GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it"

Transcript

1 GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR

2 CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente e sicura AMBIENTE NELLE MALATTIE COMPLESSE IL RISCHIO DI MALATTIA INFLUENZATO DA FATTORI GENETICI E DA FATTORI AMBIENTALI Si sono identificati centinaia di loci associati alla variabilità di molti caratteri (linkage, associazione - GWAS) È

3 Come studiare il fattore genetico nelle malattie complesse? Modalità? ANALISI DI LINKAGE (studio attraverso la segregazione di marcatori del DNA) ANALISI DI ASSOCIAZIONE (guilty by association) Nostro interesse per oggi

4 Studio di associazione in breve Individuo con genotipo nero Individuo con genotipo rosso Controlli Casi è maggiormente frequente nei casi rispetto a ASSOCIAZIONE NOTA: Con lo studio di associazione si possono studiare caratteri sia qualitativi (affetto/non affetto : frequenza del genotipo tra i 2 gruppi?) che quantitativi (medie del valore dei livelli di un dato parametro per i diversi genotipi)

5 GWAS - caratteristiche Vantaggi Nessuna ipotesi/conoscenza a priori del problema biologico Richieste Dimensione del campione molto grande (>>1000) Alta risoluzione (milioni di mkrs) Replica dei risultati in un campione indipendente Problematiche Grande quantità di dati (individui, fenotipi, marcatori DNA) Controllo di qualità (campioni, popolazioni, marcatori) Possibile stratificazione del campione (controlli adatti) Statistica da utilizzare (modello genetico, singolo locus) Test multipli (>> test eseguiti)

6 ESEMPIO DI GWAS: Bone-mineral-density loci Nature Genetics 41, (2009)

7 GWA & Variabilità tra popolazioni CEU CHB JPT YRI EJHG 2008, 16:

8

9

10

11 SI SINTETIZZA IL GRANDE NUMERO DI CARATTERI STUDIATI RIASSUMENDOLI IN CATEGORIE

12 SI SINTETIZZA IL GRANDE NUMERO DI CARATTERI STUDIATI RIASSUMENDOLI IN CATEGORIE

13 LD & GWAS & PREDIZIONE

14 SNPs associati a più Caratteri (Complessità)

15 GWAS BMD misurata in 2 aree Nature Genetics 41, (2009)

16 GWAS LOCI nuovi e già noti Nature Genetics 41, (2009)

17 GWAS LOCI nuovi e già noti Nature Genetics 41, (2009)

18 Meta-Analisi per i loci identificati Nature Genetics 41, (2009)

19 BMD e numero di alleli di rischio La distribuzione del numero di alleli di rischio portati da un individuo si avvicina alla curva a campana Il valore di BMD (espresso in Z-score), in media, si riduce all'aumentare del numero di alleli di rischio!! (ricorda il modello a soglia)

20

21

22 PATHWAYS Potenziali target Representation of the connections between SNPs and corresponding genes for the 42 SNPs with GRAIL (p < 0.01). Thicker and redder lines imply stronger literature-based connectivity. doi: /nature09410

23 L'eredità mancante dei GWAS

24 L'EREDITABILITÀ MANCANTE I loci individuati dai GWAS spiegano in genere una ridotta quantità della variabilità legata alla componente genetica (ereditabilità; < ~20%) La parte mancante viene scherzosamente definita la MATERIA OSCURA dei GWAS perchè si è sicuri che esista, si vede il suo effetto, ma NON si riesce a vederla. Nota: L'ereditabilità dei caratteri quantitativi (h^2: prop di varianza attribuibile ai fattori genetici addittivi) è tipicamente stimata dagli studi familiari e quindi il suo valore potrebbe variare nei diversi ambienti

25 LIPIDI: geni con varianti comuni e con varianti rare Il rischio determinato tramite gli SNP potrebbe sottostimare il rischio associato alle vere varianti causali Es: 11 dei 30 geni attualmente associati a variazioni dei livelli di lipidi possono anche presentare degli alleli rari che sono associati a forme Mendeliane di dislipidemia (ABCA1, PCSKA9, LDLR): geni con varianti comuni associate ad effetti lievi possono anche portare varianti rare associate a forti effetti

26 Geni & Alzheimer disease 178 mutazioni diverse in 393 famiglie [associato a demenza frontotemporale]

27 Diverse malattie diversi modelli L'architettura allelica (numero, tipo, effetto, frequenza) potrebbe essere diversa nei diversi fenotipi: Age-related macular degeneration: numero ridotto di varianti comuni con un forte effetto (OR > 2) Crohn's disease: numero abbondante di varianti comuni con un lieve effetto (OR << 2; e molto rimane ancora da identificare) Il numero delle varianti comuni identificate aumenta con l'aumentare delle dimensioni del campione analizzato.

28 Fondatori di Fondatori di Google: 23andMe: Larry Page Linda Avey Sergey Brin Anne Wojcicki

29 Privacy: trovata una scappatoia nei database genetici L'identità di alcuni donatori di DNA potrebbe essere svelata tramite le informazioni presenti nei database pubblici Un gruppo di ricerca è stato in grado di scoprire l'identità di alcuni donatori del genoma incrociando i dati dei loro marcatori genetici (DNA) con informazioni demografiche in banche dati pubbliche: 1. Un programma chiamato lobstr estrae informazioni sugli aplotipi ricostruiti tramite marcatori genetici del cromosoma Y (il sistema funziona quindi con i soli maschi) 2. Gli aplotipi sono inseriti in banche di dati genealogici per trovare i possibili cognomi del donatore. 3. Questi cognomi, insieme alle informazioni circa l'età e la posizione di un donatore del DNA, possono essere inseriti in banche dati demografici per individuare identità dell'individuo.

30 OMICHE GENOMICA TRASCRITTOMICA EPIGENETICA WHOLE GENOME De novo sequencing RNA-Seq WHOLE GENOME Bisulfite sequencing WHOLE GENOME Re- sequencing small RNA MeDIP - Sequencing ESOMA (~50MB) Genotyping ChIP - Sequencing

31 HUMAN GENOME

32 HUMAN GENOME 3.1 GBp Geni codificanti Geni non codificanti Pseudogeni Trascritti 50M di varianti corte 10M di varianti strutturali

33 Exome sequencing makes medical genomics a reality Nature Genetics 42, (2010) doi: /ng

34

35 Sequenziamento (Next Generation Seq)

36 ALLA RICERCA DELLA VARIANTE DAMAGING Seleziono i migliori candidati Se sono già descritti come polimorfismi comuni allora NON mi interessano ANALISI BIOINFORMATICA Conservazioni in specie omologhe, alterazioni della struttura 3D, interazioni con il sito di legame, etc...

37

38

39 FILTRARE LE VARIANTI PER INDIVIDUARE LE MIGLIORI CANDIDATE

40 VARIANTI RARE CANDIDATE

41 GENOMA UMANO: regioni conservate 3-8% del genoma umano è dato da sequenze conservate che si trovano nei vertebrati e/o altri mammiferi euteri D. melanogaster : 37-53% C. elegans : 18-37% S. cerevisiae : 47-68% gr

42

43

44

45 MetaHIT project A human gut microbial gene catalogue established by metagenomic sequencing TotalDNA from faecal samples of 124 European adults Gb of sequence Predicte 3.3 million unique open reading frames (ORFs) 46 Mar 2010

46

47

48 CARATTERISCHE DEI LGC E DEI HGC 2 gruppi di individui che differisco per il numero di geni microbici (ricchezza di batteri intestinali) Gli indivui con una bassa ricchezza batterica (23% degli individui studiati) sono caratterizzati da una più marcata adiposità generale, insulina resistenza e dislipidemia, da un più pronunciato fenotipo infiammatorio. Gli individui obesi guadagnano più peso nel tempo si presentano una bassa ricchezza batterica I 2 gruppi possono essere distinti utilizzando un piccolo sottogruppo di batteri (anche per magri ed obesi)

49 1999, BGI-Beijing 2001, BGI-Hangzhou 2007, BGI-Shenzhen 2009, BGI-HongKong 2010, BGI-Wuhan 2010, BGI-San Francisco 2010, BGI-Copenhagen 2

50 BGI wet lab Facilities: 137 Illumina Hi-Seq Life Tech SOLiD 4 16 AB/3730xl 2 Illumina iscan (2010) Data production: ~5 Tb / day (end of 2010) About 50 human genome (30X) per day 51

51 BGI dry lab (~2010) # CPUS Flops RAM Storage ,500 18T 4TB 2PB ,000 50T 10TB 5PB , T 20TB 10PB ,000 1,000T 200TB 1,000PB 52

52 LA NOSTRA STANZA CON IL NOSTRO SERVER (2013)

53 LA RIVOLUZIONE GENOMICA secondo Craig Venter: Il primo genoma rappresenta la linea di partenza Almeno genomi + fenotipi per poter parlare di medicina preventiva Dr. Craig Venter

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

LA SELEZIONE GENOMICA NELLE RAZZE DA CARNE: WORK IN PROGRESS

LA SELEZIONE GENOMICA NELLE RAZZE DA CARNE: WORK IN PROGRESS Associazione Italiana Allevatori LA SELEZIONE GENOMICA IMMAGINE NELLE RAZZE DA CARNE: WORK IN PROGRESS RICCARDO NEGRINI riccardo.negrini@unicatt.it negrini.r@aia.it Trend del mercato della carne nei Paesi

Dettagli

Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini. Genova, 3/02/2015 Teatro della Gioventù

Renata Bocciardi DINOGMI - Università degli Studi di Genova U.O.C. Genetica Medica - Istituto G. Gaslini. Genova, 3/02/2015 Teatro della Gioventù 1. Do you think genome sequencing will impact on your future life? Give examples of what you would want and what you would not want to happen because of genome sequencing. or 2. How can you explain human

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema

Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed. Fare clic per modificare lo stile del sottotitolo dello schema Realizzazione dell Unità di Bioinformatica dell IRCCS Neuromed Fare clic per modificare lo stile del sottotitolo dello schema La Fondazione Neuromed è un organizzazione relativamente giovane, nata nel

Dettagli

CELIACHIA E TEST HLA RACCOMANDAZIONI

CELIACHIA E TEST HLA RACCOMANDAZIONI CELIACHIA E TEST HLA RACCOMANDAZIONI a cura di Maria Cristina Mazzilli 1 Antonio Calabrò 2 Carlo Catassi 2 Luigi Greco 2 Riccardo Troncone 2 Umberto Volta 2 Valerio Misefari 3 Antonio Amoroso 4 Ettore

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA INDICE pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA 1.1. Il concetto d identificazione... 9 1.2. L identificazione nella storia....

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

IL CONTROLLO GENETICO DELLA PARENTELA NEL CANE CON ANALISI DEL DNA Michele Polli, Loredana Holzer, Stefano Marelli, Luigi Guidobono Cavalchini

IL CONTROLLO GENETICO DELLA PARENTELA NEL CANE CON ANALISI DEL DNA Michele Polli, Loredana Holzer, Stefano Marelli, Luigi Guidobono Cavalchini IL CONTROLLO GENETICO DELLA PARENTELA NEL CANE CON ANALISI DEL DNA Michele Polli, Loredana Holzer, Stefano Marelli, Luigi Guidobono Cavalchini Università degli Studi di Milano - Istituto di Zootecnica

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

Biobanca Genetica per Malattie Rare Scheletriche

Biobanca Genetica per Malattie Rare Scheletriche Biobanca Genetica per Malattie Rare Scheletriche Luca Sangiorgi S.S.D. di Genetica Medica e Malattie Rare Ortopediche, Istituto Ortopedico Rizzoli Bologna SSD di Genetica Medica IOR Roma, 25 settembre

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

MASTER DEGREE IN MOLECULAR AA 2015/16

MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

CAPITOLO 2 I TRATTI COMPLESSI

CAPITOLO 2 I TRATTI COMPLESSI CAPITOLO 2 I TRATTI COMPLESSI Tratti semplici e tratti complessi Come detto nel capitolo precedente, la genetica classica studia fondamentalmente i cosiddetti tratti mendeliani semplici, quelli in cui,

Dettagli

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

X-FILES in NUTRIZIONE. CLINICA ed ARTIFICIALE

X-FILES in NUTRIZIONE. CLINICA ed ARTIFICIALE Onconutrizione: La ricerca in chemioprevenzione Ulrich Pfeffer U.O.C. Patologia Molecolare ntegrata RCCS Azienda Ospedaliera Universitaria San Mar6no ST s6tuto Nazionale per la Ricerca sul Cancro La prevenzione

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' PERSONE SOTTOPOSTE AL TEST QUESITO Campione Biologico Tampone

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

MALATTIA CELIACA. Il test HLA per la celiachia. Le malattie genetiche si distinguono tra monogeniche e multifattoriali

MALATTIA CELIACA. Il test HLA per la celiachia. Le malattie genetiche si distinguono tra monogeniche e multifattoriali MALATTIA CELIACA La ricerca della malattia celiaca si esegue evidenziando nel sangue e quindi nel DNA gli alleli che codificano per le molecole DQ2 DQ8. La presenza di questi determina la possibilità che

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA

Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA Il donatore di emocomponenti e di cellule staminali emopoietiche: attualità e prospettive Compatibilità nel trapianto di CSE e sistema HLA Nicoletta Sacchi Italian Bone Marrow Donor Registry E.O. Ospedali

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' Campione Biologico PERSONE Prelievo Ematico Padre XXXXXXXX

Dettagli

Il microbiota della vite: un assicurazione sulla salute della pianta

Il microbiota della vite: un assicurazione sulla salute della pianta Il microbiota della vite: un assicurazione sulla salute della pianta 26 marzo 2015 Costigliole d Asti Museo del Vino Barolo Paola Bonfante Dibios paola.bonfante@unito.it Il microbiota dell intestino umano

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi

Dettagli

DATA inizio e fine BUDGET. Euro 2.454.414,00 01/07/2011 31/03/2015. COORDINATORE PROGETTO Roberta Davoli. CAPOFILA Università di Bologna, DIPROVAL

DATA inizio e fine BUDGET. Euro 2.454.414,00 01/07/2011 31/03/2015. COORDINATORE PROGETTO Roberta Davoli. CAPOFILA Università di Bologna, DIPROVAL SETTORE INTERVENTO: ZOOTECNIA (SUINO) TITOLO PROGETTO: Ricerca avanzata in genomica e innovazioni tecnologiche per la filiera produttiva del suino pesante italiano (HEPIGET) Advanced research in genomics

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

Come studiare un genoma complesso. 1. Costruirne la mappa

Come studiare un genoma complesso. 1. Costruirne la mappa Come studiare un genoma complesso 1. Costruirne la mappa Costruzione della mappa di un cromosoma Obiettivo: ordinare in modo reciproco lungo il cromosoma geni responsabili di fenotipi riconoscibili, o

Dettagli

La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel Genetica: scienza che studia la trasmissione dei caratteri ereditari (che si trasmettono di generazione in generazione) Carattere: caratteristica esterna, interna o comportamentale

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data

Dettagli

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI

LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI LA TECNOLOGIA SANGER SEQUENCING RICERCATORE TEAM LEADER: DOTT.SSA VELCA BOTTI 1953: scoperta del DNA (Watson e Crick) CENNI STORICI 1977: metodo di Sanger per il sequenziamento del DNA (pubblicazione della

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA

Dettagli

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin Elementi di genetica di base e marcatori molecolari Dott.ssa Marica Soattin Organismi animali costituiti da cellule di tipo eucariote Cellule con nucleo differenziato delimitato da membrana e organelli

Dettagli

Contributo. Tavoli tematici. 1. Dati proponente contributo VERSO LA STRATEGIA REGIONALE DELL INNOVAZIONE 2014-2020

Contributo. Tavoli tematici. 1. Dati proponente contributo VERSO LA STRATEGIA REGIONALE DELL INNOVAZIONE 2014-2020 VERSO LA STRATEGIA REGIONALE DELL INNOVAZIONE 2014-2020 Tavoli tematici Contributo 1 1. Dati proponente contributo Alfredo Ferro Ente/organizzazione di appartenenza Università di Catania Telefono 3666627657

Dettagli

LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI

LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI LEGA ITALIANA PER LA LOTTA CONTRO I TUMORI Il Consiglio Direttivo Nazionale LILT, nella seduta del 19 marzo 2015, ha formalmente approvato la documentazione relativa ai lavori della Commissione tecnico-scientifica

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le tre leggi di Mendel, che descrivono la trasmissione dei caratteri ereditari da una generazione all altra, segnano l inizio della

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento Docente: ROSSI STEFANIA Qualifica: RICERCATORE Insegnamento: STATISTICA SSD: MED/42 o Definire gli aspetti fondamentali per la stesura di progetto/protocollo di ricerca: razionale; plausibilità biologica

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Ad integrazione delle lezioni e del testo di studio Genetica Umana e Medica Neri- Genuardi 3a edizione 2014 Masson (www.mediquiz.it) GENETICA MEDICA

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

TEST GENETICI DI SUSCETTIBILITÀ E MEDICINA PERSONALIZZATA

TEST GENETICI DI SUSCETTIBILITÀ E MEDICINA PERSONALIZZATA TEST GENETICI DI SUSCETTIBILITÀ E MEDICINA PERSONALIZZATA ELABORATO DEL GRUPPO DI LAVORO MISTO, ESPRESSO DAL COMITATO NAZIONALE PER LA BIOETICA E DAL COMITATO NAZIONALE PER LA BIOSICUREZZA, LE BIOTECONOLOGIE

Dettagli

Genetica: Lo studio dell eredità

Genetica: Lo studio dell eredità Genetica: Lo studio dell eredità Perché la progenie assomiglia ai genitori? Perché alcuni individui in una popolazione differiscono? Gregor Johann Mendel Austrian Monk, born in what is now Czech Republic

Dettagli

L integrazione scolastica degli allievi con Distrofia Muscolare Duchenne o Becker

L integrazione scolastica degli allievi con Distrofia Muscolare Duchenne o Becker L integrazione scolastica degli allievi con Distrofia Muscolare Duchenne o Becker Raffaela Maggi USP - Ancona Falconara Marittima 16.12.08 Sotto il termine DISTROFIA MUSCOLARE si raccolgono un gruppo di

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

UNIVERSITA DEGLI STUDI DI SASSARI FACOLTA DI MEDICINA E CHIRURGIA DIPARTIMENTO DI SCIENZE BIOMEDICHE

UNIVERSITA DEGLI STUDI DI SASSARI FACOLTA DI MEDICINA E CHIRURGIA DIPARTIMENTO DI SCIENZE BIOMEDICHE UNIVERSITA DEGLI STUDI DI SASSARI FACOLTA DI MEDICINA E CHIRURGIA DIPARTIMENTO DI SCIENZE BIOMEDICHE DOTTORATO IN GENETICA MEDICA, MALATTIE METABOLICHE E NUTRIGENOMICA CICLO XXIV LA SCLEROSI MULTIPLA;

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli