Stem Cells. Medicine Biology. Bioethics

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Stem Cells. Medicine Biology. Bioethics"

Transcript

1 Stem Cells Medicine Biology Bioethics

2 Dal DNA all organismo complesso Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico I cromosomi sono in coppia Ogni cromosoma è una lunga molecola di DNA e i geni sono regioni funzionali su questa molecola Il DNA è una doppia elica Tutte le cellule di un individuo hanno lo stesso DNA. Ma non sono tutte uguali! Combinazione di geni on e off = identità cellulare

3

4 What are the molecular bases of differentiation?

5 Differentiation as an Epigenetic Phenomenon Epigenetic Landscape Conrad Hal Waddington (1940)

6 Regolazione dell espressione genica Prodotti dei geni necessari al metabolismo cellulare (housekeeping): sempre presenti Prodotti degli altri geni: regolati Come si attua questa regolazione?

7 Trascrizione Maturazione RNA Trasporto RNA nel citoplasma Stabilità mrna Traduzione Stabilità proteine

8 Negli eucarioti, prima di passare nel citoplasma, l RNA deve essere modificato mediante una serie di eventi noti come processo di maturazione dell RNA - Aggiunta del cappuccio al 5 (guanina + 2 gruppi metilici (sito di inizio traduzione) - Processamento degli introni - Aggiunta coda poli-a al 3

9 Maturazione dell RNA Dall RNA devono essere allontanate le sequenze introniche con un processo chiamato splicing

10 Trascrizione Maturazione RNA Trasporto RNA nel citoplasma introni presenti: no trasporto Stabilità mrna Controllo code polia Rimozione CAP Traduzione Accorciamento code polia e riallungamento Stabilità proteine ubiquitinazione

11 Trascrizione Fattori trascrizionali Basali (legati ai promotori) Speciali (legati agli enhancer) Struttura della cromatina aperta o chiusa

12 Epigenetics and Chromatin

13 Bivalent Chromatin Domains Differentiation Pluripotency Genes Activity Differentiation Genes Activity

14 Stem Cells: at the crossroad between self-renew and differentiation Differentiation Stem Cell Differentiated Cell Stem Cell

15 Cellule differenziate: Combinazione di geni attivi o inattivi non modificabile Si duplicano un numero ridotto di volte (o non si duplicano più) dando origine sempre allo stesso tipo di cellule Cellule staminali: Cellule non specializzate in grado di dividersi per lunghi periodi dando origine a diversi tipi di cellule

16 Cellule Staminali 1. Non svolgono alcuna funzione specifica, come cellule del sangue, muscolari o nervose, ma possono diventare ciascuna di esse 2. Una popolazione di cellule staminali può proliferare in laboratorio per molti mesi, rimanendo indifferenziata: autorinnovamento 3. Differenziamento guidato da segnali intracellulari (attivazione specifica di geni) ed extracellulari (molecole secrete da cellule vicine o presenti nel mezzo)

17

18 Asymmetric division Two sisters with different fates size, morphology gene expression pattern number of subsequent divisions

19 Two mechanisms: 1. response to extracellular signals (extrinsic mechanism) 2. cell autonomously (intrinsic mechanism) 1. response to extracellular signals From: Knoblich JA. Cell 132: , 2008

20 Stem Cell Niches Example: HSC (Hsu and Fuchs, 2012)

21 Polarized mother cell capable of segregating specific factors called determinants into one of its daughter cells to initiate a particular developmental pathway in this cell but not its sister. Four steps From: Ahringer, Curr. Opin. Cell Biol. 15:73-81, 2003

22 Spindle orientation and Slicening of a cake Vertical slice = 2 pieces of equal size and content Horizontal slice = 2 pieces of unequal size and content Symmetric division Asymmetric division From: Kaltschmidt and Brand, J. Cell Sci. 115:

23 Asymmetric divisions of Drosophila neuroblasts From: Bonaccorsi et al., Nature CellBiol2: 54-56

24 Proteins involved in asymmetric cell division identified in D. melanogaster

25 Proteins involved in asymmetric cell division identified in C. elegans

26

27 Cellule Staminali Embrionali: totipotenti o pluropotenti Provengono dalla inner cell mass di embrioni di 4-5 giorni (blastocisti) prodotti in vitro Adulte: multipotenti Cellule indifferenziate mescolate ad altre differenziate in un dato tessuto o organo necessarie per mantenere e/o riparare i tessuti

28 Embryonic Stem Cells Embryonic Stem Cells derive from the early embryo. Blastocyst ICM Inner Cell Mass Embryonic Stem Cells

29

30 Adult Stem Cells Adult Stem Cells are present in (some) organs during our entire lifetime. They are able to regenerate our tissues. Prometeus Ἧπαρ (liver) is derived from ἠπάοµαι (repair). (Thanks to A. Musarò!)

31 Adult Stem Cells Adult Stem Cells are multipotent or unipotent. Satellite Cell Differentiation Muscle Fiber

32 Adult Stem Cells Some examples of Adult Stem Cells: - Hematopoietic Stem Cells - Muscle Stem Cells (satellite cells) - Skin Stem Cells

33 Adult Stem Cells Adult Stem Cells are multipotent or unipotent. Satellite Cell Differentiation Muscle Fiber

34 Differentiation as an Epigenetic Phenomenon Epigenetic Landscape Conrad Hal Waddington (1940)

35 Reprogramming the Epigenome At the GENETIC level an embryonic cell is identic to an adult cell (with very few exceptions). Genes are not lost, gained or modified during differentiation. If this is true, we could reprogram the EPIGENETIC state of the cell to bring it back to an embryonic state.

36 Somatic Cell Nuclear Transfer (SCNT) and Cell Fusion These experiments clearly showed that some sort of Reprogramming Factors is present in the cytoplasm of the egg and of the embryonic stem cells. Such factors can reprogram a somatic nucleus to an embryonic stem cell-like state.

Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the

Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the 1 2 3 Le cellule staminali dell embrione: cosa possono fare Embryonic stem cells are exciting because they can make all the different types of cell in the body scientists say these cells are pluripotent.

Dettagli

Cellule Staminali. Arti Ahluwalia

Cellule Staminali. Arti Ahluwalia Cellule Staminali Arti Ahluwalia Le Proprietà di cellule staminali Capacita di auto rinnovarsi (self-renewal) Capacità di differenziarsi lungo almeno una linea (potency) The cell which results from the

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

Il differenziamento cellulare

Il differenziamento cellulare Liceo Classico M. Pagano Campobasso Docente: prof.ssa Patrizia PARADISO Allieve (cl. II sez. B e C): BARONE Silvia Antonella DI FABIO Angelica DI MARZO Isabella IANIRO Laura LAUDATI Federica PETRILLO Rosanna

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Cellule staminali pluripotenti indotte: definizione e applicazioni Caterina Pipino, PhD

Cellule staminali pluripotenti indotte: definizione e applicazioni Caterina Pipino, PhD Cellule staminali pluripotenti indotte: definizione e applicazioni Caterina Pipino, PhD Department of Medical, Oral and Biotechnological Sciences University G. d'annunzio, Aging Research Center, Ce.S.I.,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

COME SI DEFINISCE IL FENOTIPO DIFFERENZIATO? Lezioni dallo sviluppo embrionale: con Tre meccanismi fondamentali INDUZIONE, INIBIZIONE LATERALE e

COME SI DEFINISCE IL FENOTIPO DIFFERENZIATO? Lezioni dallo sviluppo embrionale: con Tre meccanismi fondamentali INDUZIONE, INIBIZIONE LATERALE e NOTA BENE!! COME SI DEFINISCE IL FENOTIPO DIFFERENZIATO? Lezioni dallo sviluppo embrionale: con Tre meccanismi fondamentali INDUZIONE, INIBIZIONE LATERALE e DETERMINANTI CITOPLASMATICI. BY CELL-CELL COMUNICATION=INDUCTION

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Cellule, tessuti, organi ed apparati

Cellule, tessuti, organi ed apparati LE CELLULE UMANE Il corpo umano contiene circa 100 000 miliardi di cellule che si uniscono a formare i tessuti e più tessuti formano organi come i muscoli, il cervello, il fegato, ecc. EMBRIOLOGIA-UNIPG

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni Perché ci troviamo oggi a parlare delle cellule staminali? Driesch (fine 800) dimostra la totipotenza dei blastomeri dell embrione embrione

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI

DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI DIFFERENZIAMENTO DELLE CELLULE MUSCOLARI Testi di riferimento: Alberts B. et al. Biologia molecolare della cellula - Ed. Zanichelli Gilbert S.F. Biologia dello sviluppo - Ed. Zanichelli COS E UNA CELLULA

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Cellule staminali: evoluzione e rivoluzione della medicina moderna

Cellule staminali: evoluzione e rivoluzione della medicina moderna Cellule staminali: evoluzione e rivoluzione della medicina moderna Le cellule staminali (SC), embrionali (ES) e somatiche o adulte (SSC) sono cellule dotate della singolare proprietà di rinnovarsi mantenendo

Dettagli

L ORIGINE DEI TESSUTI

L ORIGINE DEI TESSUTI L ORIGINE DEI TESSUTI Tutte le cellule dell organismo derivano dallo zigote Embrioni di topo a diversi stadi di sviluppo: A, stadio a 2 pronuclei; E, stadio a circa 16 cellule B, stadio a 2 blastomeri;

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Differenziamento = Creazione cellule specializzate. Il tuo corpo ha bisogno delle cellule staminali

Differenziamento = Creazione cellule specializzate. Il tuo corpo ha bisogno delle cellule staminali Differenziamento = Creazione cellule specializzate Cos è una cellula staminale? Cosa mostra la foto Un pezzo di metallo e molti diversi tipi di viti. Dare origine a diversi tipi di cellule è un processo

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

St S e t m e Ce C l e l l s l

St S e t m e Ce C l e l l s l StemCells Tutte le cellule di un organismo hanno lo stesso genoma (originano tutte dallo zigote) Le differenze tra i diversi tipi cellulari dipendono dalle diverse proteine che li costituiscono dall espressione

Dettagli

Michaela Luconi, PhD

Michaela Luconi, PhD Michaela Luconi, PhD Unità di Endocrinologia Laboratorio di Biologia Cellulare dell Organo Adiposo Dipartimento di Scienze Biomediche Sperimentali & Cliniche «Mario Serio» michaela.luconi@unifi.it COSA

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

UNIVERSITA DEGLI STUDI DI PALERMO Dipartimento Biomedico di Medicina Interna e Specialistica

UNIVERSITA DEGLI STUDI DI PALERMO Dipartimento Biomedico di Medicina Interna e Specialistica UNIVERSITA DEGLI STUDI DI PALERMO Dipartimento Biomedico di Medicina Interna e Specialistica Dottorato di Ricerca in Genomica e Proteomica delle malattie oncologiche ed endocrino-metaboliche XXIV Ciclo

Dettagli

«Vita, morte e miracoli della cellula staminale»

«Vita, morte e miracoli della cellula staminale» «Vita, morte e miracoli della cellula staminale» Prof.ssa Gabriella Vannelli Sezione di Anatomia Umana e Istologia Dipartimento di Medicina Sperimentale e Clinica Firenze, 13 marzo 2015 Il lungo e affascinante

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti

Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti I tessuti studio dei tessuti: è compito dell I STOLOGIA (dal greco istos, tela e logos, discorso). I tessuti UN TESSUTO: è formato

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Tumore (gonfiore) o neoplasia (nuova crescita):

Tumore (gonfiore) o neoplasia (nuova crescita): Tumore (gonfiore) o neoplasia (nuova crescita): *popolazione cellulare di nuova formazione che ha preso origine quasi sempre da una sola cellula somatica dell organismo, colpita da una serie sequenziale

Dettagli

Fonti di cellule staminali pluripotenti: Le cellule staminali possiedono 2 caratteristiche principali: -La massa cellulare interna della blastocisti.

Fonti di cellule staminali pluripotenti: Le cellule staminali possiedono 2 caratteristiche principali: -La massa cellulare interna della blastocisti. possiedono 2 caratteristiche principali: Fonti di cellule staminali pluripotenti: -Si autorinnovano a lungo termine. -Danno origine a tutti i tipi di cellule differenziate. -La massa cellulare interna

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

L'ultima parte del differenziamento, che si compie dopo che è cessata l'attività proliferativa, si definisce differenziamento terminale.

L'ultima parte del differenziamento, che si compie dopo che è cessata l'attività proliferativa, si definisce differenziamento terminale. Il differenziamento è il processo mediante il quale una cellula diventa diversa dalla sua progenitrice e dalle altre cellule figlie della stessa progenitrice. L'ultima parte del differenziamento, che si

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

CORSO INTEGRATO DI GENETICA. Cellule Staminali e Medicina Rigenerativa

CORSO INTEGRATO DI GENETICA. Cellule Staminali e Medicina Rigenerativa CORSO INTEGRATO DI GENETICA AA 2010/11 Prof Alberto Turco Martedi 14 dicembre 2010 Lezioni 55 e 56 Cellule Staminali e Medicina Rigenerativa Early human preimplantation development in vitro Pronuclear-stage

Dettagli

Differenziamento Cellule Staminali

Differenziamento Cellule Staminali Differenziamento Cellule Staminali Differenziamento Tutte le cellule hanno funzioni di base Respirazione, crescita, divisione, sintesi La maggior parte ha inoltre delle capacità particolari 200 differenti

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE Aa 2013/2014. Lezioni 59,60,61,62

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE Aa 2013/2014. Lezioni 59,60,61,62 CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE Aa 2013/2014 Giov 12 e Merc 18.12.2013 Lezioni 59,60,61,62 Prof.A.Turco CELLULE STAMINALI E MEDICINA RIGENERATIVA (da stamen, filo della vita..) CELLULE

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

L'ultima parte del differenziamento, che si compie dopo che è cessata l'attività proliferativa, si definisce differenziamento terminale.

L'ultima parte del differenziamento, che si compie dopo che è cessata l'attività proliferativa, si definisce differenziamento terminale. Il differenziamento è il processo mediante il quale una cellula diventa diversa dalla sua progenitrice e dalle altre cellule figlie della stessa progenitrice. L'ultima parte del differenziamento, che si

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants DISS. ETH NO. 19590 Epithelial-Mesenchymal Transition in Cancer Relevance of Periostin Splice Variants A dissertation submitted to the ETH Zurich For the degree of Doctor of Sciences Presented by Laura

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

Meccanobiologia in medicina rigenerativa

Meccanobiologia in medicina rigenerativa LABORATORY OF BIOLOGICAL STRUCTURE MECHANICS www.labsmech.polimi.it Meccanobiologia in medicina rigenerativa Manuela T. Raimondi Dipartimento di Chimica, Materiali e Ingegneria Chimica Giulio Natta Politecnico

Dettagli

Gametogenesi. Dott.ssa Maria Rosa Guglielmino

Gametogenesi. Dott.ssa Maria Rosa Guglielmino Gametogenesi Dott.ssa Maria Rosa Guglielmino La gametogenesi è quel processo per mezzo del quale, nell embrione in fase di sviluppo, le cellule germinali capostipiti migrano nelle gonadi per moltiplicarsi

Dettagli

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni Perché ci troviamo oggi a parlare delle cellule staminali? Driesch (fine 800) dimostra la totipotenza dei blastomeri dell embrione precoce

Dettagli

Pluripotent Stem CellsiPSCs

Pluripotent Stem CellsiPSCs La scoperta delle induced Pluripotent Stem CellsiPSCs e la riprogrammazione cellulare La storia della vita L ABC delle cellule staminali Cosa sono le cellule staminali? cellule dei tessuti cellula staminale

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare.

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Nelle cellule in proliferazione le 4 fasi impiegano dalle 10 20 ore in dipendenza

Dettagli

ANIMALI TRANSGENICI : come si producono???

ANIMALI TRANSGENICI : come si producono??? ANIMALI TRANSGENICI : come si producono??? GFP Vettori retrovirali Microiniezione del DNA Cellule staminali embrionali Gene targeting/ gene trap KO condizionali Trasferimento del nucleo YAC KO costitutivi

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

CELLULE STAMINALI E MEDICINA RIGENERATIVA (I e II parte)

CELLULE STAMINALI E MEDICINA RIGENERATIVA (I e II parte) CORSO INTEGRATO DI GENETICA E BIOL.MOLECOLARE AA 2012/13 Prof Alberto Turco Lezioni 57-60 12 e 13.12.2012 CELLULE STAMINALI E MEDICINA RIGENERATIVA (I e II parte) Early human preimplantation development

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Cellule, tessuti, organi ed apparati

Cellule, tessuti, organi ed apparati LE CELLULE UMANE Il corpo umano contiene circa 100 000 miliardi di cellule che si uniscono a formare i tessuti e più tessuti formano organi come i muscoli, il cervello, il fegato, ecc. EMBRIOLOGIA-UNIPG

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Vengono definiti STATI DI PRE EMBRIONE i seguenti: 2 cellule: ZIGOTE

Vengono definiti STATI DI PRE EMBRIONE i seguenti: 2 cellule: ZIGOTE Vengono definiti STATI DI PRE EMBRIONE i seguenti: cavità blastocelica ICM 2 cellule: ZIGOTE 8 16 cellule: MORULA: inizia la sintesi attiva di RNA e proteine trofectoderma BLASTOCISTI 32 64 cellule: BLASTOCISTI:

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

-malattie monogeniche o mendeliane:

-malattie monogeniche o mendeliane: Martedì 16 Febbraio è venuta nella nostra classe la dr.ssa Petrelli Maria a spiegarci le malattie sessualmente trasmissibili e ereditarie, sessualità e affettività. Ci ha spiegato la divisione delle cellule

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

CELL L U L LE L S TA T MIN I ALI

CELL L U L LE L S TA T MIN I ALI CELLULE STAMINALI APPLICAZIONI TERAPEUTICHE Maurilio Sampaolesi Gabriele Ceccarelli LESSON 2 Corso ANATOMIA UMANA Specialistica (2013-2014) 2014) Stem cells and Parkinsons disease Fondazione Michael J.

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA aa 2014/15 CELLULE STAMINALI E MEDICINA RIGENERATIVA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA aa 2014/15 CELLULE STAMINALI E MEDICINA RIGENERATIVA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA aa 2014/15 16 e 17.12.2014 Lezioni 59-62 Prof.A.Turco CELLULE STAMINALI E MEDICINA RIGENERATIVA Early human preimplantation development in vitro

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Conoscenza delle tecniche per studiare le cellule in coltura

Conoscenza delle tecniche per studiare le cellule in coltura Corso di Laurea in Biotecnologie Tecnologie per linee cellulari e staminali Docente: Grazyna Ptak Ricevimento: per appuntamento; contatto: e-mail: gptak@unite.it Obiettivo del corso: Conoscenza delle tecniche

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

Breve presentazione dei momenti più interessanti e significativi che hanno caratterizzato questa esperienza.

Breve presentazione dei momenti più interessanti e significativi che hanno caratterizzato questa esperienza. Nell ambito del progetto GENETICA e DNA sono stati studiati gli aspetti della medicina rigenerativa in riferimento alle cellule staminali. Il 24 aprile 2012 ci siamo recati presso il Dipartimento di Istologia

Dettagli

Figure Molecular Biology of the Cell ( Garland Science 2008)

Figure Molecular Biology of the Cell ( Garland Science 2008) Figure 22-24 Molecular Biology of the Cell ( Garland Science 2008) Figure 22-25 Molecular Biology of the Cell ( Garland Science 2008) Figure 22-28a Molecular Biology of the Cell ( Garland Science 2008)

Dettagli

Cellule Staminali e Clonazione (terapeutica)

Cellule Staminali e Clonazione (terapeutica) Cellule Staminali e Clonazione (terapeutica) Arti Ahluwalia Percentage of papers dedicated to stem cells in the journal Tissue Engineering, since its inception in 1995. By the end of this decade, 50% of

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

CELLULE STAMINALI APPLICAZIONI TERAPEUTICHE

CELLULE STAMINALI APPLICAZIONI TERAPEUTICHE CELLULE STAMINALI APPLICAZIONI TERAPEUTICHE Maurilio Sampaolesi LESSON 2 Corso ANATOMIA UMANA Specialistica (2011-2012) PROGRAMMA Introduzione alle cellule staminali: cellule staminali embrionali ed adulte

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti NUCLEO Il nucleo è la centrale operativa che controlla i vari processi che si svolgono dentro la cellula. Contiene il materiale genetico DNA e proteine. Quando la cellula è a riposo il DNA è sotto forma

Dettagli

Cos è la clonazione? Dal greco: klon, germoglio. La possibilità di duplicare il patrimonio genetico di una struttura molecolare (essere vivente)

Cos è la clonazione? Dal greco: klon, germoglio. La possibilità di duplicare il patrimonio genetico di una struttura molecolare (essere vivente) La CLONAZIONE Cos è la clonazione? Dal greco: klon, germoglio La possibilità di duplicare il patrimonio genetico di una struttura molecolare (essere vivente) Perchè clonare? Finalità della clonazione animale

Dettagli

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV

Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV Alterata regolazione del ciclo cellulare: un nuovo meccanismo patologico coinvolto nella deplezione delle cellule T CD4+ nell infezione da HIV ADULTS AND CHILDREN ESTIMATED TO BE LIVING WITH HIV/AIDS,

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

MITOSI E MEIOSI (MITOSIS & MEIOSIS)

MITOSI E MEIOSI (MITOSIS & MEIOSIS) MITOSI E MEIOSI (MITOSIS & MEIOSIS) MITOSI e MEIOSI sono due processi di divisione cellulare che, con modalità differenti, portano alla formazione di nuove cellule. MITOSI. La mitosi consente la formazione,

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Le cellule staminali: una risorsa..una speranza

Le cellule staminali: una risorsa..una speranza AVIS NAZIONALE/REGIONALE MARCHE Ancona, 31 Ottobre 2008 Il Sistema Trasfusionale tra necessità e disponibilità Le cellule staminali: una risorsa..una speranza Prof.ssa Gabriella Girelli Sapienza Università

Dettagli