTI ANATOMICI ESOFAGO: RAPPORTI ANATOMICI Esofago Giunzione gastro-esofagea: endoscopicamente è definita come il punto di svasatura tra l esofago tubulare ed il limite prossimale della plicatura gastrica. Linea Z (giunzione

Dettagli

I markers biologici come fattori predittivi di efficacia terapeutica nei tumori solidi: l esperienza di Varese

I markers biologici come fattori predittivi di efficacia terapeutica nei tumori solidi: l esperienza di Varese I markers biologici come fattori predittivi di efficacia terapeutica nei tumori solidi: l esperienza di Varese Daniela Furlan U.O. Anatomia Patologica, Ospedale di Circolo e Fondazione Macchi, Varese Il

Dettagli

LE LINFOADENOPATIE. ProfAM Vannucchi-AA2009-10

LE LINFOADENOPATIE. ProfAM Vannucchi-AA2009-10 LE LINFOADENOPATIE I LINFOMI Organi linfatici primari Organi linfatici periferici mig M.O. B Sangue RICIRCOLAZIONE Progenitore linfocitario Linfonodi Milza Tess. linfatico associato alle mucose/cute Cell.

Dettagli

Analisi della Malattia Minima Residua

Analisi della Malattia Minima Residua XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Analisi della Malattia Minima Residua Dr.ssa Anna Gazzola Laboratorio di Patologia Molecolare, Sezione di Emolinfopatologia,

Dettagli

NEOPLASIE E HIV IN EPOCA HAART

NEOPLASIE E HIV IN EPOCA HAART st Infectivology Today Paestum,3 Maggio 2004 NEOPLASIE E HIV IN EPOCA HAART Iommelli R., D Abbraccio M., Aprea L., Mele R., Spatarella M., Maddaloni A., Montesarchio V. A.O. D. Cotugno, Napoli Patologie

Dettagli

Unità Operativa Complessa ANATOMIA PATOLOGICA

Unità Operativa Complessa ANATOMIA PATOLOGICA Unità Operativa Complessa ANATOMIA PATOLOGICA sanitaria Descrizione L obiettivo fondamentale è fornire diagnosi corrette, complete, tempestive e clinicamente rilevanti. Gli esami istologici e citologici

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Gli esami di laboratorio nel bambino con linfoadenopatia. Dr Guido Pastore SCDU Pediatria ASO Maggiore della Carità, Novara UPO

Gli esami di laboratorio nel bambino con linfoadenopatia. Dr Guido Pastore SCDU Pediatria ASO Maggiore della Carità, Novara UPO Gli esami di laboratorio nel bambino con linfoadenopatia Dr Guido Pastore SCDU Pediatria ASO Maggiore della Carità, Novara UPO Il bambino con linfoadenopatia è di comune riscontro nella pratica quotidiana

Dettagli

Scheda di presentazione del progetto. Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica

Scheda di presentazione del progetto. Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica Scheda di presentazione del progetto Titolo del progetto Applicazioni dell'elettroforesi capillare nella ricerca e diagnostica oncologica Obiettivi del progetto Lo scopo di questo progetto e quello di

Dettagli

Elenco dei test di patologia cromosomica e molecolare

Elenco dei test di patologia cromosomica e molecolare Elenco dei test di patologia cromosomica e molecolare Test Metodo utilizzato Osservazioni, indicazioni Amplificazione genica Her2/neu nei carcinoma mammari e gastrici L amplificazione genica di Her2/neu

Dettagli

Tumori Maligni Rari. Neoplasie dell Esofago. Fattori di Rischio. Carcinoma Esofageo. Scaricato da SunHope. carcinoma a piccole cellule

Tumori Maligni Rari. Neoplasie dell Esofago. Fattori di Rischio. Carcinoma Esofageo. Scaricato da SunHope. carcinoma a piccole cellule Tumori Maligni Rari carcinoma a piccole cellule Neoplasie dell Esofago Marco Romano Dipartimento di Internistica Clinica e Sperimentale Gastroenterologia SUN Tel: 0815666714 E-mail: marco.romano@unina2.it

Dettagli

Requisiti minimi e standard di refertazione per carcinoma della mammella

Requisiti minimi e standard di refertazione per carcinoma della mammella SIAPEC PIEMONTE Concordanza e uniformità di refertazione diagnostica nelle anatomie patologiche della Regione Piemonte Requisiti minimi e standard di refertazione per carcinoma della mammella Statement

Dettagli

XIII RIUNIONE ANNUALE ASSOCIAZIONE ITALIANA REGISTRI TUMORI - AIRTUM Siracusa, 6/8 Maggio 2009. R. Sunseri 2,N. Romano 2.

XIII RIUNIONE ANNUALE ASSOCIAZIONE ITALIANA REGISTRI TUMORI - AIRTUM Siracusa, 6/8 Maggio 2009. R. Sunseri 2,N. Romano 2. XIII RIUNIONE ANNUALE ASSOCIAZIONE ITALIANA REGISTRI TUMORI - AIRTUM Siracusa, 6/8 Maggio 2009 Sottotipi di carcinoma della mammella identificati con markers immunoistochimici: dati del Registro Tumori

Dettagli

IL RUOLO DELLE SOCIETA SCIENTIFICHE SIAPeC IAP

IL RUOLO DELLE SOCIETA SCIENTIFICHE SIAPeC IAP Roma 25-26 ottobre 2011 Camera dei Deputati Palazzo Marini Sala della Mercede IL RUOLO DELLE SOCIETA SCIENTIFICHE SIAPeC IAP (Società di Anatomia Patologica e Citopatologia diagnostica Divisione Italiana

Dettagli

Tecniche di patologia molecolare finalizzate all'analisi di mutazioni

Tecniche di patologia molecolare finalizzate all'analisi di mutazioni Tecniche di patologia molecolare finalizzate all'analisi di mutazioni dei geni predittivi di risposta alla terapia oncologica Carmelo Lupo Casa di Cura La Maddalena Palermo Test molecolari PREDITTIVI di

Dettagli

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi IV Congresso Regionale I Congresso del Middle Management di Area Tecnica Federazione Italiana Tecnici di Laboratorio Biomedico Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi Dott.ssa

Dettagli

Corso di Laurea in TECNICHE DI LABORATORIO BIOMEDICO

Corso di Laurea in TECNICHE DI LABORATORIO BIOMEDICO Corso di Laurea in TECNICHE DI LABORATORIO BIOMEDICO Anno: 3 Semestre: 2 Corso integrato: TECNICHE DIAGNOSTICHE DI CITOPATOLOGIA ED ISTOPATOLOGIA Disciplina: BIOLOGIA MOLECOLARE APPLICATA ALL ANATOMIA

Dettagli

Sede nazionale: Via Ravenna, 34 00161 Roma - Tel.: 06.4403763 www.ail.it

Sede nazionale: Via Ravenna, 34 00161 Roma - Tel.: 06.4403763 www.ail.it marsteller/ B-M Healthcare Sede nazionale: Via Ravenna, 34 00161 Roma - Tel.: 06.4403763 www.ail.it IN COLLABORAZIONE CON: SI RINGRAZIA: PER AVER SOSTENUTO L AIL NELLA DIFFUSIONE DI QUESTO MESSAGGIO. L

Dettagli

Il sistema immunitario: LE MALATTIE CHIARA SARACENI 3B A.S.2011-2012

Il sistema immunitario: LE MALATTIE CHIARA SARACENI 3B A.S.2011-2012 Il sistema immunitario: LE MALATTIE CHIARA SARACENI 3B A.S.2011-2012 DIFESA DELL ORGANISMO IMMUNITA INNATA IMMUNITA ACQUISITA Immunità innata IMMUNITA ACQUISITA IMMUNITA CELLULO-MEDIATA IMMUNITA UMORALE

Dettagli

Peculiarita del trattamento integrato nei pazienti HIV

Peculiarita del trattamento integrato nei pazienti HIV Peculiarita del trattamento integrato nei pazienti HIV Clinica'di'Mala*e'Infe*ve'' Azienda'Ospedaliera'di'Perugia' 31/10/2014' ' Dr.'Claudio'Sfara' Dr.ssa'Laura'Bernini' Carcinoma anale 2.5% delle neoplasie

Dettagli

F ORMATO EUROPEO INFORMAZIONI PERSONALI MASI SERENA ISTRUZIONE E FORMAZIONE PER IL CURRICULUM VITAE. Nome Indirizzo Telefono Fax E-mail

F ORMATO EUROPEO INFORMAZIONI PERSONALI MASI SERENA ISTRUZIONE E FORMAZIONE PER IL CURRICULUM VITAE. Nome Indirizzo Telefono Fax E-mail F ORMATO EUROPEO PER IL CURRICULUM VITAE INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail MASI SERENA Nazionalità Italiana Data di nascita ISTRUZIONE E FORMAZIONE Date 2002 2007 (data conseguimento:

Dettagli

LINFOADENOMEGALIE. Reattive -infettive. Neoplastiche. Classificazione eziologica. - autoimmunitarie -metaboliche - tossico-medicamentose - aspecifiche

LINFOADENOMEGALIE. Reattive -infettive. Neoplastiche. Classificazione eziologica. - autoimmunitarie -metaboliche - tossico-medicamentose - aspecifiche LINFOADENOMEGALIE Classificazione eziologica Reattive -infettive Neoplastiche - autoimmunitarie -metaboliche - tossico-medicamentose - aspecifiche LINFOADENOMEGALIE inquadramento eziologico Infettive Cause

Dettagli

QUESITI E RACCOMANDAZIONI

QUESITI E RACCOMANDAZIONI Linfoadenopatia della testa e del collo in età pediatrica: le nuove linee guida italiane. Elena Chiappini Azienda Ospedaliero-Universitaria Anna Meyer, Dipartimento di Scienze della Salute, Università

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA

Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA SEZIONE LOMBARDA Aggiornamenti 2011 Corso di aggiornamento per Tecnici di Laboratorio Gallarate 11 giugno 2011 ASSOCIAZIONE ITALIANA TECNICI di ISTOLOGIA e CITOLOGIA Azienda Ospedaliera S. Antonio Abate

Dettagli

Il Nodulo Tiroideo dalla diagnosi alla Terapia

Il Nodulo Tiroideo dalla diagnosi alla Terapia Il Nodulo Tiroideo dalla diagnosi alla Terapia Genova Voltri 15 Dicembre 2012 Luca Anselmi Anatomia Patologica Sestri Ponente Percorso Diagnostico Terapeutico Multidisciplinare ENDOCRINOLOGO RADIOLOGO

Dettagli

Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32

Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32 2 Workshop SIES di Ematologia traslazionale Verona, 21-22 Maggio 2009 Caratterizzazione dei geni coinvolti nelle nuove traslocazioni riguardanti la banda 14q32 Identificazione di una correlazione tra l'espressione

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV ADULTS AND CHILDREN ESTIMATED TO BE LIVING WITH HIV/AIDS,

Dettagli

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO Documento redatto da: Dott.ssa T.Venesio, Dr.ssa A. Balsamo - Laboratorio di Patologia

Dettagli

Citologia polmonare: quale aiuto per il clinico?? Ariana Rezzonico Locarno 22 novembre 2011

Citologia polmonare: quale aiuto per il clinico?? Ariana Rezzonico Locarno 22 novembre 2011 Citologia polmonare: quale aiuto per il clinico?? Ariana Rezzonico Locarno 22 novembre 2011 1 Citologia polmonare Citologia spontanea Espettorato Spontanea Espettorato Indotta Aspirato bronchiale Spazzolato

Dettagli

Unità Operativa Complessa ANATOMIA PATOLOGICA

Unità Operativa Complessa ANATOMIA PATOLOGICA Unità Operativa Complessa ANATOMIA PATOLOGICA sanitaria Descrizione L obiettivo fondamentale è fornire diagnosi corrette, complete, tempestive e clinicamente rilevanti. Gli esami istologici e citologici

Dettagli

La sicurezza: un presupposto imprescindibile

La sicurezza: un presupposto imprescindibile La sicurezza: un presupposto imprescindibile Dr. A.O. San Giovanni Addolorata Roma, 7 dicembre 2012 Premessa L insufficiente reperimento di donatori, il rapporto rischi/benefici attesi con il trapianto

Dettagli

CARCINOMA DELLA MAMMELLA

CARCINOMA DELLA MAMMELLA CARCINOMA DELLA MAMMELLA TRATTAMENTO LOCO REGIONALE e ADIUVANTE NEOPLASIE INTRAEPITELIALI DELLA MAMMELLA Neoplasia Lobulare Intraepiteliale (LIN 2-3) Nessun trattamento (dopo la diagnosi) Resezione mammaria

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI Alcune malattie infettive ad eziologia virale e andamento benigno nei soggetti immunocompetenti, se sono contratte durante la gravidanza, possono rappresentare

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Le zone grigie della citologia tiroidea.

Le zone grigie della citologia tiroidea. Carcinoma differenziato della tiroide: dalla diagnosi al follow-up Bologna 21 marzo 2009 Le zone grigie della citologia tiroidea. Cosa deve dire il patologo Gian Piero Casadei Anatomia Patologica Ospedale

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Neoplasie mesenchimali

Neoplasie mesenchimali Neoplasie mesenchimali Nicoletta Ravarino S.C. di ANATOMIA PATOLOGICA Direttore B.Torchio A.O ORDINE MAURIZIANO TORINO TUMORI MESENCHIMALI Derivazione dal mesenchima del corpo: stroma endometriale, muscolatura

Dettagli

UNA STRANA MASSA ADDOMINALE

UNA STRANA MASSA ADDOMINALE UNA STRANA MASSA ADDOMINALE Uomo di 50 anni Altezza 1,70m Peso 88 kg Professione impiegato Coniugato Due figli Anamnesi patologica remota 1997 Ernioplastica ombelicale Obesita Ipertensione arteriosa bolderline

Dettagli

Neoplasie della mammella - 1

Neoplasie della mammella - 1 Neoplasie della mammella - 1 Patologia mammaria FIBROADENOMA CISTI ASCESSO ALTERAZIONI FIBROCISTICHE NEOPLASIA NEOPLASIA RETRAZIONE CUTANEA Carcinoma mammario Incidenza per 100.000 donne Western Europe

Dettagli

La gestione di un caso di morbillo

La gestione di un caso di morbillo La gestione di un caso di morbillo Eziologia del morbillo L agente causale è un paramyxovirus (virus ad RNA) Il virus è rapidamente inattivato dal calore e dalla luce L uomo è l unico ospite Patogenesi

Dettagli

Malattie ematologiche maligne

Malattie ematologiche maligne Malattie ematologiche maligne Sono tutte condizioni di crescita cellulare incontrollata di cellule emopoietiche. Malattie quindi di notevole gravità. CELLULA MIELOIDE CELLULA LINFOIDE Malattie mieloproliferative

Dettagli

Strumenti e Tecniche di studio in patologia

Strumenti e Tecniche di studio in patologia Strumenti e Tecniche di studio in patologia Gli strumenti della patologia: Microscopia Biologia molecolare Indagini biochimiche Microscopia Ottica citopatologia ed istopatologia citochimica ed istochimica

Dettagli

HPV metodiche molecolari e considerazioni su una casistica omogenea

HPV metodiche molecolari e considerazioni su una casistica omogenea XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012 HPV metodiche molecolari e considerazioni su una casistica omogenea Dott. Filippo Micheli HPV I Papillomavirus sono

Dettagli

LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE.

LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE. LA FISSAZIONE E LA PROCESSAZIONE DEI CAMPIONI ISTOLOGICI CON SOSTANZE A BASE ALCOLICA: POSSIBILI VANTAGGI E PROSPETTIVE FUTURE. Dott.ssa Marchi Barbara Biologa sanitaria COMBINAZIONE TRA LA BIOLOGIA MOLECOLARE

Dettagli

Domande relative alla specializzazione in: Oncologia medica

Domande relative alla specializzazione in: Oncologia medica Domande relative alla specializzazione in: Oncologia medica Domanda #1 (codice domanda: n.541) : Cosa caratterizza il grado T2 del colangiocarcinoma? A: Interessamento del connettivo periduttale B: Coinvolgimento

Dettagli

XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012. Citoassistenza e Gestione del materiale biologico on site:

XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012. Citoassistenza e Gestione del materiale biologico on site: XIX Corso Nazionale per Tecnici di Laboratorio Biomedico Riccione, 22-25 maggio 2012 Citoassistenza e Gestione del materiale biologico on site: CASI CLINICI Dr.ssa Paola Baccarini, U.O. Anatomia Patologica

Dettagli

Area Funzionale Omogenea Anatomia ed Istologia Patologica. 1.0 Carta dei servizi per il cittadino utente

Area Funzionale Omogenea Anatomia ed Istologia Patologica. 1.0 Carta dei servizi per il cittadino utente Area Funzionale Omogenea 1.0 Carta dei servizi per il cittadino utente Pag. 2 di 9 INDICE 1.1 Generalità 3 1.2 Missione 3 1.3 Il team 3 1.3.1. Come trovarci 4 1.3.2. Orario del servizio 4 1.4 Prodotti

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE

LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE LA DIAGNOSTICA MOLECOLARE E I TUMORI DEL SANGUE UNA NUOVA FRONTIERA NELLA DIAGNOSI DI ALCUNI TUMORI La diagnostica molecolare ha l obiettivo di accertare un ampia varietà di patologie (infettive, oncologiche

Dettagli

Polipi. Sessili. Peduncolati

Polipi. Sessili. Peduncolati Polipi Sessili Peduncolati Polipi Intestinali Polipi iperplastici 25% Polipi amartomatosi

Dettagli

ginecomastia aumento di volume della mammella maschile, mono o bilateralmente

ginecomastia aumento di volume della mammella maschile, mono o bilateralmente ginecomastia aumento di volume della mammella maschile, mono o bilateralmente diagnosi differenziale: carcinoma della mammella sono elementi di sospetto: monolateralità, rapido sviluppo Primitiva: puberale,

Dettagli

Carta dei Servizi U.O.C. Laboratorio di Virologia Molecolare

Carta dei Servizi U.O.C. Laboratorio di Virologia Molecolare Carta dei Servizi U.O.C. Laboratorio di Virologia Molecolare Mission Il Policlinico Tor Vergata ha iniziato, dal 10 gennaio 2001, a costruire insieme con tutti i suoi professionisti l ospedale umano aperto

Dettagli

CATALOGO PRESTAZIONI PER I CLIENTI UTENTI ESTERNI

CATALOGO PRESTAZIONI PER I CLIENTI UTENTI ESTERNI U. O. ANATOMIA PATOLOGICA - LEGNANO Direttore Dott.ssa Agnese Assi Telefono segreteria: 0331/449358-449266 Fax:0331/449266 e-mail: anatomopatologialegnano@ao-legnano.it Indirizzo: Via Candiani,2-20025

Dettagli

ALLEGATO 2 DESCRIZIONE SCIENTIFICA DEL PROGETTO E OBIETTIVI

ALLEGATO 2 DESCRIZIONE SCIENTIFICA DEL PROGETTO E OBIETTIVI BANDO DI CONCORSO CELESTINA LOSA per l assegnazione di 3 BORSE DI RICERCA sul tema: «Nuove opzioni terapeutiche per i pazienti con medulloblastoma: l immunoterapia adottiva diretta verso l antigene tumorale

Dettagli

Problematiche chirurgiche nel paziente affetto da linfoadenopatia Prof. Roberto Caronna roberto.caronna@uniroma1.it. La prassi più comune:

Problematiche chirurgiche nel paziente affetto da linfoadenopatia Prof. Roberto Caronna roberto.caronna@uniroma1.it. La prassi più comune: Problematiche chirurgiche nel paziente affetto da linfoadenopatia Prof. Roberto Caronna roberto.caronna@uniroma1.it Sapienza Università di Roma Cattedra di Chirurgia Generale N Direttore: Prof. P. Chirletti

Dettagli

L approccio vaccinale al cancro*

L approccio vaccinale al cancro* L approccio vaccinale al cancro* La vaccinazione è una tecnica mirata a stimolare una reazione immunologica dell organismo verso l'antigene o gli antigeni contenuti nel vaccino somministrato. Oggi i vaccini

Dettagli

Funzione della struttura di riferimento regionale per la gestione delle infezioni in gravidanza

Funzione della struttura di riferimento regionale per la gestione delle infezioni in gravidanza CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE Funzione della struttura di riferimento regionale per la gestione delle infezioni in gravidanza Dott.ssa Nadia Gussetti U.O. Malattie

Dettagli

Mononucleosi infettiva

Mononucleosi infettiva Mononucleosi infettiva Dr. Gianluca Russo, Mingha Africa Onlus La mononucleosi infettiva è una malattia acuta ad andamento quasi sempre spontaneamente benigno che interessa il sistema reticolo-istiocitario,

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

Prevenzione delle infezioni opportunistiche

Prevenzione delle infezioni opportunistiche Prevenzione delle infezioni opportunistiche Andamento viremico e risposta immunitaria 10 6 cellule CD4 1000 HIV RNA Copie/ml HIV-RNA plasmatico 800 600 400 200 CD4 Cellule/mm 3 10 2 mesi anni 0 >9/99 3/99-9/99

Dettagli

Laura Catena Istituto di Oncologia Policlinico di Monza

Laura Catena Istituto di Oncologia Policlinico di Monza Oncologia epato-bilio-pancreatica Metastasi da tumore a sede primitiva ignota Monza, 06 Maggio 2011 Laura Catena Istituto di Oncologia Policlinico di Monza Epidemiologia Rappresentano meno del 5% di tutte

Dettagli

Il Nodulo Tiroideo. "Diagnostica Citologica"

Il Nodulo Tiroideo. Diagnostica Citologica Il Nodulo Tiroideo "Diagnostica Citologica" FNAC Con il termine di FNAC (Fine Needle Aspiration Cytology) si intende un prelievo citologico eseguito mediante un ago definito sottile (a partire da 22G ),

Dettagli

La diagnosi istopatologica delle lesioni melanocitarie II edizione

La diagnosi istopatologica delle lesioni melanocitarie II edizione [ Corso Teorico-Pratico] La diagnosi istopatologica delle lesioni melanocitarie II edizione Genova, 14-16 novembre 2012 Con il patrocinio Società Italiana di Anatomia Patologica e Citopatologia Diagnostica

Dettagli

SPECIFICHE TECNICHE. LOTTO 1 Applicazioni di biologia molecolare per la diagnostica della Sepsi.

SPECIFICHE TECNICHE. LOTTO 1 Applicazioni di biologia molecolare per la diagnostica della Sepsi. 1 ALLEGATO A) SPECIFICHE TECNICHE LOTTO 1 Applicazioni di biologia molecolare per la diagnostica della Sepsi. Il sistema deve essere costituito da idonea strumentazione nuova di fabbrica, gruppo di continuità

Dettagli

La diagnostica del carcinoma prostatico Girolamo Morelli

La diagnostica del carcinoma prostatico Girolamo Morelli La diagnostica del carcinoma prostatico Girolamo Morelli Ricercatore presso l Università di Pisa U.O. di Urologia Universitaria Generalità Neoplasia non cutanea più frequente nel maschio Malattia a lenta

Dettagli

Identificazione e studio delle Cellule Staminali Tumorali del carcinoma della mammella e dell adenocarcinoma del colon

Identificazione e studio delle Cellule Staminali Tumorali del carcinoma della mammella e dell adenocarcinoma del colon Identificazione e studio delle Cellule Staminali Tumorali del carcinoma della mammella e dell adenocarcinoma del colon Carmelo Lupo Coordinatore Tecnico U.O. Anatomia Patologica e Patologia Molecolare

Dettagli

HPV-test: quale test e quando

HPV-test: quale test e quando Lugano 10 Settembre 2015 PAP-test, HPV e vaccino: cosa sta cambiando HPV-test: quale test e quando Francesca Molinari Istituto Cantonale di Patologia, Locarno Temi della presentazione Introduzione: virus

Dettagli

AZIENDA OSPEDALIERA S CARLO POTENZA Dirigente - ANATOMIA PATOLOGICA E CITODIAGNOSTICA

AZIENDA OSPEDALIERA S CARLO POTENZA Dirigente - ANATOMIA PATOLOGICA E CITODIAGNOSTICA INFORMAZIONI PERSONALI Nome BENVENUTO ALESSANDRA Data di nascita 31/08/1972 Qualifica Amministrazione Incarico attuale Numero telefonico dell ufficio I Fascia AZIENDA OSPEDALIERA S CARLO POTENZA Dirigente

Dettagli

Splenomegalia cronica associata a pancitopenia in paziente con infezione da HIV-1. Prof. Ivano Mezzaroma

Splenomegalia cronica associata a pancitopenia in paziente con infezione da HIV-1. Prof. Ivano Mezzaroma Splenomegalia cronica associata a pancitopenia in paziente con infezione da HIV-1 Prof. Ivano Mezzaroma SPLENOMEGALIE e CITOPENIE Classificazione etiologica A) Flogistica Infezioni (setticemie, brucellosi,

Dettagli

Conferenza di Consenso sul Test HIV: Quesiti e risposte

Conferenza di Consenso sul Test HIV: Quesiti e risposte Conferenza di Consenso sul Test HIV: Quesiti e risposte 1) Le popolazioni target per l offerta attiva del test 1a) In Italia è indicato uno screening generalizzato dell infezione da HIV? Se sì, con quale

Dettagli

PROGRAMMA REGIONALE DI SCREENING MAMMOGRAFICO PREVENZIONE SERENA Workshop 2013. Torino 7 novembre 2013. Anatomia Patologica. Isabella Castellano

PROGRAMMA REGIONALE DI SCREENING MAMMOGRAFICO PREVENZIONE SERENA Workshop 2013. Torino 7 novembre 2013. Anatomia Patologica. Isabella Castellano PROGRAMMA REGIONALE DI SCREENING MAMMOGRAFICO PREVENZIONE SERENA Workshop 2013 Torino 7 novembre 2013 Anatomia Patologica Isabella Castellano Dipartimento di Scienze Mediche Università di Torino Anatomia

Dettagli

CARCINOSARCOMA DELLA COLECISTI ALFAFETOPROTEINA SECERNENTE: PRESENTAZIONE DI UN CASO

CARCINOSARCOMA DELLA COLECISTI ALFAFETOPROTEINA SECERNENTE: PRESENTAZIONE DI UN CASO NUOVO OSPEDALE DI SANTORSO Unità Operativa Complessa di Chirurgia Direttore: Dott. Matteo Rebonato CARCINOSARCOMA DELLA COLECISTI ALFAFETOPROTEINA SECERNENTE: PRESENTAZIONE DI UN CASO Dott.ssa M. Fontana,

Dettagli

Scheda di presentazione del progetto. Titolo del progefto Applicazioni dell'elettroforesi capillare in oncologia.

Scheda di presentazione del progetto. Titolo del progefto Applicazioni dell'elettroforesi capillare in oncologia. Scheda di presentazione del progetto Titolo del progefto Applicazioni dell'elettroforesi capillare in oncologia. Obietfivi del progetto Lo scopo di qr"resto progetto e quello di sviluppare e mettere a

Dettagli

Linfoma follicolare le basi su cui si fonda una terapia di successo per il linfoma follicolare Che cosa é il linfoma follicolare?

Linfoma follicolare le basi su cui si fonda una terapia di successo per il linfoma follicolare Che cosa é il linfoma follicolare? Linfoma follicolare La terapia del linfoma non-hodgkin follicolare è oggi molto più efficace che in passato grazie alle nuove modalità di terapia quali gli anticorpi monoclonali (Rituximab, Zevalin) e

Dettagli

HERPESVIRUS UMANI HERPESVIRUS UMANI PROPRIETA DEI VIRUS ERPETICI. scaricato da www.sunhope.it SCOPERTA DEGLI HERPESVIRUS.

HERPESVIRUS UMANI HERPESVIRUS UMANI PROPRIETA DEI VIRUS ERPETICI. scaricato da www.sunhope.it SCOPERTA DEGLI HERPESVIRUS. SCOPERTA DEGLI HERPESVIRUS PROPRIETA DEI VIRUS ERPETICI Dimensioni del virione 180-200nm Genoma 90-145x10 6 basi DNA lineare, a doppia elica VZV HHV7 Struttura icosaedrica provvista di envelope glipoproteico

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

Identificazione di profili di rischio nella popolazione per lo sviluppo di interventi di prevenzione

Identificazione di profili di rischio nella popolazione per lo sviluppo di interventi di prevenzione Istituto Superiore di Sanità Roma Identificazione di profili di rischio nella popolazione per lo sviluppo di interventi di prevenzione Lo scopo principale del progetto è di coordinare gli studi epidemiologici

Dettagli

VEQ in Biologia Molecolare ciclo 2013. HBV DNA HIV RNA HCV RNA Genotipo HCV

VEQ in Biologia Molecolare ciclo 2013. HBV DNA HIV RNA HCV RNA Genotipo HCV VEQ in Biologia Molecolare ciclo 2013 HBV DNA HIV RNA HCV RNA Genotipo HCV Firenze 21 ottobre 2014 Maria Grazia Colao VEQ 2013 2 7 54 4 1 1 2 17 5 3 2 4 1 2 4 3 112 partecipanti Metodi utilizzati Gruppi

Dettagli

CASO CLINICO carcinoma mammario ErbB2+ con M+ SNC

CASO CLINICO carcinoma mammario ErbB2+ con M+ SNC CASO CLINICO carcinoma mammario ErbB2+ con M+ SNC METASTASI CEREBRALI DA CA MAMMELLA 10-30% delle pazienti con tumore mammario in fase avanzata Insorgono tardivamente nella storia naturale della malattia

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica SEZIONE DI CITOGENETICA E GENETICA MOLECOLARE DIAGNOSI PRENATALE DIAGNOSI MOLECOLARE PRE E POSTNATALE DI MALATTIE GENETICHE DIAGNOSTICA GENETICA DELLA INFERTILITA

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo BIOLOGIA MOLECOLARE

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

CASO CLINICO. Resezione chirurgica e esame istologico: glioblastoma multiforme

CASO CLINICO. Resezione chirurgica e esame istologico: glioblastoma multiforme CASO CLINICO Bambina di 8 anni Manifestazione acuta: linguaggio incomprensibile e sguardo fisso per 10 minuti collasso di 30 secondi con attacco epilettico generalizzato tonico-clonico vomito e stato di

Dettagli

Normale controllo della crescita cellulare

Normale controllo della crescita cellulare Normale controllo della crescita cellulare STOP STOP Cellula normale STOP Alterato controllo della crescita cellulare X STOP STOP Cellula tumorale STOP X Le cellule tumorali presentano alterazioni cromosomiche

Dettagli

PRELIEVO DI LIQUIDO AMNIOTICO

PRELIEVO DI LIQUIDO AMNIOTICO PRELIEVO DI LIQUIDO AMNIOTICO ANALISI DEL DNA PRELIEVO DI VILLI CORIALI Ivilli coriali e tutte le strutture placentari sono di origine embrionale: di conseguenza la dotazione cromosomica dei singoli elementi

Dettagli