Mutazioni & Mutagenesi

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Mutazioni & Mutagenesi"

Transcript

1 Mutazioni & Mutagenesi

2 Importanza delle mutazioni Le mutazioni costituiscono uno degli strumenti più importanti per comprendere la funzione dei geni. Per ottenere mutazioni si utilizzano: - agenti mutageni (raggi X, EMS) Mutazioni casuali, difficoltà di screening, no gene-specifico - mutagenesi in vitro sequenza-specifica Mutazioni sito-specifiche in modo da migliorare o alterare le caratteristiche delle proteine (ingegneria proteica), diverse strategie di screening - elementi inserzionali Mutazioni di tipo KnockOut, recessive, casuali Tipi di Mutazioni - Puntiformi (silenti, missenso, nonsenso) - Inserzioni/delezioni (frameshift?? Se non 3N)

3 Mutagenesi sito-specifica per estensione del primer Questo sistema utilizza uno stampo di DNAss del gene da mutare. Il primer si lega alla sua sequenza complementare introducendo una o più mutazioni specifiche. L ibrido viene poi trattato con DNApol. e dntp, per sintetizzare un filamento complementare che porta le basi mutate. Il filamento ds così creato è trasformato in cellule di E.coli. In E.coli si avrà replicazione sia di copie del plasmide wild type che del plasmide mutagenizzato. Screening con oligonucletoide ad alta stringenza

4 Mutagenesi sito-specifica con il metodo dut - ung - Un metodo più efficiente per effettuare mutagenesi sito-specifica è il metodo dut- ung- in cui il filamento wild type è selettivamente indirizzato verso la degradazione. Si ottiene facendo crescere il fago filamentoso M13 in un ceppo di E.coli che porta mutazioni nei geni dut e ung Il gene DUT codifica per una UTPasi la cui funzione è di degradare il dutp nella cellula. La mutazione dut - provoca un elevata concentrazione di dutp (U) che si accumula nella cellula e tende a sostituirsi al dttp (T) durante la replicazione del DNA Il gene UNG codifica per una uracil-n-glicosilasi che normalmente rimuove l uracile dal DNA

5 Mutagenesi sito-specifica con il metodo dut - ung - Dopo aver fatto crescere il costrutto in un ceppo dut -, ung - si purifica il DNAss e si procede alla mutagenesi in vitro utilizzando il primer mutagenizzato. Si otterrà un plasmide ds in cui il filamento parentale sarà ricco in UTP mentre quello mutato avrà un normale contenuto di TTP. Trasformando in un ceppo di E.coli WT per il gene UNG che codifica per una uracil-n-glicosilasi i residui di uracile contenuti nel filamento parentale saranno degradati distruggendo selettivamente il filamento stampo. In questo modo la maggioranza dei trasformanti ottenuti sarà di tipo mutante.

6 I plasmidi sono clonati un ceppo E.coli con attività dam metilasica così che i siti Screening mediante metilazione GATC siano metilati. I plasmidi sono isolati e denaturati. I primer mutagenizzati sono appaiati al DNA clonato. Viene effettuata la PCR e come risultato si avranno molecole mutagenizzate di neo sintesi non metilate e molecole stampo metilate. La miscela di reazione viene digerita con MboI, enzima di restrizione metilazione-specifico che taglia solo il filamento stampo parentale. Il DNA clonato mutato viene usato per trasformare E.coli.

7 Mutagenesi sito-specifica a cassetta Si applica quando il sito da mutare è compreso tra due siti di restrizione convenienti, ad una distanza massima di bp KpnI EcoRI HindIII BamHI Vogliamo, per esempio cambiare una A in una T in una zona compresa tra i siti EcoRI e HindIII GAATTCAACGTTGGAAATATGCCATTAAGCTT CTTAAGTTGCAACCTTTATACGGTAATTCGAA A questo scopo: 1) Rimuoviamo il frammento interno EcoRI/HindIII contenente la base da cambiare G CTTAA AGCTT A

8 2) Sintetizziamo due oligonucleotidi (max 100 bp) complementari tra loro, eccetto per le parti terminali e contenenti la base mutata AATTCAACGTTGGAATTATGCCATTA GTTGCAACCTTAATACGGTAATTCGA 3) Denaturando e rinaturando gli oligo, questi si appaieranno tra loro e potranno essere ligati alla sequenza priva della cassetta EcoRI/HindIII AATTCAACGTTGGAATTATGCCATTA GTTGCAACCTTAATACGGTAATTCGA G CTTAA AGCTT A Generando, così la mutazione sito-specifica desiderata GAATTCAACGTTGGAATTATGCCATTAAGCTT CTTAAGTTGCAACCTTAATACGGTAATTCGAA

9 Mutagenesi sito-specifica per PCR all interno di un prodotto di amplificazione

10

11 Mutagenesi Inserzionale Un sistema alternativo di mutagenesi prevede l uso di DNA come agente mutageno. Il genoma di piante e animali contiene elementi trasponibili, sequenze di DNA che occasionalmente possono interrompere l integrità di un gene causando una mutazione. E importante sottolineare che la mutagenesi con elementi trasponibili puo essere condotta a saturazione, cioe inducendo un numero di trasposizioni sufficientemente elevato da interrompere teoricamente, ciascun gene dell organismo, almeno una volta in una delle linee mutagenizzate ottenute. Oltre agli elementi trasponibili endogeni, anche i DNA esogeni possono occasionalmente integrarsi in modo casuale interrompendo un gene. Tra gli elementi trasponibili noti: Elementi P di Drosophila Tc1 in C.elegans Ac-Ds in mais Tam in Antirrhinium

12 Strategie genetico-molecolari per studiare la funzione genica Inattivazione di un gene per identificare e caratterizzare un fenotipo Non tutti i geni sono mutagenizzabili perché: geni funzionalmente ridondanti (geni a funzione simile ma non omologhi) (ridondanza strutturale v/s ridondanza funzionale) geni coinvolti in diverse fasi dello sviluppo, e mutazioni in tali geni possono causare fenotipi letali o pleiotropici mutagenesi sito-specifica v/s mutagenesi inserzionale random Nelle piante ed in Drosophila No mutagenesi sito-specifica!!!!!

13 Mutagenesi Inserzionale random

14 Promoter Trapping Utilizzando un gene reporter all interno del trasposone, è possibile identificare promotori/enhancer mediante espressione del reporter.

15 Strategie di Mutagenesi Inserzionale Nelle piante a) T-DNA mutageno inserzionale che produce inserzioni stabili no hot spots di integrazione b) Trasposoni il trasposone può essere exciso dal gene inattivato (reversione del fenotipo = complementazione) eventi di trasposizione avvengono in zone limitrofe al sito di inserzione

16 Esempio di T-DNA ingegnerizzato come elemento mutageno RB LB GUS nos3 ocs3 KanR Pnos 35S Erbic R

17 Gene tagging Un vantaggio della mutagenesi inserzionale è rappresentato dal fatto che il locus interrotto risulta anche marcato o tagged. L uso di trasposoni non endogeni o transgeni con caratteristiche equivalenti offre una sequenza tag unica che permette l identificazione del gene inattivato senza ambiguità. Tra le diverse strategie disponibili per isolare il gene taggato, o meglio le flanking sequences del trasposone: o Plasmic Rescue o Inverse PCR o Libreria genomica dell organismo taggato

18 X Plasmid rescue X RB Kana T-DNA ori amp LB X Digestione X T-DNA ori amp Ligazione intramolecolare T-DNA X X Trasformazione E.coli X Selezione colonie AmpR, su LB+Amp

19

20 X RB GUS Inverse PCR T-DNA LB Kana X X Digestione X T-DNA Ligazione intramolecolare T-DNA PCR X X

21 Mutagenesi per ricombinazione omologa Qualsiasi regione del genoma di lievito può essere sostituita da sequenze di interesse, o un gene endogeno può essere sostituito da una sua copia mutagenizzata. Il DNA da inserire viene fiancheggiato da sequenze omologhe a quelle che fiancheggiano la regione genomica da sostituire. Le alte frequenze di ricombinazione omologa di lievito, garantiscono un alta percentuale di ricombinazione con il cromosoma che ha come risultato lo scambio genetico.

22 Il fenotipo mutante dipende dall inserzione del T-DNA, cioé dall inattivazione del gene X??? DIMOSTRAZIONE FORMALE: COMPLEMENTAZIONE!!!!!!! Complementazione Trasformazione dell organismo mutante con una copia del gene WT, al fine di restaurare la funzione mancante