RNA polimerasi operone. L operatore è il tratto

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "RNA polimerasi operone. L operatore è il tratto"


1 La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato. Altre proteine vengono prodotte solo quando sono necessarie: in questo caso il controllo dell attività genica è molto preciso. Sebbene il controllo dell espressione genica possa avvenire sia durante la che in fase di traduzione o di post-traduzione, nei procarioti esso si verifica prevalentemente a livello di, con l attivazione o inattivazione dei geni. Le proteine indispensabili alla cellula in tutto il ciclo cellulare sono codificate da geni, detti geni costitutivi, che non richiedono un controllo particolarmente sofisticato, dato che devono essere sempre attivi. Al contrario, l attività di altri geni strutturali deve essere regolata in modo preciso e rapido. Il modello che spiega la regolazione della nei procarioti si chiama operone, la cui descrizione è riportata in figura. direzione della operone Il gene regolatore codifica le proteine regolatrici della (repressori). Sul cromosoma esso può trovarsi anche a grande distanza dai geni che controlla. Il promotore è il tratto di dove si attacca l enzima RNA polimerasi al momento della. L operatore è il tratto di dove può attaccarsi il repressore codificato dal gene regolatore. Quando il repressore si lega all operatore, l non può trascrivere l mrna; quando il repressore non è legato all operatore, la procede regolarmente. I geni strutturali codificano le proteine. Nei procarioti i geni strutturali con funzioni correlate sono allineati sulla molecola di. I meccanismi di azione del repressore sono di due tipi. 1. In alcuni operoni, il repressore blocca stabilmente l operatore e viene rimosso esclusivamente quando giunge dall esterno una molecola specifica chiamata induttore. L induttore disattiva il repressore. 2. Il repressore entra in azione soltanto in presenza di un corepressore, molecola che lo rende capace di legarsi all operatore. Il corepressore attiva il repressore. In entrambi i casi, la presenza dell induttore o del corepressore, determina un cambiamento della forma del repressore e ne modifica la capacità di legarsi all operatore. La regolazione prima della Negli eucarioti, i meccanismi di regolazione della sono più complessi di quelli che abbiamo visto per i procarioti, e comprendono anche la possibilità di modulare l intensità della. Negli organismi eucarioti pluricellulari, inoltre, la regolazione genica è alla base del differenziamento cellulare: le cellule somatiche di un individuo, infatti, pur condivi- 1

2 Procarioti Eucarioti Livello di regolazione Soprattutto durante la Prima, durante e dopo la e la traduzione Siti regolatori Promotore Promotore e sequenze di controllo supplementari Coordinazione dell espressione genica Tipi di Interazioni Operone Unica Lega direttamente promotore Elementi di controllo comuni I (trascrive rrna) II (trascrive geni strutturali) III (trascrive trna) Lega promotore e diversi fattori di (forma un complesso di ) dendo lo stesso patrimonio genetico, lo esprimono in modo differenziato a seconda della funzione che svolgono. Sebbene il processo di proceda in modo analogo nei procarioti e negli eucarioti, tra i due gruppi esistono alcune differenze che hanno ripercussioni importanti sulle modalità di regolazione dell espressione dei geni. Negli eucarioti alcuni meccanismi di regolazione genica possono intervenire prima che un gene venga trascritto nel corrispondente mrna. Questi meccanismi si basano su una modifica della struttura della cromatina. L impacchettamento del può essere tale da impedire all e alle proteine del complesso di di legarvisi e iniziare la. Osservando al microscopio una cellula eucariotica durante l interfase è possibile distinguere due tipi di cromatina: l eucromatina, dispersa nel nucleo e poco colorata; l eterocromatina, più condensata e colorata intensamente. Vari studi hanno dimostrato che l eucromatina corrisponde al che viene trascritto in RNA, mentre l eterocromatina contiene geni che di solito non vengono trascritti. Un esempio di eterocromatino si osserva nelle cellule somatiche delle femmine dei mammiferi, dove sono presenti due cromosomi X, uno attivo e uno inattivo. Il cromosoma X inattivo si presenta (durante l interfase) condensato in una massa di eterocromatina, chiamata corpo di Barr. La regolazione durante la Nei procarioti la può essere effettuata oppure bloccata, ma non può essere aumentata o diminuita come invece accade nelle cellule eucariotiche. La differenziale dei geni è uno dei modi con cui gli eucarioti variano la quantità di proteine prodotte a seconda delle necessità cellulari. La differenziale dei geni negli eucarioti è possibile grazie all esistenza di particolari sequenze di e di specifiche proteine: due sequenze regolatrici poste a monte del promotore alle quali si legano proteine regolatrici che hanno il compito di attivare il complesso di (formato dai fattori di e dall II, quello che trascrive i geni strutturali); sequenze amplificatrici poste a una certa distanza dal promotore, alle quali si legano delle proteine attivatrici, che hanno il compito di stimolare ulteriormente il comples- 2

3 so di (il modo in cui agiscono le sequenze amplificatrici non è ancora del tutto noto); sequenze silenziatrici che bloccano la grazie al legame con alcune proteine che vengono chiamate repressori. Al contrario di quanto avviene nel dei procarioti, i geni degli eucarioti, i cui prodotti hanno una correlazione funzionale, non sono raggruppati negli operoni. Ciò rende più complessa la loro regolazione: per poter essere trascritti contemporaneamente questi geni devono contenere le stesse sequenze di regolazione, in grado di legarsi alle stesse proteine regolatrici. Per aumentare la produzione di una certa rispetto ad altre, le cellule possono ricorrere all amplificazione genica. Questo processo consiste nella creazione di più copie dello stesso gene che vengono tutte trascritte. promotore Aumentando la velocità di, la cellula aumenta anche la velocità di sintesi della. La regolazione dopo la Molti geni contengono al loro interno anche sequenze di nucleotidi non codificanti (chiamate introni). Gli introni sono intervallati ai tratti codificanti, detti esoni. I geni formati da introni ed esoni sono definiti geni interrotti. Il numero e la lunghezza degli introni e degli esoni varia da gene a gene. In genere la lunghezza degli introni è 8-10 volte maggiore di quella degli esoni. Gli introni sono stati scoperti attraverso alcuni esperimenti di ibridazione mrna-. Il gene per l ovoalbumina contiene 8 esoni. Ciascun esone specifica una porzione della. I numeri tra parentesi indicano quanti nucleotidi sono presenti in ciascun esone. I geni interrotti iniziano e finiscono sempre con un esone. esone 1 (47) sito di legame della regolatrice sequenza amplificatrice attivatrice complesso di regolatrice attivatrice regolatrice A B C D E F G esone 2 (185) esone 3 (51) esone 4 (129) esone 5 (118) esone 6 (143) esone 7 (156) sito di legame del complesso di fattori di sito di legame dell regione trascritta Il si ripiega e le proteine attivatrici legate a una sequenza amplificatrice si trovano a contatto con il complesso di amplificandone l azione. esone 8 (1043) Gli introni, indicati con le lettere maiuscole, nel gene per l ovoalbumina sono 7. Il gene interrotto che codifica per l ovoalbumina, una presente nell albume d uovo, è formato da 7700 coppie di basi. 3

4 unità 3. Il controllo dell espressione genica che cosa vede il biologo A C D F B G E mrna per ovoalbumina Fotografia al microscopio elettronico di un filamento singolo di (che contiene il gene che codifica per l ovoalbumina), ibridato con l mrna per questa. L mrna per l ovoalbumina si appaia solo a certi tratti del gene dal quale è stato trascritto. I tratti di che non si appaiano all mrna formano delle «anse» (indicate con le lettere maiuscole) che corrispondono agli introni. Quando un gene interrotto viene trascritto, l mrna corrispondente, detto pre-mrna, contiene anche gli introni. Prima di lasciare il nucleo per essere trasferito nel citoplasma dove avviene la traduzione, il pre-mrna va incontro a un processo di maturazione che consiste nel taglio degli introni e nella congiunzione degli esoni. Tale processo, chiamato splicing dell RNA, richiede l intervento di particolari complessi molecolari, detti snrnp costituiti da rrna e proteine. L espressione di un gene può essere regolata anche dopo che è stato trascritto, attraverso il processo detto splicing alternativo. Questo processo consiste nell eliminazione selettiva di alcuni esoni, oltre che degli introni: grazie a questo meccanismo da uno stesso gene eucariotico è possibile ottenere trascritti differenti e di conseguenza sintetizzare proteine diverse a partire dalla medesima informazione genetica. La regolazione durante e dopo la traduzione La regolazione della produzione delle proteine può avvenire anche dopo che l mrna è stato trascritto e rielaborato. I controlli traduzionali sono meccanismi di regolazione dell espressione genica che intervengono dopo che l mrna è migrato dal nucleo al citoplasma, al momento della traduzione di una. Uno di questi meccanismi consiste nell impedire temporaneamente che l mrna si attacchi ai ribosomi, modificando chimicamente la configurazione della sequenza di inizio della traduzione. Un altro metodo richiede la presenza di una, che viene chiamata repressore della traduzione, la quale si lega all mrna quando la da esso codificata è già presente nel citoplasma in quantità sufficiente. Il repressore viene disattivato quando la cellula ha la necessità di riprendere la sintesi di quella. I meccanismi di regolazione che intervengono dopo che una è stata tradotta riguardano essenzialmente il tempo di permanenza della stessa all interno della cellula. L azione della viene limitata attraverso la sua degradazione o apportando modifiche chimiche alla sua struttura in modo da alterarne la funzionalità. Il meccanismo che attiva la degradazione di una è il seguente: un enzima (lisina) favorisce il legame tra la bersaglio da demolire e una chiamata ubiquitina; 4

5 unità 3. Il controllo dell espressione genica altre molecole di ubiquitina si legano alla precedente. Si forma il complesso poliubiquitina; il complesso -poliubiquitina si lega a sua volta a un proteasoma, una grossa struttura proteica che presenta al suo interno un cilindro cavo; all ingresso nel proteasoma l ubiquitina si stacca, la bersaglio cambia forma e viene digerita da tre diverse proteasi (proteine idrolizzanti). La bersaglio viene ridotta in piccoli frammenti peptidici e in singoli amminoacidi. Il complesso «-poliubiquitina» viene riconosciuto da un proteosoma. Tre proteasi contenute del proteosoma digeriscono la. ubiquitina Una lisina lega la da demolire all ubiquitina. proteasoma Proteina che deve essere demolita. 5

6 1 Completa la figura dell'operone: direzione della Il... codifica le proteine regolatrici della (... ). Sul cromosoma esso può trovarsi anche a grande distanza dai geni che controlla. Il... è il tratto di dove si attacca l enzima RNA polimerasi al momento della. L... è il tratto di dove può attaccarsi il repressore codificato dal gene regolatore. Quando il repressore si lega all operatore, l non può trascrivere l mrna; quando il repressore non è legato all operatore, la procede regolarmente. I... codificano le proteine. Nei procarioti i geni strutturali con funzioni correlate sono allineati sulla molecola di. 2 Completa la figura sulla regolazione dei geni coordinati. gene per la regolatrice traduzione SRE promotore SRE SRE gene A gene B gene C mrna 6

7 3 Completa le seguenti frasi scegliendo i termini corretti tra quelli indicati nei corrispondenti riquadri. A. In alcuni operoni dei procarioti, il blocca stabilmente l operatore e viene rimosso solo quando si lega con una molecola specifica detta. In altri casi invece una molecola esterna detta legandosi al repressore lo attiva e ne permette il funzionamento. corepressore, regolatore, complesso di, repressore, corpo di Barr, induttore B. Nelle cellule delle femmine dei mammiferi è presente un cromosoma attivo e uno inattivo. Quello inattivo si presenta condensato in una massa di, inaccessibile al complesso di. In questo modo i questo cromosoma detto non vengono trascritti. presenti su X, Y, Z, geni, RNA, introni, esoni, eucromatina, eterocromatina, operone lac, corpo di Barr C. Per aumentare la produzione di una rispetto ad altre, le cellule possono ricorrere all massima velocità. genica, ovvero alla creazione di più copie di uno stesso, che vengono poi tutte contemporaneamente alla sequenza,, regolazione, amplificazione, eucromatina, introne, gene, trascritte, tradotte D. Molti geni contengono al loro interno delle sequenze di nucleotidi non codificanti, dette, alternate a sequenze codificanti dette. Questi geni sono detti geni. e sono stati scoperti grazie alla tecnica dell esoni, introni, operoni, sequenze amplificatrici, interrotti, strutturali, splicing dell RNA, traduzione del, ibridazione mrna- E. Quando un gene interrotto viene trascritto la cellula produce un RNA detto che contiene ancora gli. Questi vengono successivamente eliminati nel citoplasma e gli vengono uniti tra loro grazie al processo di. Tale processo viene compiuto da particolari complessi molecolari, detti, e costituiti da proteine e da RNA ribosomiale. rrna, pre-mrna, snrnp, operoni, esoni, introni, splicing, spliceosoma 7

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici


www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello





Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO


La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.



LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione





Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici


Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.


eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni


David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi


Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti


La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle



TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi


Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma


DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni





LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?


Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi


SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)


LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e





Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,



LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:



LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.



CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO





Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,


RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso


Passiamo ora in rassegna i meccanismi di controllo nelle due principali suddivisioni di esseri viventi.

Passiamo ora in rassegna i meccanismi di controllo nelle due principali suddivisioni di esseri viventi. La regolazione dell espressione dei geni. (prof. Paolo Marchesi)..siete pregati di non divulgare questo materiale senza il consenso dell autore, grazie.. Problema: Il DNA di una cellula contiene i geni



IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune


Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante


Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri


Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie


Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra


Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando


LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami


Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso


Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo


MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)


Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,


La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.


Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e


unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie



IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena


Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti Dall RNA alle proteine La traduzione nei procarioti e negli eucarioti Codice genetico La sequenza dell mrna viene decodificata a gruppi di tre nucleotidi, e tradotta in una sequenza di amminoacidi 4 x


Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare)

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare) Il checkpoint del fuso mitotico (Pietro Perini-gruppo ciclo cellulare) 1) Prima di approfondire la funzione del checkpoint del fuso mitotico, è opportuno ricordare quali sono le caratteristiche e le funzioni


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere



TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione





Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto





Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi
