Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Paola Bonizzoni. Università degli Studi di Milano-Bicocca"


1 Paola Bonizzoni Università degli Studi di Milano-Bicocca

2 Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2

3 In un organismo i processi biologici elaborano informazione L archivio delle informazioni è il genoma, costituito da un insieme di cromosomi Un cromosoma è una molecola di DNA, una doppia elica contenente un messaggio con alfabeto (A, C, G, T) 3

4 4

5 Il genoma è formato da milioni di basi anche in organismi semplici: Batterio (E. Coli) 1 Mbp Gbp = Mbp Lievito 14.4 Mbp Verme (C. elegans) Mbp Moscerino (Drosophila) Mbp Uomo (Homo sapiens) 3.3 Gbp Per memorizzare ed analizzare un intero genoma occorrono grandi risorse computazionali 5

6 Obiettivi Determinare la sequenza del DNA umano Identificare i circa geni Immagazzinare le informazioni in banche dati Sviluppare strumenti per l analisi delle sequenze Affrontare i problemi etici, legali e sociali collegati 6

7 Alcune copie del genoma sono spezzettate in frammenti corti ( bp) I frammenti vengono sequenziati Attraverso le sovrapposizioni di frammenti si cerca di ricostruire la sequenza: è come un puzzle da 50 milioni di pezzi 7


9 Il DNA governa la costruzione e il funzionamento dell organismo attraverso la produzione di proteine sono le principali responsabili della struttura e delle attività dell organismo costituite da venti diversi aminoacidi Lunghezza media: aminoacidi Ogni proteina è costruita a partire da un gene I geni costituiscono una piccola parte del genoma (10%) e devono essere individuati 9

10 DNA TRASCRIZIONE pre-mrna 5 exon 1 exon 2 exon 3 3 SPLICING mrna exon 1 exon 2 exon 3 prodotto dello splicing TRADUZIONE proteina 10

11 11

12 Estrarre un significato dai dati o sequenze Identificare i geni sulle sequenze di DNA Capire meccanismi di trascrizione del DNA Trovare segnali sconosciuti Capire l espressione genica Capire l evoluzione Capire le proteine Quali programmi esegue il DNA? 12

13 Usare la conoscenza Individuare l informazione sui geni che indica la presenza di una patologia (diagnosi) Riparazione o sostituzione dei geni Progettazione di farmaci con un reale impatto sulla malattia senza alterare il delicato equilibrio dell organismo 13

14 Calcolo mutazioni geniche tra genomi: S1 = ACCGGT S2 = ACGGA -GGA C cancellata, T sostituita con A Input: due sequenze S1, S2 (genomi) Output: minimo numero di mutazioni che trasformano S1 in S2 14

15 Calcolo distanza tra genomi: G1= 1, 2, 3, 4, 5, 6, 7, 8, 9 Geni = interi G2 =1, 2, 5, 4, 3, 6, 7, 9, 8 Mutazioni= operazioni (es. inversioni) Es. Inversione di 3,4,5 5,4,3 Input: due genomi G1 e G2 Output: minimo numero di inversioni che trasformano G1 in G2 15

16 La distanza evolutiva tra due specie è il minimo numero di mutazioni che sono necessarie per trasformare un genoma nell altro. 180 mutazioni 16

17 Input: un gene Esempio: progetto ASPIC Output: trascritti (proteine del gene) 17

18 ASPIC output 18

19 Processi biologici Processi di calcolo 19

20 Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Biologia Informatica Bio-inspired Computing: DNA computing Algoritmi genetici Ant computing Reti neurali... 20

21 Complessità computazionale Algoritmi non praticabili (output ottenuto dopo secoli ): problemi di ottimizzazione: numero elevato di soluzioni da controllare Esempi problemi di ottimizzazione: Riempire un container, o una nave Trovare il percorso più corto per un commesso viaggiatore Trovare la distribuzione migliore delle ambulanze in città Realizzare la rete del metano con meno tubi possibile 21

22 Modelli di calcolo ispirati da meccanismi biologici Reti neurali Algoritmi genetici Modelli di calcolo basati su tecniche biologiche DNA computing Modelli di calcolo basati sui principi quantistici Quantum computing 22

23 In 1959, Richard Feynmann gave a visionary describing the possibility of building computer that were sub-microscopic. Despite remarkable progress in computer miniaturization, this goal is far to be achieved. HERE THE POSSIBILITY OF COMPUTING DIRECTLY WITH MOLECULES IS EXPLORED... Science Richard Feynman immagina computer submicroscopici Computer quantistici Computer Molecolari 23

24 enzima di restrizione Tom Head definisce i sistemi di splicing, modelli formali dell azione degli enzimi di restrizione enzima di restrizione 2 ligasi 24

25 Cut: Enzimi di restrizione Paste: enzima ligase 25

26 Tom Head 1987 (Bull. of Math. Biology) Sistemi di calcolo basati sull operazione di splicing Input: insieme di molecole (stringhe) Programma: insieme di enzimi (regole di splicing) Output: un linguaggio o insieme di stringhe (risultato della computazione) Sistemi di SPLICING Modelli di calcolo equivalenti alle Macchine di Turing! 26

27 1994 Leonard Adleman risolve HPP con tecniche biologiche La matematica nelle cellule! comportamento del DNA come Macchina di Turing Soluzione di problemi NP Completi 27

28 ELABORAZIONE Istanza del problema CODIFICA LAB ESTRAZIONE Soluzione ma... 1 secondo per eseguire il calcolo secondi per ottenere il risultato 28

29 Parallelismo: operazioni in parallelo Velocità:10 20 op/sec (vs op/sec) Efficienza Energetica: 2*10 19 op/joule (vs 10 9 op/joule) Densità di informazione: 1 bit/nm 3 (vs 1 bit x nm 3 ) 29

30 Limiti computazionali Istanze grandi (500 nodi) restano intrattabili Complessità in peso DNA per risolvere HPP su 200 vertici = Più della massa della Terra <<... new computational complexity measure: the weight of the computation >> [Hartmanis, Bull. of EATCS 1996] 30

31 Potenza computazionale Equivalente alle macchine di Turing Modelli formali: Sistemi di accoppiamento (splicing) Sistemi a inserimento/cancellazione Sistemi a membrane Sistemi autoassemblanti... 31

32 Elementary membrane Regions Non elementary membrane Skin membrane 32

33 A A B A > CC(out) B > AAA (here) 2 B C A > BC(out) A C C > BD(here) 3 B A D > E (here) C A C A 5 B > CD (out) C > D (in 5) A > BB (in 6) A > BC (in 2) A > DDB (in 3) Objects Evolution Rules 33


35 Grazie! 35

Bioinformatica: DNA e Algoritmi

Bioinformatica: DNA e Algoritmi Bioinformatica: DNA e Algoritmi Alberto Policriti Dpt. of Mathematics and Informatics, University of Udine. Applied Genomics Institute Di cosa parleremo In generale Deniamo i termini: DNA & Algoritmi Tecnologie


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi


Cos è un Calcolatore?

Cos è un Calcolatore? Cos è un Calcolatore? Definizione A computer is a machine that manipulates data according to a (well-ordered) collection of instructions. 24/105 Riassumendo... Un problema è una qualsiasi situazione per


Computazione Naturale AA. 2011-2012

Computazione Naturale AA. 2011-2012 Computazione Naturale AA. 2011-2012 Prof. Mario Pavone CdL Magistrale in Informatica Dip. Matematica ed Informatica INDICE Obiettivi formativi Cos


Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli


Le parole dell informatica: modello di calcolo, complessità e trattabilità

Le parole dell informatica: modello di calcolo, complessità e trattabilità Le parole dell informatica: modello di calcolo, complessità e trattabilità Angelo Montanari Dipartimento di Matematica e Informatica Università degli Studi di Udine Ciclo di seminari su un Vocabolario


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


La macchina di Turing (Alan Turing, 1936)*

La macchina di Turing (Alan Turing, 1936)* DNA-computing La macchina di Turing (Alan Turing, 1936)* Un meccanismo (finite control) si muove tra una coppia di nastri:. legge le istruzioni da un nastro (input tape). scrive il risultato sull altro


Page 1. Evoluzione. Intelligenza Artificiale. Algoritmi Genetici. Evoluzione. Evoluzione: nomenclatura. Corrispondenze natura-calcolo

Page 1. Evoluzione. Intelligenza Artificiale. Algoritmi Genetici. Evoluzione. Evoluzione: nomenclatura. Corrispondenze natura-calcolo Evoluzione In ogni popolazione si verificano delle mutazioni. Intelligenza Artificiale In un ambiente che varia, le mutazioni possono generare individui che meglio si adattano alle nuove condizioni. Questi


Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Giuditta Franco Corso di Laurea in Bioinformatica - AA 2012/2013 Uno dei più grossi risultati nell informatica degli


Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva



TECNOLOGIE INFORMATICHE DELLA COMUNICAZIONE ORE SETTIMANALI 2 TIPO DI PROVA PER GIUDIZIO SOSPESO PROVA DI LABORATORIO CLASSE DISCIPLINA MODULO Conoscenze Abilità e competenze Argomento 1 Concetti di base Argomento 2 Sistema di elaborazione Significato dei termini informazione, elaborazione, comunicazione, interfaccia,


Un nuovo tassello per scoprire il lato oscuro del Genoma

Un nuovo tassello per scoprire il lato oscuro del Genoma Roma, 23 febbraio 2015 COMUNICATO STAMPA Un nuovo tassello per scoprire il lato oscuro del Genoma Un team del dipartimento di Biologia e Biotecnologie "Charles Darwin" della Sapienza, coordinato da Patrizio


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%



(ETC) MATRICOLE DISPARI Elementi di Teoria della Computazione (ETC) MATRICOLE DISPARI Docente: Prof. Luisa Gargano BENVENUTI! Finalità: Fornire gli elementi di base delle teorie che sono di fondamento all'informatica 1. Computabilità


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto


TO61: Applicazione di metodi della fisica teorica a sistemi biologici

TO61: Applicazione di metodi della fisica teorica a sistemi biologici TO61: Applicazione di metodi della fisica teorica a sistemi biologici Obiettivi: Offrire l opportunita ai vari gruppi che in questi ultimi anni, all interno dell INFN, hanno cominciato a lavorare al confine


Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza


La GRID nella Medicina

La GRID nella Medicina La GRID nella Medicina Paola Di Giacomo Principali sfide della medicina Aumento Aumento popolazione anziana Malattie Malattie croniche (neurologiche, ecc.) Malattie Malattie


Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale


Progetto e analisi di algoritmi

Progetto e analisi di algoritmi Progetto e analisi di algoritmi Roberto Cordone DTI - Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Tel. 0373 / 898089 E-mail: Ricevimento: su appuntamento


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Fasi di creazione di un programma

Fasi di creazione di un programma Fasi di creazione di un programma 1. Studio Preliminare 2. Analisi del Sistema 6. Manutenzione e Test 3. Progettazione 5. Implementazione 4. Sviluppo 41 Sviluppo di programmi Per la costruzione di un programma



SCUOLA SECONDARIA DI I GRADO Operare in situazioni reali e/o disciplinari con tecniche e procedure di calcolo L alunno si muove con sicurezza nel calcolo anche con i numeri razionali, ne padroneggia le diverse e stima la grandezza


Breve introduzione al Calcolo Evoluzionistico

Breve introduzione al Calcolo Evoluzionistico Breve introduzione al Calcolo Evoluzionistico Stefano Cagnoni Dipartimento di Ingegneria dell Informazione, Università di Parma 1 Introduzione Il mondo fisico ed i fenomeni naturali


Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l


Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici


SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno





La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute


Contatti 2. Testo. Contatti. Maria Chiara Laghi, Ph.D Dip. Ingegneria dell Informazione. tel. 0521 905712 e-mail

Contatti 2. Testo. Contatti. Maria Chiara Laghi, Ph.D Dip. Ingegneria dell Informazione. tel. 0521 905712 e-mail Contatti 2 Maria Chiara Laghi, Ph.D Dip. Ingegneria dell Informazione tel. 0521 905712 e-mail Pagina web del corso a.a. 2011/2012


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


Organi Cellule Molecole

Organi Cellule Molecole Organi Cellule Molecole Il presupposto tradizionale delle scienze bio-mediche consiste nel fatto che se si conoscono tutti gli elementi costitutivi fondamentali delle cellule (le molecole) si e' allora


Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche

Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche Verbale n. 3: Discussione dei titoli e delle pubblicazioni scientifiche Il giorno 24.10.2011 alle ore 11,00, presso la sede dell Università degli Studi Parthenope di Napoli, in Via Acton 38, si riunisce





Linguaggi di programmazione

Linguaggi di programmazione Linguaggi di programmazione Programmazione L attività con cui si predispone l elaboratore ad eseguire un particolare insieme di azioni su particolari dati, allo scopo di risolvere un problema Dati Input


Dott.ssa Lorella Gabriele PhD in Psicologia della Programmazione e Intelligenza Artificiale Dipartimento di Fisica Università della Calabria

Dott.ssa Lorella Gabriele PhD in Psicologia della Programmazione e Intelligenza Artificiale Dipartimento di Fisica Università della Calabria Dott.ssa Lorella Gabriele PhD in Psicologia della Programmazione e Intelligenza Artificiale Dipartimento di Fisica Università della Calabria La robotica è una scienza che si occupa di studiare e sviluppare



GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza


Sperimenta il BIOLAB

Sperimenta il BIOLAB Sperimenta il BIOLAB I numeri del BIOLAB Il Maserati porta annualmente al CusMiBio circa 200 alunni dalla 2^ alla 5^ Liceo Scientifico tecnologico per fare 2-3 laboratori di Genetica, Citologia e Biologia


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione





L interesse nella macchina di Turing

L interesse nella macchina di Turing Aniello Murano Macchina di Turing universale e problema della fermata 6 Lezione n. Parole chiave: Universal Turing machine Corso di Laurea: Informatica Codice: Email Docente: murano@ A.A. 2008-2009


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


ALGORITMI e PROGRAMMI Programmazione: Lavoro che si fa per costruire sequenze di istruzioni (operazioni) adatte a svolgere un dato calcolo

ALGORITMI e PROGRAMMI Programmazione: Lavoro che si fa per costruire sequenze di istruzioni (operazioni) adatte a svolgere un dato calcolo ALGORITMI e PROGRAMMI Programmazione: Lavoro che si fa per costruire sequenze di istruzioni (operazioni) adatte a svolgere un dato calcolo INPUT: dati iniziali INPUT: x,y,z AZIONI esempio: Somma x ed y


Materiale didattico. Laboratorio di Informatica a.a. 2007-08. I) Introduzione all Informatica. Definizione di Informatica. Definizione di Informatica

Materiale didattico. Laboratorio di Informatica a.a. 2007-08. I) Introduzione all Informatica. Definizione di Informatica. Definizione di Informatica Corso di Laurea Triennale in Storia, Scienze e Tecniche dell Industria Culturale sede di Brindisi Laboratorio di Informatica a.a. 2007-08 Materiale didattico Testo adottato D.P. Curtin, K. Foley, K. Suen,


Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization

Tesi di Laurea Specialistica. Elaborazione di dati bioinformatici attraverso l uso di Particle Swarm Optimization Università degli Studi di Genova Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica Anno Accademico 2009/2010 Tesi di Laurea Specialistica Elaborazione di dati



LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi


A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina


Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


Perché abbiamo deciso di sequenziare il genoma umano

Perché abbiamo deciso di sequenziare il genoma umano L'immagine sopra rappresenta le tappe fondamentali per la scoperta del genoma umano. Una versione più interattiva della mappa è disponibile nel sito del progetto genoma umano, nella sezione dedicata alla



MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi


Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche



CHE COS È L INFORMATICA CHE COS È L INFORMATICA Prof. Enrico Terrone A. S. 2011/12 Definizione L informatica è la scienza che studia il computer sotto tutti i suoi aspetti. In inglese si usa l espressione computer science, mentre


Storia dell informatica




Disciplina: SCIENZE MATEMATICHE UNITÀ DI APPRENDIMENTO 1 Disciplina: SCIENZE MATEMATICHE UNITÀ DI APPRENDIMENTO 1 OBIETTIVO FORMATIVO Comprendere come gli strumenti matematici siano necessari per operare nella realtà. L alunno si muove con sicurezza nel calcolo



MASTER DEGREE IN MOLECULAR AA 2015/16 MASTER DEGREE IN MOLECULAR AND MEDICAL BIOTECHNOLOGY AA 2015/16 Classe LM-9 - Biotecnologie mediche, veterinarie e farmaceutiche Come iscriversi Il Corso di Studio è ad accesso non programmato Accesso


Il test di Turing. Seminario. Ester Dalvit. 22 marzo 2005. Il test di Turing p. 1/1

Il test di Turing. Seminario. Ester Dalvit. 22 marzo 2005. Il test di Turing p. 1/1 Il test di Turing Seminario Ester Dalvit 22 marzo 2005 Il test di Turing p. 1/1 Intelligenza artificiale Una macchina compie in modo efficiente e veloce attività come eseguire calcoli aritmetici Il test


Elementi di Informatica e Programmazione

Elementi di Informatica e Programmazione Elementi di Informatica e Programmazione Il concetto di Algoritmo e di Calcolatore Corsi di Laurea in: Ingegneria Civile Ingegneria per l Ambiente e il Territorio Università degli Studi di Brescia Cos


Informatica 3. Informatica 3. LEZIONE 10: Introduzione agli algoritmi e alle strutture dati. Lezione 10 - Modulo 1. Importanza delle strutture dati

Informatica 3. Informatica 3. LEZIONE 10: Introduzione agli algoritmi e alle strutture dati. Lezione 10 - Modulo 1. Importanza delle strutture dati Informatica 3 Informatica 3 LEZIONE 10: Introduzione agli algoritmi e alle strutture dati Modulo 1: Perchè studiare algoritmi e strutture dati Modulo 2: Definizioni di base Lezione 10 - Modulo 1 Perchè





Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


Crescita e divisione cellulare

Crescita e divisione cellulare 08-04-14 CANCRO Crescita e divisione cellulare ogni cellula deve essere in grado di crescere e riprodursi una cellula che cresce e si divide genera due nuove cellule figlie gene4camente iden4che alla cellula


Origini e caratteristiche dei calcolatori elettronici

Origini e caratteristiche dei calcolatori elettronici Origini e caratteristiche dei calcolatori elettronici Lunedì, 09 ottobre 2006 Supercomputer, mainframe 1 Server, workstation, desktop, notebook, palmare Un po di storia 1642 Biagio Pascal 1671 Leibniz


Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune





Il software. Il software. Dott. Cazzaniga Paolo. Dip. di Scienze Umane e Sociali

Il software. Il software. Dott. Cazzaniga Paolo. Dip. di Scienze Umane e Sociali Il software Dip. di Scienze Umane e Sociali Outline 1 Il software Outline Il software 1 Il software Algoritmo Sequenza di istruzioni la cui esecuzione consente di risolvere uno


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Linguaggi e Paradigmi di Programmazione

Linguaggi e Paradigmi di Programmazione Linguaggi e Paradigmi di Programmazione Cos è un linguaggio Definizione 1 Un linguaggio è un insieme di parole e di metodi di combinazione delle parole usati e compresi da una comunità di persone. È una


Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e


Architettura di un computer

Architettura di un computer Architettura di un computer Modulo di Informatica Sara Zuppiroli A.A. 2012-2013 Modulo di Informatica () Architettura A.A. 2012-2013 1 / 36 La tecnologia Cerchiamo di capire alcuni concetti su


Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi


Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola


Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini

Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Introduzione agli Algoritmi Genetici Prof. Beatrice Lazzerini Dipartimento di Ingegneria della Informazione Via Diotisalvi, 2 56122 PISA ALGORITMI GENETICI (GA) Sono usati per risolvere problemi di ricerca


Università di Pisa Facoltà di Scienze Matematiche Fisiche e Naturali

Università di Pisa Facoltà di Scienze Matematiche Fisiche e Naturali Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea Specialistica in Informatica (classe 23/S: Informatica) Corso di Laurea Specialistica in Tecnologie Informatiche (classe 23/S: Informatica)



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando


Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni





RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


Scopo della lezione. Informatica. Informatica - def. 1. Informatica

Scopo della lezione. Informatica. Informatica - def. 1. Informatica Scopo della lezione Informatica per le lauree triennali LEZIONE 1 - Che cos è l informatica Introdurre i concetti base della materia Definire le differenze tra hardware e software Individuare le applicazioni


Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


Varianti Macchine di Turing

Varianti Macchine di Turing Varianti Macchine di Turing Esistono definizioni alternative di macchina di Turing. Chiamate Varianti. Tra queste vedremo: MdT a più nastri e MdT non deterministiche. Mostriamo: tutte le varianti ragionevoli
