Il project management in microbiologia

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il project management in microbiologia"

Transcript

1 Il project management in microbiologia Ettore Turra Area Sistemi di Gestione APSS Trento

2 Argomenti Processi, progetti e project management Project management in microbiologia Caso applicativo (APSS) Il progetto estensione sorveglianza HAI Considerazioni finali

3 PROCESSI, PROGETTI E PROJECT MANAGEMENT 3

4 Diversi tipi di organizzazione per l esecuzione dei processi Caratteristiche dei processi Scala Esecuzione frequente unica unica Durata breve termine breve-medio lungo termine Dimensione esigua medio-vasta vasta Organizzazioni coinvolte poche alcune molte Forma organizzazione Organizzazione permanente Progetto Programma Approccio gestionale Process management Project management Program management Fonte: Roland Gareis,

5 Progetto come organizzazione temporanea Fase pre progetto Fase post progetto Prossimo Stato Progetto Stato Attuale 5

6 Gestire il cambiamento attraverso i progetti Fonte: R.Gareis, M.Heumann - International Journal of Project Management 26 (2008) La gestione per progetti è funzionale al cambiamento delle organizzazioni In particolare, assicura la comunicazione e l apprendimento organizzativo In modo da mitigare i rischi e superare le resistenze al cambiamento 6

7 Genesi di un progetto inizio Idea investimento Proposta Progettuale Valutazione costi/ benefici Decisione di Progetto no fine si Proposta di Investimento Assegnazione di Progetto Decisione di investimento sì fine fine 7

8 Un progetto nel ciclo di vita di un investimento Controllo II Inizio del Progetto: Progetto assegnato Controllo I Controllo III Controllo IV Termine dell utilizzo Progetto per inizializzare l investimento Utilizzo dei risultati dell investimento Disinvest -imento Fine del Progetto: Progetto approvato Ciclo di vita dell investimento (Realizzazione costi/benefici) t Inizio del ciclo di vita dell investimento : Decisione di investimento presa Fine del ciclo di vita : Disinvestimento effettuato 8

9 PROJECT MANAGEMENT IN MICROBIOLOGIA Caso Applicativo 9

10 Progetto Estensione Sorveglianza HAI: contesto e fatti Contesto Scopo: migliorare la sorveglianza, prevenzione e terapia delle HAI Sulla base di un sistema di laboratorio unico attivo nei sette ospedali provinciali Secondo le indicazioni e le esperienze del CIPASS aziendale (Comitato Controllo Infezioni Associate ai Processi Assistenziali) Fatti Inizio progetto: luglio 2008 Durata: 14 mesi Organizzazioni coinvolte: Dipartimento di laboratorio, direzioni mediche di presidio (7), tutte le UU.OO ospedaliere di ricovero e cura Project Manager: Paolo Lanzafame (Dipartimento di Laboratorio) 10

11 Progetto Estensione Sorveglianza HAI: fasi pre e post progetto Fase pre-progetto Fase post-progetto Stadardizzazione di tutti i laboratori di APSS su un unico sistema software integrato (LIS) Procedure CIPASS e CIO per le precauzioni in corso d infezioni varie PROGETTO CIPASS Sorveglianza HAI Utilizzo dei risultati del progetto nelle strategie di prevenzione e cura delle infezioni Estensione ad RSA e a ospedali convenzionati Estensione ad ADI 11

12 Progetto Estensione Sorveglianza HAI: obiettivi Attivare uno strumento di sorveglianza in grado di integrare i dati di laboratorio con quelli provenienti da fonti di informazioni cliniche e di supporto Costituire un servizio centralizzato, per tutte le strutture APSS, di sorveglianza di laboratorio delle infezioni correlate a pratiche assistenziali Identificare precocemente gli eventi di allarme Eseguire raccolte di informazioni specifiche e mirate per valutare gli ambiti in cui applicare le misure preventive/correttive e per poi valutarne l efficacia 12

13 Progetto Estensione Sorveglianza HAI: risultati operativi Riduzione dei tassi globali di incidenza delle infezioni correlate all assistenza Riduzione dei tassi di antibioticoresistenza Riduzione dei tempi di applicazione delle precauzioni volte a controllo e contenimento delle infezioni con riduzione degli outbreaks e/o eventi epidemici 13

14 Progetto Estensione Sorveglianza HAI: risultati di efficienza Nel primo anno di utilizzo del sistema (2010 vs 2009) è stata registrata una riduzione del tasso di infezione di - 2,3 infezioni/1000 giorni di degenza X giornate di degenza totali = ca = infezioni/anno corrispondente a un risparmio di K Euro* * Ipotesi di costo medio per infezione ospedaliera = 1500 euro ca. 14

15 Progetto Estensione Sorveglianza HAI: struttura delle attività (WBS) PROGETTO CIPASS SORVEGLIANZA HAI 1.0 PROJECT MANAGEMENT 2.0 SOFTWARE 3.0 ATTIVAZIONE SORVEGLIANZA 1.1 Avvio del progetto 2.1 Acquisizione Soluzione Software 3.1 Informazione e Formazione CIO e Reparti 1.2 Pianificazione progetto completata 2.2 Installazione Fase Attivazione Pilota 1.3 Controllo di progetto 1.4 Coordinamento continuo 1.5 Chiusura di progetto 1.6 Presentazione finale di progetto 2.3 Installazione Fase Parametrizzazione 2.5 Test 2.6 Software collaudato Monitoraggio e Valutazione 3.4 Estensione Sorveglianza 3.5 Sorveglianza a regime

16 Progetto Estensione Sorveglianza HAI: descrizione attività (WP) 16

17 Progetto Estensione Sorveglianza HAI: organizzazione Team Cavalese Team Rovereto - Tione Team Team di Progetto di Progetto PM Team Trento - Cles e Borgo Comitato Comitato Guida Guida Direzione Aziendale 17

18 Progetto Estensione Sorveglianza HAI: ambienti rilevanti Direzione Dipartimento Laboratorio Componenti CIPASS Servizio Sistemi Informativi Responsabili UU.OO. PROGETTO CIPASS Sorveglianza HAI Fornitore Software Direzioni Mediche + CIO (per ospedale) 18

19 Progetto Estensione Sorveglianza HAI: conclusioni La complessità del progetto non è tanto dovuta a fattori tecnologici ma umani: aspettative di un numero elevato di parti interessate assunzione di responsabilità nella gestione delle infezioni Ruolo del Project Manager nella gestione del cambiamento Progetto posto sotto le conduzione di esperti del contenuto (clinico) piuttosto che esperti del contenitore (sistema informativo) 19

20 PROJECT MANAGEMENT IN MICROBIOLOGIA Considerazioni finali 20

21 Project Management raccomandazioni per l uso Importanza della dimensione sociale del project management: Non solo pianificazione dei tempi, attività, costi, ma soprattutto gestione dell organizzazione, delle comunicazioni, del contesto sociale del progetto Applicare gli strumenti ad un livello corretto, quello minimo necessario per assicurare la prevedibilità e dei risultati e la comunicazione all interno e all esterno del progetto I vantaggi dall uso di strumenti standard di Project Management sono: riduzione dell impegno necessario per la pianificazione visione complessiva del progetto considerazione esplicita dei collegamenti tra obiettivi, attività, risultati I potenziali svantaggi sono: rischio di applicazione di strumenti non adattati al contesto specifico possibile appiattimento dei contenuti e delle attività progettuali 21

22 Domande 22

23

24 ERROR: undefined OFFENDING COMMAND: Il STACK: (8) /Title () /Subject (D: ) /ModDate () /Keywords (PDFCreator Version 0.9.5) /Creator (D: ) /CreationDate ( ) /Author -mark-

Argomenti. Sesto al Reghena (PN), 4 dicembre 2009 CONTESTO APPLICAZIONE DEL PROJECT MANAGEMENT AD UN PERCORSO INTEGRATO DI CURA CONCLUSIONI

Argomenti. Sesto al Reghena (PN), 4 dicembre 2009 CONTESTO APPLICAZIONE DEL PROJECT MANAGEMENT AD UN PERCORSO INTEGRATO DI CURA CONCLUSIONI DISEGNO ED ATTUAZIONE DI PERCORSI INTEGRATI DI CURA SULLA BASE DEI METODI DI PROJECT MANAGEMENT Salute, centralità del cittadino, percorsi integrati di cura Sesto al Reghena (PN), 4 dicembre 2009 Ettore

Dettagli

REGOLAMENTO PER LA GESTIONE DELLE PARTECIPAZIONI SOCIETARIE DEL COMUNE DI RIMINI

REGOLAMENTO PER LA GESTIONE DELLE PARTECIPAZIONI SOCIETARIE DEL COMUNE DI RIMINI REGOLAMENTO PER LA GESTIONE DELLE PARTECIPAZIONI SOCIETARIE DEL COMUNE DI RIMINI ARTICOLO 1 DEFINIZIONI 1.1 Ai fini del presente regolamento i seguenti termini hanno i significati di seguito indicati:

Dettagli

UNIONE DI COMUNI VALLE DEL SAMOGGIA 1 S ETTORE - SERVIZIO SEGRETERIA GENERALE Reg. n. IT - 40972

UNIONE DI COMUNI VALLE DEL SAMOGGIA 1 S ETTORE - SERVIZIO SEGRETERIA GENERALE Reg. n. IT - 40972 REGOLAMENTO PER L ISTITUZIONE ED IL FUNZIONAMENTO DEL CONSIGLIO TRIBUTARIO ASSOCIATO Articolo 1- Oggetto del regolamento 1. Oggetto del presente regolamento, adottato ai sensi dell articolo 7 del D.Lgs.

Dettagli

CASO APPLICATIVO: PROGRAMMA DI SVILUPPO RISORSE UMANE

CASO APPLICATIVO: PROGRAMMA DI SVILUPPO RISORSE UMANE CASO APPLICATIVO: PROGRAMMA DI SVILUPPO RISORSE UMANE IL PROJECT MANAGEMENT NEL SERVIZIO SANITARIO L esperienza dell APSS di Trento Bolzano, 8 maggio 2008 Auditorio del Palazzo Provinciale 12 Autore: Ettore

Dettagli

Aggiornato al mese di Novembre 2007. Caso applicativo presentato da Ettore Turra (APSS) al seminario:

Aggiornato al mese di Novembre 2007. Caso applicativo presentato da Ettore Turra (APSS) al seminario: Aggiornato al mese di Novembre 2007 Dr. Enzo Moser Dipartimento di Radiodiagnostica, APSS Caso applicativo presentato da Ettore Turra (APSS) al seminario: IL PROJECT MANAGEMENT NEL SERVIZIO SANITARIO L

Dettagli

1 PREMESSA - RELAZIONE A SUPPORTO DI RICHIESTA DI DEROGA PER DISTANZA ALLEVAMENTI -

1 PREMESSA - RELAZIONE A SUPPORTO DI RICHIESTA DI DEROGA PER DISTANZA ALLEVAMENTI - 1 PREMESSA Il presente documento viene predisposto al fine di inoltrare richiesta di deroga sindacale per modifica della distanza di rispetto di un allevamento bovino, con riferimento al progetto di S.U.A.P.

Dettagli

La valutazione dei rischi nei viaggi internazionali

La valutazione dei rischi nei viaggi internazionali Corso di Formazione Specifica in Medicina Generale Triennio 2008-2011 VIAGGI E SALUTE Reggio Emilia 16/12/2010 La valutazione dei rischi nei viaggi internazionali nei viaggi internazionali Il Viaggio Trasferimento

Dettagli

Informatizzazione delle strutture:

Informatizzazione delle strutture: Informatizzazione delle strutture: 9 anni di esperienza e Rete Oncologica Trentina Enzo Galligioni Oncologia Medica, Trento 1 Assistenza sanitaria in Trentino: Peculiarità organizzative Provincia Autonoma

Dettagli

Ettore Turra Azienda Provinciale per i Servizi Sanitari Provincia Autonoma di Trento ettore.turra@apss.tn.it. Ettore Turra

Ettore Turra Azienda Provinciale per i Servizi Sanitari Provincia Autonoma di Trento ettore.turra@apss.tn.it. Ettore Turra IL PROJECT MANAGEMENT NEL SERVIZIO SANITARIO L esperienza dell APSS di Trento Bolzano, 8 maggio 2008 Auditorio del Palazzo Provinciale 12 Ettore Turra Azienda Provinciale per i Servizi Sanitari Provincia

Dettagli

Gli elementi chiave del progetto

Gli elementi chiave del progetto Gli elementi chiave del progetto 1 BELMONTE from inside: Dal 1938 Belmonte in Italia vuol dire camicia. Nata come piccola azienda familiare, la struttura è ormai una florida e ben radicata testimonianza

Dettagli

INFEZIONE DA HCV NEL PAZIENTE DIALIZZATO. Dr Fabrizio Valente S.C. Nefrologia e Dialisi Trento

INFEZIONE DA HCV NEL PAZIENTE DIALIZZATO. Dr Fabrizio Valente S.C. Nefrologia e Dialisi Trento INFEZIONE DA HCV NEL PAZIENTE DIALIZZATO Dr Fabrizio Valente S.C. Nefrologia e Dialisi Trento 170 Million Carriers Worldwide, 3-4 MM new cases/year 3% of World Population CANADA 300,000 U.S.A. 4 M WEST

Dettagli

L ESPERIENZA DELLE REGIONE LAZIO NELLA GESTIONE DELLE INFEZIONI CORRELATE ALL ASSISTENZA. Antonio Silvestri Risk Manager

L ESPERIENZA DELLE REGIONE LAZIO NELLA GESTIONE DELLE INFEZIONI CORRELATE ALL ASSISTENZA. Antonio Silvestri Risk Manager L ESPERIENZA DELLE REGIONE LAZIO NELLA GESTIONE DELLE INFEZIONI CORRELATE ALL ASSISTENZA Antonio Silvestri Risk Manager 1982 I RAPPORTO ISTISAN 1982 Indagine conoscitiva sulle infezioni ospedaliere negli

Dettagli

Le normative ed il risparmio ottenibile mediante l utilizzo della Ventilazione Meccanica Controllata Claudio Buttà Dir. Relazioni Esterne Aldes spa

Le normative ed il risparmio ottenibile mediante l utilizzo della Ventilazione Meccanica Controllata Claudio Buttà Dir. Relazioni Esterne Aldes spa Le normative ed il risparmio ottenibile mediante l utilizzo della Ventilazione Meccanica Controllata Claudio Buttà Dir. Relazioni Esterne Aldes spa 1 2 3 4 5 6 7 le infiltrazioni naturali. UNI 10344: "Riscaldamento

Dettagli

COMUNE DI CASTELLO DI SERRAVALLE. - Provincia di Bologna - REPUBBLICA ITALIANA ACCORDO PRELIMINARE AI SENSI DELL ART. 18 DELLA LEGGE DELLA

COMUNE DI CASTELLO DI SERRAVALLE. - Provincia di Bologna - REPUBBLICA ITALIANA ACCORDO PRELIMINARE AI SENSI DELL ART. 18 DELLA LEGGE DELLA COMUNE DI CASTELLO DI SERRAVALLE - Provincia di Bologna - Repertorio n.. REPUBBLICA ITALIANA ACCORDO PRELIMINARE AI SENSI DELL ART. 18 DELLA LEGGE DELLA REGIONALE 24 MARZO 2000, N. 20 E ART. 11 LEGGE N.

Dettagli

Esperienza di utilizzo integrato del blocco operatorio in una rete ospedaliera provinciale

Esperienza di utilizzo integrato del blocco operatorio in una rete ospedaliera provinciale CONVEGNO INTERNAZIONALE ACCREDITAMENTO, PROGRAMMI DI VALUTAZIONE ESTERNA E SICUREZZA DEL PAZIENTE Roma, 7-8 marzo 2011 Esperienza di utilizzo integrato del blocco operatorio in una rete ospedaliera provinciale

Dettagli

CARTA DEI SERVIZI. SS di TERAPIA ANTALGICA E CURE PALLIATIVE PEDIATRICHE. Servizio Procedure

CARTA DEI SERVIZI. SS di TERAPIA ANTALGICA E CURE PALLIATIVE PEDIATRICHE. Servizio Procedure CARTA DEI SERVIZI SS di TERAPIA ANTALGICA E CURE PALLIATIVE PEDIATRICHE Servizio Procedure Informazioni generali Gentile utente, la preghiamo di esaminare le indicazioni contenute in questa Carta dei Servizi

Dettagli

Siamo in tanti, oggi, in questa sala e questo è un fatto positivo per il nostro partito e per gli appuntamenti che lo stanno attendendo.

Siamo in tanti, oggi, in questa sala e questo è un fatto positivo per il nostro partito e per gli appuntamenti che lo stanno attendendo. Sintesi del discorso di presentazione della mozione per la candidatura a segretario provinciale di Renato Veronesi, espressosi liberamente, senza l ausilio di una traccia scritta, durante i lavori della

Dettagli

AZIENDA PROVINCIALE PER I SERVIZI SANITARI

AZIENDA PROVINCIALE PER I SERVIZI SANITARI Provincia Autonoma di Trento AZIENDA PROVINCIALE PER I SERVIZI SANITARI Trento via Degasperi 79 VERBALE DI DELIBERAZIONE DEL DIRETTORE GENERALE Reg. delib. n. 473 2011 OGGETTO: Riorganizzazione delle attività

Dettagli

La diagnosi microbiologica per HCV e proposta di una flow-chart diagnostica

La diagnosi microbiologica per HCV e proposta di una flow-chart diagnostica La diagnosi microbiologica per HCV e proposta di una flow-chart diagnostica Danila Bassetti, MD Microbiologia e Virologia Struttura Semplice Sierologia Autoimmunità Ospedale S.Chiara Trento Trento, 14

Dettagli

L informativa obbligatoria

L informativa obbligatoria Corso di International Accounting Università degli Studi di Parma - Facoltà di Economia (Modulo 1 e Modulo 2) LAMIB L informativa obbligatoria Anno Accademico 2009-2010 1 INFORMATIVA OBBLIGATORIA Il sistema

Dettagli

Il Percorso continua e si sviluppa. Il POA definisce nuove competenze Applicazione POA. Necessità di risorse Coinvolgimento singoli

Il Percorso continua e si sviluppa. Il POA definisce nuove competenze Applicazione POA. Necessità di risorse Coinvolgimento singoli POLITICA AZIENDALE SCELTE E PROSPETTIVE Il Percorso continua e si sviluppa Il POA definisce nuove competenze Applicazione POA Necessità di risorse Coinvolgimento singoli 2.2 Il controllo della Qualità

Dettagli

POSITION PAPER: RUOLO DELLE STRUTTURE DI DIETETICA E NUTRIZIONE CLINICA

POSITION PAPER: RUOLO DELLE STRUTTURE DI DIETETICA E NUTRIZIONE CLINICA libro:layout 1 21-10-2010 15:06 Pagina 49 POSITION PAPER: RUOLO DELLE STRUTTURE DI DIETETICA E CLINICA M. L. Amerio, D. Domeniconi in collaborazione con la Rete dei Servizi di Dietetica e Nutrizione Clinica

Dettagli

GESTIONE DEL RISCHIO: tecnologia sanitaria e strategia globale

GESTIONE DEL RISCHIO: tecnologia sanitaria e strategia globale Arezzo, Centro Affari e Convegni 28 novembre 1 dicembre 2007 II FORUM RISK MANAGEMENT IN SANITÀ GESTIONE DEL RISCHIO: tecnologia sanitaria e strategia globale C. Favaretti Presidente SIHTA Direttore Generale

Dettagli

LA CARTA DEI SERVIZI PER I LAVORATORI DISABILI PROVINCIA AUTONOMA DI TRENTO

LA CARTA DEI SERVIZI PER I LAVORATORI DISABILI PROVINCIA AUTONOMA DI TRENTO LA CARTA DEI SERVIZI PER I LAVORATORI DISABILI PROVINCIA AUTONOMA DI TRENTO POSSIAMO GARANTIRTELO: I CENTRI PER L IMPIEGO SONO VICINI, E TI SONO VICINI indice dei servizi ACCOGLIENZA ISCRIZIONE IN ELENCHI

Dettagli

GOVERNANCE E COMUNICAZIONE DI IMPRESA

GOVERNANCE E COMUNICAZIONE DI IMPRESA Corso di laurea Magistrale Management e comunicazione d impresa Insegnamento di: GOVERNANCE E COMUNICAZIONE DI IMPRESA a.a. 2009/2010 MATERIALE DIDATTICO DOCENTE Christian Corsi ARGOMENTO RISCHI NEL PROJECT

Dettagli

Curriculum Vitae di MARIO GRATTAROLA

Curriculum Vitae di MARIO GRATTAROLA Curriculum Vitae di MARIO GRATTAROLA DATI PERSONALI nato a PARMA il 19-09-1964 PROFILO BREVE Direttore della Struttura Ospedaliera di Trento dell Azienda Provinciale per i Servizi Sanitari di Trento TITOLI

Dettagli

SISS IL SISTEMA AL SERVIZIO DELLA SANITÀ AO DESENZANO DEL GARDA

SISS IL SISTEMA AL SERVIZIO DELLA SANITÀ AO DESENZANO DEL GARDA SISS IL SISTEMA AL SERVIZIO DELLA SANITÀ AO DESENZANO DEL GARDA Sommario Introduzione Le finalità del progetto CRS-SISS e il ruolo di Regione Lombardia Aspetti tecnico-organizzativi del Progetto Servizi

Dettagli

LE VALUTAZIONI TECNICO SANITARIE SULLE OPERE DI COSTRUZIONE E RISTRUTTURAZIONE EDILIZIA NEI VECCHI E NUOVI OSPEDALI

LE VALUTAZIONI TECNICO SANITARIE SULLE OPERE DI COSTRUZIONE E RISTRUTTURAZIONE EDILIZIA NEI VECCHI E NUOVI OSPEDALI LE VALUTAZIONI TECNICO SANITARIE SULLE OPERE DI COSTRUZIONE E RISTRUTTURAZIONE EDILIZIA NEI VECCHI E NUOVI OSPEDALI AOSTA - 24.5.2006 Dr. Roberto GERBI D.P.R. 128/1969 Art. 5 - Attribuzioni del direttore

Dettagli

La Logistica Sanitaria per la Qualità e la sostenibilità delle cure: l Esperienza dell Area Vasta Romagna

La Logistica Sanitaria per la Qualità e la sostenibilità delle cure: l Esperienza dell Area Vasta Romagna La Logistica Sanitaria per la Qualità e la sostenibilità delle cure: l Esperienza dell Area Vasta Romagna La rilevanza strategica della logistica nelle Aziende Sanitarie Stefano Villa, Ricercatore di Economia

Dettagli

ELECTRONIC PATIENT RECORD: L INTEGRAZIONE DELLE INFORMAZIONI A SUPPORTO DELLA GOVERNANCE SANITARIA

ELECTRONIC PATIENT RECORD: L INTEGRAZIONE DELLE INFORMAZIONI A SUPPORTO DELLA GOVERNANCE SANITARIA ELECTRONIC PATIENT RECORD: L INTEGRAZIONE DELLE INFORMAZIONI A SUPPORTO DELLA GOVERNANCE SANITARIA Adalgisa Protonotari Direttore Programmazione Sanitaria Coordinatore Area Direzione delle Attività Clinico-Assistenziali

Dettagli

RUOLI E COMPETENZE IN SANITA Lo sviluppo delle pratiche di Human Resource Management: scenari ed esperienze di successo Modena 21 giugno 2011

RUOLI E COMPETENZE IN SANITA Lo sviluppo delle pratiche di Human Resource Management: scenari ed esperienze di successo Modena 21 giugno 2011 RUOLI E COMPETENZE IN SANITA Lo sviluppo delle pratiche di Human Resource Management: scenari ed esperienze di successo Modena 21 giugno 2011 Ettore Turra Innovazione Organizzativa e Gestione del Cambiamento

Dettagli

NEWSLETTER Screening Mammografico provincia di Trento

NEWSLETTER Screening Mammografico provincia di Trento NEWSLETTER Screening Mammografico provincia di Trento Anno 2003 A cura del gruppo tecnico di valutazione Screening Mammografico Direzione per la Promozione e l'educazione alla Salute Giugno 2004 Gruppo

Dettagli

Ordinario di Igiene, Facoltà di Medicina e Chirurgia, Università degli Studi di

Ordinario di Igiene, Facoltà di Medicina e Chirurgia, Università degli Studi di Nursing avanzato per la sorveglianza epidemiologica e il controllo delle infezioni correlate ai processi assistenziali (ICPA) Livello I Crediti Formativi Universitari 60 Direttore Prof. Gabriele Romano

Dettagli

DIMISSIONI PROTETTE E ASSISTENZA DOMICILIARE. MARIA IMMACOLATA COZZOLINO GERIATRA DIRETTORE DISTRETTO RMF1 mariai.cozzolino@aslrmf.

DIMISSIONI PROTETTE E ASSISTENZA DOMICILIARE. MARIA IMMACOLATA COZZOLINO GERIATRA DIRETTORE DISTRETTO RMF1 mariai.cozzolino@aslrmf. DIMISSIONI PROTETTE E ASSISTENZA DOMICILIARE MARIA IMMACOLATA COZZOLINO GERIATRA DIRETTORE DISTRETTO RMF1 mariai.cozzolino@aslrmf.it Popolazione anziana Distretto RMF1 Dati 2000 65-74 75-84 >85 M 3397

Dettagli

Strumenti di programmazione, monitoraggio e controllo. Il processo di budget

Strumenti di programmazione, monitoraggio e controllo. Il processo di budget Servizio Controllo di Gestione Strumenti di programmazione, monitoraggio e controllo Il processo di budget Il processo ho la scopo di garantire il raggiungimento dei risultati annuali previsti dalla Direzione

Dettagli

TITOLI DI STUDIO E PROFESSIONALI ED ESPERIENZE LAVORATIVE

TITOLI DI STUDIO E PROFESSIONALI ED ESPERIENZE LAVORATIVE CURRICULUM VITAE Informazioni personali Cognome e Nome ONOFARO FILIPPINA Data di nascita 15/09/1961 Qualifica MED.S.S.EX9-117TP Disciplina Medicina Matricola 36173 Incarico attuale Dirigente U.O.S.D. ALPI

Dettagli

STRUMENTI INFORMATICI PER MIGLIORARE L APPROPRIATEZZA PRESCRITTIVA:

STRUMENTI INFORMATICI PER MIGLIORARE L APPROPRIATEZZA PRESCRITTIVA: STRUMENTI INFORMATICI PER MIGLIORARE L APPROPRIATEZZA PRESCRITTIVA: LE INTERAZIONI TRA FARMACI IN OSPEDALE E LA REVISIONE DELLA TERAPIA AL DOMICILIO Annalisa Campomori, per il gruppo di progetto Simplify,

Dettagli

ASL AVELLINO Commissario Straordinario dott. Mario Nicola Vittorio Ferrante TITOLO DEL PROGETTO SVILUPPO DEGLI STRUMENTI DEL GOVERNO CLINICO E DELAL VALUTAZIONE DELLA QUALITA E DSELAL SICUREZZA DELEL PRESTAZIOINI

Dettagli

Curriculum Vitae di LUCIA PILATI

Curriculum Vitae di LUCIA PILATI Curriculum Vitae di LUCIA PILATI DATI PERSONALI nato a TRENTO, il 07-09-1969 PROFILO BREVE Coordinatore Trapianti APSS/PAT Dal 2013 responsabile del coordinamento aziendale per le attività di trapianto

Dettagli

Invecchiare è un privilegio e una meta della società. E anche una sfida, che ha un impatto su tutti gli aspetti della società del XXI secolo.

Invecchiare è un privilegio e una meta della società. E anche una sfida, che ha un impatto su tutti gli aspetti della società del XXI secolo. Invecchiare è un privilegio e una meta della società. E anche una sfida, che ha un impatto su tutti gli aspetti della società del XXI secolo. (Organizzazione Mondiale della Sanità) Il progetto Accettazione

Dettagli

Il Project Management per la piccola-media impresa: aumentare l efficienza per superare la crisi

Il Project Management per la piccola-media impresa: aumentare l efficienza per superare la crisi Il Project Management per la piccola-media impresa: aumentare l efficienza per superare la crisi Prato, 25 Settembre 2009 1 Programma 15:00 15:10 Benvenuto e apertura lavori 15:10 15:20 Presentazione del

Dettagli

Numero 2 del 29 febbraio 2012 PROGETTO CESIPE

Numero 2 del 29 febbraio 2012 PROGETTO CESIPE Numero 2 del 29 febbraio 2012 PROGETTO CESIPE Lo scorso 8 febbraio nella sede del Comitato Consultivo, il Direttore Generale dell Azienda "Policlinico-Vittorio Emanuele", Armando Giacalone, il Direttore

Dettagli

Priorità di Governo Clinico

Priorità di Governo Clinico Convention Nazionale Clinical Governance e Management Aziendale Sostenibilità delle innovazioni organizzative nell era del federalismo sanitario Bologna, 15-16 ottobre 2010 Survey Priorità di Governo Clinico

Dettagli

ISIPM Base. Project Management epmq: Project Management Fundamentals (ISIPM Base) Gruppo A Conoscenze di Contesto Syllabus da 1.1.1 a 1.10.

ISIPM Base. Project Management epmq: Project Management Fundamentals (ISIPM Base) Gruppo A Conoscenze di Contesto Syllabus da 1.1.1 a 1.10. ISIPM Base Project Management epmq: Project Management Fundamentals (ISIPM Base) Gruppo A Conoscenze di Contesto Syllabus da 1.1.1 a 1.10.1 1 Tema: Progetto 1.1.1 Conoscere la definizione di progetto e

Dettagli

I prossimi eventi! COOPER-ATTIVI PRIMA FESTA DELLE COOPERATIVE DELLA VAL- LE SERIANA E DI SCALVE SABATO 8 SETTEMBRE

I prossimi eventi! COOPER-ATTIVI PRIMA FESTA DELLE COOPERATIVE DELLA VAL- LE SERIANA E DI SCALVE SABATO 8 SETTEMBRE Pagine Sottosopra Foglio informativo della cooperativa Sottosopra Sede operativa: via Vittorio Veneto,141 Songavazzo I prossimi eventi! COOPER-ATTIVI PRIMA FESTA DELLE COOPERATIVE DELLA VAL- LE SERIANA

Dettagli

Corso Base di Project Management 3 giorni (21 ore)

Corso Base di Project Management 3 giorni (21 ore) Corso Base di Project Management 3 giorni (21 ore) Mettere in grado i partecipanti di acquisire la conoscenza della disciplina del project management affinchè essi possano successivamente affrontare e

Dettagli

Il Controllo di Gestione

Il Controllo di Gestione Il Controllo di Gestione Strumenti e Procedure Documento a Cura del Servizio Controllo di Gestione Azienda Provinciale per i Servizi Sanitari Trento pagina 1 IL SISTEMA DI MONITORAGGIO E REPORTING DELL

Dettagli

Corso di Formazione per Operatore Socio-Sanitario Complesso Integrato Columbus - Anno 2014

Corso di Formazione per Operatore Socio-Sanitario Complesso Integrato Columbus - Anno 2014 Corso di Formazione per Operatore Socio-Sanitario Complesso Integrato Columbus - Anno 2014 Lezione 8 Interventi socio assistenziali nell anziano Docenti: Claudia Onofri Ivana Palumbieri L invecchiamento

Dettagli

Specializzato in Statistica Sanitaria con indirizzo in programmazione socio-sanitaria presso l Università dell Aquila con votazione 70/70 e lode.

Specializzato in Statistica Sanitaria con indirizzo in programmazione socio-sanitaria presso l Università dell Aquila con votazione 70/70 e lode. DOTT. IVAN TERSIGNI CURRICULUM FORMATIVO E PROFESSIONALE STUDI Laureato in Medicina e Chirurgia presso l'universita' Cattolica del Sacro Cuore di Roma il 21-7-1978, con votazione 110/110 e lode. Specializzato

Dettagli

GESTIONE DEL RISCHIO, QUALE L APPROCCIO ASSISTENZIALE

GESTIONE DEL RISCHIO, QUALE L APPROCCIO ASSISTENZIALE Direzione del Servizio Infermieristico e Tecnico GESTIONE DEL RISCHIO, QUALE L APPROCCIO ASSISTENZIALE Annita Caminati e Roberta Mazzoni RISK MANAGEMENT Insieme di attività coordinate per gestire un organizzazione

Dettagli

XII CONGRESSO CURE PRIMARIE Azienda USL 11 Empoli TRA CHRONIC CARE MODEL E MEDICINA DI INIZIATIVA Empoli Palazzo delle esposizioni- 14 giugno 2012

XII CONGRESSO CURE PRIMARIE Azienda USL 11 Empoli TRA CHRONIC CARE MODEL E MEDICINA DI INIZIATIVA Empoli Palazzo delle esposizioni- 14 giugno 2012 M.C. Escher XII CONGRESSO CURE PRIMARIE Azienda USL 11 Empoli TRA CHRONIC CARE MODEL E MEDICINA DI INIZIATIVA Empoli Palazzo delle esposizioni- 14 giugno 2012 I TRE SNODI CRUCIALI DI UNA STRATEGIA IPOTIZZATA/ATTUATA

Dettagli

Regione Marche. Linee di intervento PSR: 7.1 Rete ospedaliera

Regione Marche. Linee di intervento PSR: 7.1 Rete ospedaliera Regione Marche Linee di intervento PSR: 7.1 Rete ospedaliera 1 Analisi della realtà regionale, per sistemi e processi Differenziali nel consumo di giornate di degenza tra le diverse aree vaste Scambi interni

Dettagli

Presentazione. Infezioni correlate all assistenza sanitaria (I.C.A.)

Presentazione. Infezioni correlate all assistenza sanitaria (I.C.A.) Presentazione Infezioni correlate all assistenza sanitaria e resistenza antimicrobica costituiscono due speciali problematiche sanitarie sulle quali importanti istituzioni internazionali, quali l OMS,

Dettagli

Ministero delle Infrastrutture e dei Trasporti Consulta Generale per L autotrasporto e per la Logistica

Ministero delle Infrastrutture e dei Trasporti Consulta Generale per L autotrasporto e per la Logistica Ministero delle Infrastrutture e dei Trasporti Consulta Generale per L autotrasporto e per la Logistica SUPPORTO OPERATIVO E TECNICO-SPECIALISTICO PER LA MESSA A SISTEMA E L OTTIMIZZAZIONE DELLA FILIERA

Dettagli

TITOLI DI STUDIO E PROFESSIONALI ED ESPERIENZE LAVORATIVE

TITOLI DI STUDIO E PROFESSIONALI ED ESPERIENZE LAVORATIVE INFORMAZIONI PERSONALI Nome Porretto Simone Lazzaro Data di nascita 20/03/1956 Qualifica Amministrazione Incarico attuale Dirigente Medico Direttore di Struttura Complessa ASL AL ALESSANDRIA Direttore

Dettagli

L infermiere case-manager: l esperienza dell Unità Spinare Unipolare dell A.O. Niguarda di Milano

L infermiere case-manager: l esperienza dell Unità Spinare Unipolare dell A.O. Niguarda di Milano L infermiere case-manager: l esperienza dell Unità Spinare Unipolare dell A.O. Niguarda di Milano Noemi Ziglioli, Coordinatore Infermieristico USU Niguarda, Milano Giovanna Bollini, Direttore DITRA A.O.

Dettagli

ATI SPEED AUTOMAZIONE

ATI SPEED AUTOMAZIONE DG Industria, Artigianato, Edilizia e Cooperazione SCHEDE TECNICHE INTERVENTI CONCLUSI ATI SPEED AUTOMAZIONE - SPEED AUTOMAZIONE Srl Milano - SALMOIRAGHI Spa Monza (MB) - SPEED R&D Srl (ex IICS Srl) Milano

Dettagli

IL PROJECT MANAGEMENT

IL PROJECT MANAGEMENT IL PROJECT MANAGEMENT Scopi e campi di applicazione La pianificazione del progetto Le tecniche di pianificazione del progetto Le tecniche di pianificazione dei tempi La gestione e il controllo del progetto

Dettagli

DISCIPLINARE TECNICO

DISCIPLINARE TECNICO Premessa ALLEGATO A del Capitolato Speciale d Appalto DISCIPLINARE TECNICO L Azienda Sanitaria Provinciale di Catanzaro (di seguito anche ), con la presente procedura intende dotarsi di un Sistema

Dettagli

Un approccio semplificato al program management Roberto Gribaldo,PMP Ufficio Program Management Torino, 14 Ottobre 2004

Un approccio semplificato al program management Roberto Gribaldo,PMP Ufficio Program Management Torino, 14 Ottobre 2004 Un approccio semplificato al program management Roberto Gribaldo,PMP Ufficio Program Management Torino, 14 Ottobre 2004 1 Reale Mutua Assicurazioni È la più grande società di assicurazioni italiana in

Dettagli

Il Sistema di Monitoraggio dell Agenzia delle Entrate

Il Sistema di Monitoraggio dell Agenzia delle Entrate Il Sistema di Monitoraggio dell Agenzia delle Entrate 1 La Governance dei contratti di outsourcing Dipartimento Politiche Fiscali Strumenti di governance Convenzione Triennale Agenzia delle Entrate Sogei

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Direttore UOC Anziani e Cure Domiciliari Azienda Sanitaria Provinciale di Catania ASP di Catania

Direttore UOC Anziani e Cure Domiciliari Azienda Sanitaria Provinciale di Catania ASP di Catania INFORMAZIONI PERSONALI DI FRANCO, Maria Antonina numero telefonico aziendale: 0952545746 numero telefonico aziendale: 3356005678 Viale Regina Margherita, 38-95024, Catania, Acireale Data di nascita [ 31

Dettagli

ewslette Supplemento n. 2 del n. 2 di APSS NOTIZIE Anno 13 INDAGINE DI CLIMA in Azienda provinciale per i servizi sanitari

ewslette Supplemento n. 2 del n. 2 di APSS NOTIZIE Anno 13 INDAGINE DI CLIMA in Azienda provinciale per i servizi sanitari ewslette Supplemento n. 2 del n. 2 di APSS NOTIZIE Anno 13 INDAGINE DI CLIMA in Azienda provinciale per i servizi sanitari ANALISI DI CLIMA IN APSS SUPPLEMENTO DEL PERIODICO D INFORMAZIONE APSS NOTIZIE

Dettagli

Via Tartini, n.5 Padova (PD) C.A.P. 35131 +39 3357767447 annamaria.saieva@sanita.padova.it. Sesso F Data di nascita 09/11/1958 Nazionalità italiana

Via Tartini, n.5 Padova (PD) C.A.P. 35131 +39 3357767447 annamaria.saieva@sanita.padova.it. Sesso F Data di nascita 09/11/1958 Nazionalità italiana INFORMAZIONI PERSONALI ANNA MARIA SAIEVA Via Tartini, n.5 Padova (PD) C.A.P. 35131 +39 3357767447 annamaria.saieva@sanita.padova.it Sesso F Data di nascita 09/11/1958 Nazionalità italiana DICHIARA QUANTO

Dettagli

DEFINIZIONE DEL FABBISOGNO DELLE RISORSE INFERMIERISTICHE, FISIOTERAPISTI, DEL PERSONALE DI SUPPORTO E DEL PERSONALE SANITARIO

DEFINIZIONE DEL FABBISOGNO DELLE RISORSE INFERMIERISTICHE, FISIOTERAPISTI, DEL PERSONALE DI SUPPORTO E DEL PERSONALE SANITARIO DEFINIZIONE DEL FABBISOGNO DELLE RISORSE INFERMIERISTICHE, FISIOTERAPISTI, DEL PERSONALE DI SUPPORTO E DEL PERSONALE SANITARIO DELLA RIABILITAZIONE La definizione del fabbisogno delle risorse infermieristiche

Dettagli

Progetto di SIMULTANEOUS HOME CARE del paziente oncologico in fase avanzata di malattia.

Progetto di SIMULTANEOUS HOME CARE del paziente oncologico in fase avanzata di malattia. Progetto di SIMULTANEOUS HOME CARE del paziente oncologico in fase avanzata di malattia. Unità Operativa di Oncologia Ospedale di Circolo e Fondazione Macchi di Varese Area territoriale: Distretto di Varese,

Dettagli

Sistemi Esperti Sviluppati da ENDIF-UNIFE e DEIS- UNIBO

Sistemi Esperti Sviluppati da ENDIF-UNIFE e DEIS- UNIBO Sistemi Esperti Sviluppati da ENDIF-UNIFE e DEIS- UNIBO G. Gamberoni, E. Lamma, F. Riguzzi, S. Storari ENDIF Università di Ferrara P. Mello DEIS Università di Bologna Applicazioni i i in campo medico Collaborazione

Dettagli

Curriculum Vitae di MAURO DALLA TORRE

Curriculum Vitae di MAURO DALLA TORRE Curriculum Vitae di MAURO DALLA TORRE DATI PERSONALI nato a, il ALDENO, 03-04-1956 PROFILO BREVE Responsabile Nucleo Gestione Esercizio del Servizio Sistemi Informativi TITOLI DI STUDIO 16-07-1981 Laurea

Dettagli

Sistema Informativo Territoriale

Sistema Informativo Territoriale Sistema Informativo Territoriale Azienda Provinciale per i Servizi Sanitari di Trento Convegno Nazionale Ospedale, Città e Territorio Verona, 13 15 Settembre 2007 Responsabile Sistemi Informativi leonardo.sartori@apss.tn.it

Dettagli

file://c:\documents and Settings\Valentina\Impostazioni locali\temp\frontpagetempdir\pvwa.htm

file://c:\documents and Settings\Valentina\Impostazioni locali\temp\frontpagetempdir\pvwa.htm Pagina 1 di 3 Indice - Home Alberghi e Hotel L Hotel Byron riconferma la grande tradizione dell'ospitalità Riconoscimenti internazionali per l albergo di Forte dei Marmi Consigli Stagione di successi per

Dettagli

LINEE GUIDA CONDIVISE AZIENDA USL DI BOLOGNA E COMUNE DI BOLOGNA SISTEMA DI SORVEGLIANZA ED ALLERTA IN OCCASIONE DI ONDATE DI CALORE ESTATE 2007

LINEE GUIDA CONDIVISE AZIENDA USL DI BOLOGNA E COMUNE DI BOLOGNA SISTEMA DI SORVEGLIANZA ED ALLERTA IN OCCASIONE DI ONDATE DI CALORE ESTATE 2007 LINEE GUIDA CONDIVISE AZIENDA USL DI BOLOGNA E COMUNE DI BOLOGNA SISTEMA DI SORVEGLIANZA ED ALLERTA IN OCCASIONE DI ONDATE DI CALORE ESTATE 2007 (15 MAGGIO- 30 SETTEMBRE) Premessa L Azienda USL di Bologna

Dettagli

Società Scientifiche

Società Scientifiche Milano, 7 giugno 2006 Un iniziativa sostenuta da Pfizer Società Scientifiche Intervento del Prof. Roberto Bernabei 2006 Ambrosetti S.p.A. TUTTI I DIRITTI RISERVATI. Questo documento è stato ideato e preparato

Dettagli

Management nell Azienda Sanitaria

Management nell Azienda Sanitaria Management nell Azienda Sanitaria Dr. Paolo Menichetti Perugia, ottobre 2011 1. Finanziamento del S.S.N. 2. Management nell azienda sanitaria: budget 3. Management nell azienda sanitaria: controllo direzionale

Dettagli

L infermiere casemanager

L infermiere casemanager L infermiere casemanager Valentina Sangiorgi U.C.S.C. di Roma Policlinico Universitario A.Gemelli Firenze 29-11/1-12-2007 La riorganizzazione delle cure primarie e l integrazione del sistema L aumento

Dettagli

REGIONANDO 2000 PROVINCIA AUTONOMA DI TRENTO. Assessorato alle Politiche sociali e alla salute Servizio Programmazione e Ricerca sanitaria

REGIONANDO 2000 PROVINCIA AUTONOMA DI TRENTO. Assessorato alle Politiche sociali e alla salute Servizio Programmazione e Ricerca sanitaria REGIONANDO 2000 PROVINCIA AUTONOMA DI TRENTO Assessorato alle Politiche sociali e alla salute Servizio Programmazione e Ricerca sanitaria PROGETTO: TELECONSULTO ONCOLOGICO E TELECARDIOLOGIA SUL TERRITORIO

Dettagli

Progetto di prevenzione e gestione del Rischio Clinico ASL Roma B. Dott. Egidio Sesti

Progetto di prevenzione e gestione del Rischio Clinico ASL Roma B. Dott. Egidio Sesti Progetto di prevenzione e gestione del Rischio Clinico ASL Roma B Dott. Egidio Sesti Obiettivo generale Strutturazione di flussi informativi atti alla promozione della qualità dei processi organizzativi

Dettagli

IL MODELLO EFQM IN APSS

IL MODELLO EFQM IN APSS Auditorium del Centro per i Servizi Sanitari giovedì 13.12.2007 IL MODELLO EFQM IN APSS Carlo Favaretti, direttore generale Ospedale S.Chiara la governance il modello EFQM l approccio APSS IL MODELLO EFQM

Dettagli

O.N.DA Milano 17 novembre 2014

O.N.DA Milano 17 novembre 2014 O.N.DA Milano 17 novembre 2014 Miriam Guana Presidente Federazione Nazionale Collegi Ostetriche Caterina Masè - Presidente Collegio Ostetriche Trento PREGRAVIDICO COUNSELLING PRECONCENZIONALE STILI DI

Dettagli

QUALITÀ E SICUREZZA PER I NOSTRI PAZIENTI

QUALITÀ E SICUREZZA PER I NOSTRI PAZIENTI QUALITÀ E SICUREZZA PER I NOSTRI PAZIENTI L ACCREDITAMENTO INTERNAZIONALE ALL ECCELLENZA Fondazione Poliambulanza ha ricevuto nel dicembre 2013 l accreditamento internazionale all eccellenza da parte di

Dettagli

Progetto per l attuazione della Sanità d iniziativa nel territorio dell azienda USL 8 Arezzo

Progetto per l attuazione della Sanità d iniziativa nel territorio dell azienda USL 8 Arezzo Progetto per l attuazione della Sanità d iniziativa nel territorio dell azienda USL 8 Arezzo Premessa Il PSR 2008-2010 prevede lo sviluppo della sanità d iniziativa, intesa come nuovo approccio organizzativo

Dettagli

PROVINCIA DI VICENZA

PROVINCIA DI VICENZA PROVINCIA DI VICENZA Lì, 19/10/2011 Prot.n. 72634 ALLEGATO A alla determinazione dirigenziale n. 914 del 28/09/2011 BANDO PER LA CONCESSIONE DI UN CONTRIBUTO ALLE ASSOCIAZIONI DI STRANIERI PRESENTI NEL

Dettagli

www.hcmschool.it APPROFONDIRE POTENZIARE APPLICARE

www.hcmschool.it APPROFONDIRE POTENZIARE APPLICARE www.hcmschool.it APPROFONDIRE POTENZIARE APPLICARE Sviluppare competenze manageriali innovative per il mondo della Sanità Health Care Management School Il Sistema Sanitario rappresenta uno dei settori

Dettagli

SCHEDULAZIONI RIEPILOGATIVE E CONFRONTO DI: - FASI E ATTIVITA' DEL WBS; - PRODOTTI; - COMPITI; - RISORSE PROFESSIONALI; - EFFORT.

SCHEDULAZIONI RIEPILOGATIVE E CONFRONTO DI: - FASI E ATTIVITA' DEL WBS; - PRODOTTI; - COMPITI; - RISORSE PROFESSIONALI; - EFFORT. Cod. Figure professionali q.tà gg.uu. Riepilogo di Progetto 1.092 SCHEDULAZIONI RIEPILOGATIVE E CONFRONTO DI: - FASI E ATTIVITA' DEL WBS; - PRODOTTI; - COMPITI; - RISORSE PROFESSIONALI; - EFFORT. 001 Comitato

Dettagli

INFORMAZIONI PERSONALI ESPERIENZE LAVORATIVE, ISTRUZIONE E FORMAZIONE. Cognome e Nome. Pegoraro Chiara Data di nascita 28/07/1961

INFORMAZIONI PERSONALI ESPERIENZE LAVORATIVE, ISTRUZIONE E FORMAZIONE. Cognome e Nome. Pegoraro Chiara Data di nascita 28/07/1961 INFORMAZIONI PERSONALI Cognome e Nome Pegoraro Chiara Data di nascita 28/07/1961 Qualifica Amministrazione Incarico attuale In servizio presso l Unità Operativa/Unità Organizzativa Numero telefonico dell

Dettagli

LA SARDEGNA NELL EUROPA 2020

LA SARDEGNA NELL EUROPA 2020 LA SARDEGNA NELL EUROPA 2020 VERSO UN NUOVO MODELLO DI GOVERNANCE Enti Locali e politiche di coesione Project Management per gli EELL Ornella Cauli 8 maggio 2013 Centro Servizi Losa La logica del Project

Dettagli

14 giugno 2013 COMPETENZE E QUALIFICHE DELL INSTALLATORE DI SISTEMI DI SICUREZZA. Ing. Antonio Avolio Consigliere AIPS All right reserved

14 giugno 2013 COMPETENZE E QUALIFICHE DELL INSTALLATORE DI SISTEMI DI SICUREZZA. Ing. Antonio Avolio Consigliere AIPS All right reserved 14 giugno 2013 COMPETENZE E QUALIFICHE DELL INSTALLATORE DI SISTEMI DI SICUREZZA A.I.P.S. Associazione Installatori Professionali di Sicurezza Nata per rispondere alla fondamentale aspettativa degli operatori

Dettagli

Premessa. Il Presidente della Federazione Nazionale ALICE Dr. Giuseppe D Alessandro

Premessa. Il Presidente della Federazione Nazionale ALICE Dr. Giuseppe D Alessandro Premessa L Ictus Cerebrale, pur essendo in Italia la prima causa di invalidità, la seconda di demenza e la terza di morte, non ha ricevuto finora, a differenza di altre malattie altrettanto gravi per l

Dettagli

Importanza dei fattori non-tecnologici per la diffusione del FSE. Angelo Rossi Mori Istituto Tecnologie Biomediche, CNR, Roma

Importanza dei fattori non-tecnologici per la diffusione del FSE. Angelo Rossi Mori Istituto Tecnologie Biomediche, CNR, Roma Importanza dei fattori non-tecnologici per la diffusione del FSE Angelo Rossi Mori Istituto Tecnologie Biomediche, CNR, Roma Mattone Patient File 19 giugno 2007 Principi generali sul Fascicolo Sanitario

Dettagli

SERVIZIO DI ASSISTENZA DOMICILIARE INTEGRATA Stefano Mantovani

SERVIZIO DI ASSISTENZA DOMICILIARE INTEGRATA Stefano Mantovani RUOLO E RESPONSABILITA DEGLI INFERMIERI NELL INSERIMENTO DEGLI OPERATORI DI SUPPORTO NELLE EQUIPE ASSISTENZIALI BRESCIA 7 E 8 OTTOBRE 2013 ESPERIENZA ASCSP MAGENTA SERVIZIO DI ASSISTENZA DOMICILIARE INTEGRATA

Dettagli

COMPITI DEI DIRIGENTI, DEI PREPOSTI E DEI LAVORATORI

COMPITI DEI DIRIGENTI, DEI PREPOSTI E DEI LAVORATORI GRUPPO DI RIFERIMENTO PER LA SALUTE E LA SICUREZZA SUL LAVORO COMPITI DEI DIRIGENTI, DEI PREPOSTI E DEI LAVORATORI REV. DATA 0 8.03.2011 1 24.06.2013 2 3 IL REFERENTE DEL GRUPPO Ing. Alessandro Selbmann

Dettagli

Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva.

Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva. Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva. Mario Saia CIO: Normativa Italiana Circolare Ministeriale 52/1985 Lotta contro

Dettagli

"FONDAMENTI DI PROJECT MANAGEMENT" Cagliari 16 Maggio 2015 Dalle ore 14:00 alle ore 19:00

FONDAMENTI DI PROJECT MANAGEMENT Cagliari 16 Maggio 2015 Dalle ore 14:00 alle ore 19:00 Organizzazione scientifica a cura di AIIC in collaborazione con l'ordine degli ingegneri della provincia di Cagliari "FONDAMENTI DI PROJECT MANAGEMENT" Cagliari 16 Maggio 2015 Dalle ore 14:00 alle ore

Dettagli

Proposta di riorganizzazione della rete sanitaria per il controllo e la. Obiettivi e Strumenti

Proposta di riorganizzazione della rete sanitaria per il controllo e la. Obiettivi e Strumenti Proposta di riorganizzazione della rete sanitaria per il controllo e la cura delle infezioni da HIV nel Lazio Obiettivi e Strumenti Enrico Girardi per il gruppo tecnico HIV LaziozioSanità -ASP UOC Epidemiologia

Dettagli

amministrazione@lopisrl.com - www.lopisrl.com

amministrazione@lopisrl.com - www.lopisrl.com amministrazione@lopisrl.com - www.lopisrl.com APS RRA C LS analisi & problem solving risanamento e riorganizzazione aziendale consulenza logistica strategica WCA servizi web, comunicazione e advertising

Dettagli

La preparazione e la gestione della risposta alle emergenze sanitarie Genova 12-13 Dicembre 2006

La preparazione e la gestione della risposta alle emergenze sanitarie Genova 12-13 Dicembre 2006 La preparazione e la gestione della risposta alle emergenze sanitarie Genova 12-13 Dicembre 2006 Dott.ssa Speranza Sensi ASL 3 Genovese - Regione Liguria SICUREZZA SANITARIA GLOBALE gli impegni assunti

Dettagli

L INFERMIERE IN ONCOLOGIA TRA MANAGEMENT E PRATICA CLINICA: QUALE FUTURO? CASE MANAGEMENT IN ONCOLOGIA

L INFERMIERE IN ONCOLOGIA TRA MANAGEMENT E PRATICA CLINICA: QUALE FUTURO? CASE MANAGEMENT IN ONCOLOGIA L INFERMIERE IN ONCOLOGIA TRA MANAGEMENT E PRATICA CLINICA: QUALE FUTURO? CASE MANAGEMENT IN ONCOLOGIA Lorenza Zullo Napoli 25 maggio 2013 Qual è il soggetto d interesse del case management? Il beneficiario

Dettagli

Pianificazione sanitaria territoriale per l attuazione di procedure ed interventi in occasione di eventi di protezione civile e/o pandemici

Pianificazione sanitaria territoriale per l attuazione di procedure ed interventi in occasione di eventi di protezione civile e/o pandemici Pianificazione sanitaria territoriale per l attuazione di procedure ed interventi in occasione di eventi di protezione civile e/o pandemici G. Barreca Genova 09/06/2010 Provincia di Firenze Servizio Protezione

Dettagli

LA GESTIONE DEL RISCHIO CLINICO: il consenso informato

LA GESTIONE DEL RISCHIO CLINICO: il consenso informato LA GESTIONE DEL RISCHIO CLINICO: il consenso informato LA HARVARD MEDICAL PRACTICE, ATTRAVERSO LA REVISIONE DELLE CARTELLE CLINICHE, HA STIMATO LA PERCENTUALE DI ERRORE NELL ORDINE DEL 3,7% DEI RICOVERI

Dettagli

ACCADEMIA DI PROGETTAZIONE SOCIALE MAURIZIO MAGGIORA

ACCADEMIA DI PROGETTAZIONE SOCIALE MAURIZIO MAGGIORA Un nuovo modo di vivere la progettazione sociale... ACCADEMIA DI PROGETTAZIONE SOCIALE MAURIZIO MAGGIORA Diventare «progettista sociale esperto» Torino, 14 marzo 2013 Agenda Accademia di Progettazione

Dettagli