Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B"

Transcript

1 Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

2 I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno stato non funzionale nella linea germinale Diversi eventi di ricombinazione devono avvenire durante lo sviluppo di ciascun linfocita per rendere funzionali questi geni Ciascun evento richiede l introduzione di doppie rotture nel DNA cromosomico

3 Chromosome localization of Ig loci

4 Sia le catene leggere che le catene pesanti sono codificate da famiglie multi-geniche separate Nel DNA della linea germinale ciascuna famiglia multigenica contiene diverse sequenze codificanti, dette segmenti genici, separate da regioni non codificanti Durante la maturazione dei linfociti B questi segmenti genici vengono riarrangiati Il riarrangiamento crea un esone funzionale corrispondente alla regione variabile

5 La regione V L è codificata da più di un segmento genico La regione variabile della catena leggera (V L ) è codificata da 2 segmenti genici segmento genico V codifica per i primi a.a. segmento genico J codifica per pochi a.a. (fino a 13) Il riarrangiamento dei segmenti V e J crea un esone continuo (VJ) che codifica per l intera regione V L

6 Downloaded from Corrispondenza tra segmenti genici e domini Ig V L C L

7 La regione V H è codificata da più di un segmento genico La regione variabile della catena pesante (V H ) è codificata da 3 segmenti genici segmento genico V segmento genico D segmento genico J Il riarrangiamento dei segmenti V, D e J crea un esone continuo (VDJ) che codifica per l intera regione V H

8 Corrispondenza tra segmenti genici e domini Ig V H C m1 C m2 C m3 C m4

9 Corrispondenza tra segmenti genici e domini Ig V H C m1 C m2 C m3 Cm1 Cm2 Cm3 Cm4 TM Cyt C m4

10 Germline organization of Ig light- and heavy-chain loci in human genome

11

12 DNA catena k germ-line Riarrangiamento catena k V-J joining DNA catena k riarrangiato Trascritto primario catena k Trascrizione

13 Trascritto primario catena k RNA splicing + poliadenilazione mrna catena k Coda poli-a Traduzione Polipeptide nascente catena k Catena k

14 Riarrangiamento catena pesante DNA catena H germ line D-J joining V-DJ joining DNA catena H riarrangiato Trascrizione Trascritto primario

15 Co-espressione di IgM e IgD Nelle cellule B naive il trascritto primario della catena pesante contiene sia gli esoni per i domini costanti della catena m che della d il trascritto primario non contiene esoni per altre catene pesanti (g, e, a) Attraverso lo splicing alternativo vengono prodotti sia mrna per m che per d La cellula B naive co-esprime IgM e IgD con la stessa specificità antigenica stesso esone VDJ per dominio variabile delle catene pesanti m e d catena leggera associata identica Le altre classi di Ig non sono mai co-espresse

16 Trascritto primario catena H splicing alternativo mrna catena H Polipeptide nascente catena H Catena H Catena Hm Catena Hd

17 Recombination Signal Sequence, RSS Accanto a ciascun segmento genico sono presenti delle sequenze dette recombination signal sequences (RSS) 1 RSS è collocata al 3 di ciascun segmento V 1 RSS è collocata al 5 di ciascun segmento J 1 RSS è presente al 5 e un altra al 3 di ciascun segmento D Queste sequenze funzionano da segnali per i processi di ricombinazione

18 Recombination Signal Sequence, RSS Ciascuna RSS contiene NONAMERO: sequenza conservata non codificante di 9 nucleotidi sito di legame per RAG1; ancora le proteine RAG al DNA EPTAMERO: sequenza conservata non codificante di 7 nucleotidi aumenta legame di RAG, specifica sito di taglio eptamero e nonamero sono separati da uno spacer di 12 o 23 paia di basi lo spacer varia di sequenza ma la sua lunghezza è conservata e corrisponde a uno (12 bp) o due (23 bp) giri di DNA doppia elica la lunghezza dello spacer è cruciale per la ricombinazione permette corretta giustapposizione di nonamero ed eptamero

19 Sequenze RSS

20 Regola 12/23 Un segmento genico fiancheggiato da una RSS con uno spacer di 12 bp può ricombinare con un segmento fiancheggiato da uno spacer con 23 bp

21 Il complesso della ricombinasi V(D)J Il complesso di enzimi che opera la ricombinazione somatica V(D)J è detto ricombinasi V(D)J Recombinant-Activating Genes: RAG-1 e RAG-2 i prodotti di questi geni costituiscono la componente della ricombinasi specifica dei linfociti (B e T) necessari per la generazione dei recettori per l antigene topi KO per uno dei due geni Rag non sviluppano linfociti B né T sono espressi durante lo sviluppo dei linfociti solo quando avviene il riarrangiamento dei geni per il recettore dell antigene La ricombinasi V(D)J include anche enzimi espressi ubiquitariamente e coinvolti nella riparazione del DNA DNA ligasi IV, DNA-PK (DNA-dependent protein kinase), Ku70/80, Artemis La ricombinazione avviene alle giunzioni tra le sequenze RSS e le sequenze codificanti

22 Recombinant-Activating Genes: RAG-1 e RAG-2 Proteine nucleari, altamente conservate in vertebrati Costituiscono la componente della ricombinasi specifica dei linfociti (B e T) Necessari per la generazione dei recettori per l antigene Il core di RAG-1 contiene regione per legame a nonamero regione centrale che interagisce con eptamero e RAG2 sito catalitico per taglio DNA

23 Il core di RAG-2 Recombinant-Activating Genes: RAG-1 e RAG-2 è necessario per il taglio del DNA interagisce con RAG1 aumenta l affinità di legame con il DNA RAG2 contiene una regione che lega la lisina 4 trimetilata dell istone H3 (H3K4me3) guidando il complesso RAG nelle regioni di cromatina attiva

24 Fasi della ricombinazione 1 RAG1 e RAG2 riconoscono RSS (alla formazione del complesso partecipano anche altre proteine) le RSS di un segmento V e di uno J sono portate in prossimità Segmento genico V RSS - 1 giro Segmento genico J RSS - 2 giri

25 Fasi della ricombinazione 2 taglio di un filamento di DNA da parte di RAG-1 e RAG-2 alla giunzione delle RSS con le sequenze codificanti tra eptamero e segmento genico codificante Segmento genico V RSS - 1 giro Segmento genico J RSS - 2 giri

26 Downloaded from Fasi della ricombinazione 3 l estremità tagliata del segmento genico codificante, viene unita al filamento opposto producendo una forcina all estremità della RSS, viene prodotta una doppia rottura del DNA Segmento genico V RSS - 1 giro Segmento genico J RSS - 2 giri

27 Ricombinazione 4 Vengono reclutate altre proteine Ku70/Ku80 La forcina viene tagliata in posizione casuale RAG/Artemis l estremità viene poi modificata da esonucleasi TdT (terminal deoxynucleotidyl transferase) Riparo e legame delle sequenze codificanti e di quelle segnale DNA ligasi IV

28 Generazione della diversità anticorpale (GOD, Generation Of Diversity) Molteplici segmenti genici diverse combinazioni V-(D)-J Flessibilità nel processo di giunzione aggiunta e rimozione di nucleotidi Combinazione di catene pesanti e leggere Ipermutazione somatica in linfociti B attivati

29 200 x 6x10 3 = 1.2x x 6x10 3 = 0.72x10 6 = Possibili combinazioni teoriche 1.92x10 6

30 Variabilità Variabilità Variabilità degli aminoacidi nelle Ig Figure 3-6 HV3 ha una variabilità varibilità maggiore di HV1 e HV2 Regione V catena pesante Regione V catena leggera FR, frame region HV, hyper-variable region

31 La regione del DNA dove avviene la giunzione V(D)J codifica per la regione ipervariabile 3 (HV3) che corrisponde al CDR3 HV1 HV2 HV3 HV regions HV1 HV2 HV3

32 Flessibilità nel processo di giunzione: aggiunta e rimozione di nucleotidi Eptamero della RSS Eptamero della RSS l estremità tagliata del segmento genico codificante, viene unita al filamento opposto producendo una forcina (v. diapo precedenti)

33 Flessibilità nel processo di giunzione: aggiunta e rimozione di nucleotidi (P-addition) Quando la forcina viene tagliata si produce un filamento singolo Gli enzimi di riparazione aggiungono nucleotidi complementari a questa sequenza generando una sequenza palindromica P-nucleotidi Variazioni nella posizione del taglio della forcina generano variazioni in questa sequenza

34 Flessibilità nel processo di giunzione: aggiunta e rimozione di nucleotidi (N-addition) Durante la ricombinazione D-J e V-DJ, la terminal deoxynucleotidyl transferase (TdT) aggiunge fino a 15 nucleotidi a entrambi le giunzioni D-J e V-DJ. I nucleotidi aggiunti generano sequenze randomiche La N-addition contribuisce largamente alla variabilità del CDR3 della catena pesante La N addition si verifica quasi esclusivamente nella catena pesante

35 Downloaded from

36 Diversità totale (combinazioni V(D)J e catene L/H + diversità giunzioni N/P addition) Ig TCRab Tuttavia, un individuo ha un repertorio di circa 10 7 cloni B e T

37

38 Esclusione allelica Ciascuna cellula B esprime i geni riarrangiati della catena pesante di un solo cromosoma e i geni riarrangiati della catena leggera di un solo tipo (k o l) e di un solo cromosoma esclusione allelica Assicura che una cellula B funzionale esprima una sola catena pesante e una sola leggera una sola specificità antigenica

39 Esclusione allelica in singole cellule B Ceppo di aplotipo a/a per la catena pesante delle Ig Ceppo di aplotipo b/b per la catena pesante delle Ig Ibrido F1 di aplotipo a/b per la catena pesante delle Ig I due aplotipi diversi sono espressi in cellule diverse

Riarrangiamento genico

Riarrangiamento genico Riarrangiamento genico 1 3 quesiti per la comprensione Ø l esistenza nello stesso anticorpo di una parte variabile ed una costante; Ø l esistenza della enorme variabilità (diversità) del sito combinatorio;

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Sviluppo dei linfociti B

Sviluppo dei linfociti B Sviluppo dei linfociti B Checkpoints multipli nella maturazione dei linfociti Durante lo sviluppo i linfociti che esprimono recettori per l antigene funzionali sono selezionati e sopravvivono, gli altri

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

1.4 ORGANIZZAZIONE DEI GENI DELLE IG E DEL TCR... 12 1.4.1 Immunoglobuline... 14 1.4.2 TCR... 15

1.4 ORGANIZZAZIONE DEI GENI DELLE IG E DEL TCR... 12 1.4.1 Immunoglobuline... 14 1.4.2 TCR... 15 INTRODUZIONE... 4 CAPITOLO 1:... 5 GENETICA DELLE IMMUNOGLOBULINE E DEL T-CELL RECEPTOR... 5 1.1 INTRODUZIONE... 5 1.2 LA RISPOSTA IMMUNITARIA... 6 1.3 STRUTTURA MOLECOLARE DELLE IG E DEL TCR... 8 1.3.1

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

LA DIAGNOSI DEI LINFOMI MALIGNI ATTRAVERSO TECNICHE DI BIOLOGIA MOLECOLARE

LA DIAGNOSI DEI LINFOMI MALIGNI ATTRAVERSO TECNICHE DI BIOLOGIA MOLECOLARE LA DIAGNOSI DEI LINFOMI MALIGNI ATTRAVERSO TECNICHE DI BIOLOGIA MOLECOLARE Dott.ssa Cristina Colarossi Anatomia Patologica Istituto Oncologico del Mediterraneo Catania Linfomi I Linfomi sono malattie monoclonali

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Università di Roma Tor Vergata - Corso di Laurea in Scienze Biologiche - Immunologia Molecolare - dott. Claudio PIOLI - a.a.

Università di Roma Tor Vergata - Corso di Laurea in Scienze Biologiche - Immunologia Molecolare - dott. Claudio PIOLI - a.a. Anticorpi generalità Riconoscimento antigene Anticorpi Molecole MHC Recettore per l Ag dei linfociti T (TCR) Anticorpi riconoscono diversi tipi di strutture antigeniche macromolecole proteine, lipidi,

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Molecole che riconoscono gli antigeni nei Linfociti

Molecole che riconoscono gli antigeni nei Linfociti Molecole che riconoscono gli antigeni nei Linfociti Il riconoscimento dell antigene è altamente specifico Immunoglobuline: Libere (Anticorpi), prodotte dai Linfociti B Legate alla membrana dei Linfociti

Dettagli

RICONOSCIMENTO DELL ANTIGENE: IMMUNOGLUBULINE TCR COMPLESSO MAGGIORE DI ISTOCOMPATIBILITA PROCESSAZIONE E PRESENTAZIONE DELL ANTIGENE

RICONOSCIMENTO DELL ANTIGENE: IMMUNOGLUBULINE TCR COMPLESSO MAGGIORE DI ISTOCOMPATIBILITA PROCESSAZIONE E PRESENTAZIONE DELL ANTIGENE RICONOSCIMENTO DELL ANTIGENE: IMMUNOGLUBULINE TCR COMPLESSO MAGGIORE DI ISTOCOMPATIBILITA PROCESSAZIONE E PRESENTAZIONE DELL ANTIGENE IMMUNOGLUBULINE TCR COMPLESSO MAGGIORE DI ISTOCOMPATIBILITA (MHC) PROCESSAZIONE

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Tipi di immunità acquisita. www.uniroma2.it/didattica/immunotlb

Tipi di immunità acquisita. www.uniroma2.it/didattica/immunotlb Tipi di immunità acquisita Caratteristiche dell immunità acquisita Espansione clonale Fasi della risposta immunitaria acquisita Specificità, memoria, risoluzione delle risposte immunitarie acquisite Immunità

Dettagli

Presentazione dell antigene tramite TCR

Presentazione dell antigene tramite TCR Presentazione dell antigene tramite TCR Elena Adinolfi Il recettore della cellula T (TCR) Il TCR è il recettore per l antigene delle cellule T. In maniera analoga a quanto accade per le cellule B ad ogni

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

TCR e maturazione linfociti T

TCR e maturazione linfociti T TCR e maturazione linfociti T Il recettore per l Ag dei linfociti T, T-Cell Receptor (TCR) eterodimero composto da catene a e b o g e d TCR a/b presente in 95% delle cellule T periferiche eterodimero legato

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Sviluppo dei linfociti B

Sviluppo dei linfociti B Sviluppo dei linfociti B ATTENZIONE: questi file compresi testo ed immagini in essi contenuti sono destinati esclusivaemnte agli studenti del corso per favorirne lo studio. Nessun file, che potrebbe contenere

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Il sistema immunitario

Il sistema immunitario 1 Il sistema immunitario COMPONENTI MOLECOLARI E CELLULARI. Meccanismi e caratteristiche delle risposte immunitarie; Risposte umorali e cellulari; Teoria della selezione clonale; Versatilità, specificità

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

TCR e maturazione linfociti T

TCR e maturazione linfociti T ATTENZIONE: questi file compresi testo ed immagini in essi contenuti sono destinati esclusivamente agli studenti del corso per favorirne lo studio. Nessun file, che potrebbe contenere materiale soggetto

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Regione cerniera monomero regione cerniera

Regione cerniera monomero regione cerniera Regione cerniera Tutte le Ig, sia quelle secrete che quelle presenti sulla membrana plasmatica dei linfociti B, sono costituite da quattro catene proteiche, due pesanti (H, da heavy, in rosso nel disegno)

Dettagli

Le Ig sono glicoproteine costituite da 4 catene polipeptidiche:

Le Ig sono glicoproteine costituite da 4 catene polipeptidiche: Struttura delle Ig Le Ig sono glicoproteine costituite da 4 catene polipeptidiche: 2 catene pesanti H (heavy( heavy) di P.M. 50.000 D, formate da c/a 450 amminoacidi 2 catene leggere L (light) Di P.M.

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

Recettori per gli antigeni

Recettori per gli antigeni Recettori 1 TM U U Recettori della morte Tirosina-chinasi Serina-Treonina-chinasi Con attività chinasica intrinseca Recettori per gli antigeni Recettori per citochine Recettori per gli Senza antigeni attività

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Ruolo dei test di clonalità nei disordini linfoproliferativi

Ruolo dei test di clonalità nei disordini linfoproliferativi XIX CORSO NAZIONALE PER TECNICI DI LABORATORIO BIOMEDICO Riccione, 22-25 Maggio 2012 Ruolo dei test di clonalità nei disordini linfoproliferativi Dr.ssa Claudia Mannu Laboratorio di Patologia Molecolare,

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

KIR EVOLUZIONE RAPIDA E DIVERSIFICATA DEI RECETTORI DELL IMMUNITA INNATA E ADATTATIVA

KIR EVOLUZIONE RAPIDA E DIVERSIFICATA DEI RECETTORI DELL IMMUNITA INNATA E ADATTATIVA KIR EVOLUZIONE RAPIDA E DIVERSIFICATA DEI RECETTORI DELL IMMUNITA INNATA E ADATTATIVA C.Vilches, P. Parham Natural Killer Cellule di origine linfoide la cui funzione è lisare le cellule infettate da virus

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Mutazioni Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Le mutazioni possono essere spontanee oppure causate da agenti fisici, chimici

Dettagli

Macromolecole Biologiche. I domini (III)

Macromolecole Biologiche. I domini (III) I domini (III) Domini α/β La cross over connection è l unità costitutiva su cui si basa la topologia di 3 tipi di domini α/β osservati nelle proteine: - α/β barrel - motivi ricchi di Leu (fold a ferro

Dettagli

Classi e sottoclassi di anticorpi

Classi e sottoclassi di anticorpi Classi e sottoclassi di anticorpi Anticorpi: classi e sottoclassi In base alla catena pesante gli anticorpi sono divisi in classi e sottoclassi Classi o isotipi IgA, IgD, IgE, IgG, IgM Sottoclassi IgA1

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

La Malattia Minima Residua nelle Sindromi Linfoproliferative Acute e Croniche.

La Malattia Minima Residua nelle Sindromi Linfoproliferative Acute e Croniche. Dipartimento di Biotecnologie Cellulari ed Ematologia Sezione di Ematologia DOTTORATO DI RICERCA IN SCIENZE EMATOLOGICHE XXVI CICLO Coordinatore Prof. Robin Foà TESI DI DOTTORATO La Malattia Minima Residua

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

Selezione clonale I cloni di linfociti si sviluppano prima ed in modo indipendente dall esposizione all antigene

Selezione clonale I cloni di linfociti si sviluppano prima ed in modo indipendente dall esposizione all antigene Selezione clonale I cloni di linfociti si sviluppano prima ed in modo indipendente dall esposizione all antigene Repertorio anticorpale individuale: 10^11 Il repertorio anticorpale è generato da: RICOMBINAZIONE

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene I linfociti T sono le cellule dell immunità adattativa responsabili della protezione verso le infezioni ad opera dei microbi intracellulari. Essi derivano da cellule staminali del midollo osseo che si

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli