Interazioni proteina-dna

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Interazioni proteina-dna"

Transcript

1 Interazioni proteina-dna 1) Proteine che legano la doppia elica del DNA in maniera non sequenza-specifica: histone-like proteins (HU protein) 2) Proteine che legano strutture particolari del DNA: - single strand DNA-binding proteins (SSBP); - proteine che legano sequenze ricche in A/T (es. H-NS, IHF, chromosome organizers ) 3) Proteine che legano sequenze specifiche I PLASMIDI Molti batteri oltre al cromosoma contengono molecole di DNA più piccole (da 1-2,000 a ,000 pdb), dette plasmidi. Queste molecole non sono indispensabili per le funzioni fondamentali del batterio (ceppi della stessa specie possono esserne privi). I plasmidi sono generalmente molecole di DNA circolare e superavvolto. I plasmidi replicano indipendentemente dal cromosoma del batterio, anche se necessitano del medesimo macchinario enzimatico del cromosoma perché avvenga la loro replicazione. Funzioni codificate dai plasmidi I plasmidi possono codificare per diverse funzioni che conferiscono al batterio nuove proprietà: RESISTENZA AD ANTIBIOTICI E, SOSTANZE TOSSICHE, RADIAZIONI CAPACITA DI PRODURRE ANTIBIOTICI, TOSSINE, FATTORI DI VIRULENZA NUOVE CAPACITA METABOLICHE 1

2 Il meccanismo di inizio di replicazione dei plasmidi ne controlla il numero di copie Ma tornando al cromosoma batterico.. Perché è così importante il DNA? Perché contiene l informazione genetica.. Un gene da un punto di vista genetico : GENE= unità fondamentale dell informazione genetica Tipicamente un gene corrisponde ad una proteina (o ad un RNA con funzione specifica) Un gene da un punto di vista biochimico : Sequenze di DNA che, una volta trascritte e tradotte contengono l informazione minima necessaria per la produzione di una proteina specifica Il genoma batterico medio Genoma=insieme dei geni di un organismo Un batterio come Escherichia coli possiede un genoma di bp circa che codifica per circa 4300 geni 1 gene medio=1000 nucleotidi (regioni non-codificanti escluse) 2

3 Genoma = insieme dei geni di un organismo Mappatura = identificazione di elementi genici Sequenziamento genomico Il DNA contiene l informazione genica di un organismo, contenuta nelle sue specifiche sequenze nucleotidiche. Conoscere la sequenza di un genoma (l insieme dei geni di un organismo) ci permette di avere importanti informazioni sulla sua biologia. A tutt oggi (10/10/2013) sono state rese disponibili le sequenze di microrganismi (+ virus=4200, eucarioti=1600) Fonte: Interpretazione delle sequenze di DNA AATAAAAATTTAACTCAATTTGTATCAAAAAATAACAGAAATCTAGCAGTTTTTGTAT TTTATTTTTAAATTGAGTTAAACATAGTTTTTTATTGTCTTTAGATCGTCAAAAACATA TTGCTGCTGGTGCTGCAATGGCTGATGAAGCTGTTGTTCATGACAGTTATGCATTCG AACGACGACCACGACGTTACCGACTACTTCGACAACAAGTACTGTCAATACGTAAGC 3

4 Che cosa ci permette di identificare le sequenze codificanti (cioè i geni) da una sequenza di DNA? Risposta: Dalla nostra conoscenza del codice genetico! AUG e GUG (ATG e GTG nel DNA) è il codone di inizio per la sintesi proteica UAA (TAA), UAG (TAG) e UGA (TGA) sono i codoni di stop Concetto di Open Reading Frame (ORF) Una Open Reading Frame, cioè una lunga sequenza di codoni in frame rappresenta un potenziale gene 924 paia di basi ATG CGA ATA AAT TTC GCA CAA...GGC TAC TAA Met Arg Ile Asn Phe Ala Gln..Gly Tyr STOP 307 amino acidi 4

5 Sequenze codificanti e non-codificanti nel genoma batterico = 1000 bp Geni: CDS= Coding Sequences ORF= Open Reading Frames N.B.: nei microrganismi le sequenze geniche non presentano interruzioni (es. da sequenze introniche) Operoni: gruppi di geni parte di una unica unità trascrizionale L organizzazione di geni in operoni è tipica dei procarioti (Bacteria ed Archea) e molto meno frequente in Eukarya. Il numero di geni presenti in un operone è variabile (2-15 geni) Generalmente i geni di un operone codificano per proteine con funzioni correlate tra loro (es. enzimi di una stessa via metabolica) Siti di risorse genomiche Colibri ( Ecocyc ( Craig Venter Institute 5

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Basi della diversità genetica nei microrganismi. Mutazioni. Mutazioni spontanee 07/01/2015

Basi della diversità genetica nei microrganismi. Mutazioni. Mutazioni spontanee 07/01/2015 Basi della diversità genetica nei microrganismi Fluidità dell informazione genica: Mutazioni e trasferimento orizzontale Mutazioni Le mutazioni possono avvenire spontaneamente in seguito ad errori di incorporazione

Dettagli

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale

Dettagli

Dal gene alla proteina

Dal gene alla proteina Dal gene alla proteina Il collegamento tra geni e proteine La trascrizione e la traduzione sono i due principali processi che legano il gene alla proteina: uno sguardo panoramico Le informazioni genetiche

Dettagli

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La

Dettagli

Biologia Molecolare. CDLM in CTF La riparazione del DNA

Biologia Molecolare. CDLM in CTF La riparazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La riparazione del DNA I tipi di mutazione e le conseguenze Le classi di danno al DNA Meccanismi di riparazione La necessità di codificare l informazione L informazione

Dettagli

DNA Proteine Cellule. Il DNA contiene l informazione per sintetizzare le proteine. proteine cellule. Essere vivente. geni

DNA Proteine Cellule. Il DNA contiene l informazione per sintetizzare le proteine. proteine cellule. Essere vivente. geni Sintesi Proteica DNA Proteine Cellule Il DNA contiene l informazione per sintetizzare le proteine geni Essere vivente proteine cellule Essere vivente Il DNA si tiene tutta la gloria, Le proteine fanno

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

Importanza della genetica dei microrganismi

Importanza della genetica dei microrganismi Importanza della genetica dei microrganismi 1.I microrganismi rappresentano un mezzo essenziale per comprendere la genetica di tutti gli organismi. 2.Vengono usati per isolare e duplicare specifici geni

Dettagli

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

SINTESI DELLE PROTEINE

SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

Codice Genetico (segue)

Codice Genetico (segue) CODICE GENETICO Nucleotidi, acidi nucleici CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. Consiste

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

07/01/2015. La trasposasi induce l escissione del trasposone. Importanza dei trasposoni come fonte di diversità genetica

07/01/2015. La trasposasi induce l escissione del trasposone. Importanza dei trasposoni come fonte di diversità genetica La trasposasi induce l escissione del trasposone In maniera dipendente da segnali ambientali o dalla replicazione della cellula batterica, l espressione della trasposasi può essere attivata e portare al

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO http://www.atdbio.com/img/articles/rna wobble base pairs large.png CODICE GENETICO Codice mediante il quale la sequenza nucleotidica

Dettagli

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE?

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE? DNA E PROTEINE NUMEROSI DATI SUGGERISCONO CHE IL DNA SVOLGA IL SUO RUOLO GENETICO CONTROLLANDO LA SINTESI DELLE PROTEINE, IN PARTICOLARE DETERMINANDONE LA SEQUENZA IN AMINOACIDI E NECESSARIO RISPONDERE

Dettagli

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi GENOMA EVOLUZIONE CONTENUTO FUNZIONE STRUTTURA Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine Progetti genoma in centinaia di organismi Importante la sintenia tra i genomi The

Dettagli

Espressione della informazione genetica II: trascrizione e traduzione

Espressione della informazione genetica II: trascrizione e traduzione Espressione della informazione genetica II: trascrizione e traduzione Prof.ssa Flavia Frabetti aa.2010-11 Come si esprime l informazione? Se il gene in esame è una regione di DNA che ha la funzione di

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

Espressione della informazione genetica II: trascrizione e traduzione

Espressione della informazione genetica II: trascrizione e traduzione Espressione della informazione genetica II: trascrizione e traduzione Prof.ssa Flavia Frabetti Come si esprime l informazione? I meccanismi di Trascrizione e Traduzione Cosa è il Codice genetico I principali

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi)

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi) enhancer promotore regione trascritta TATA trascrizione 5 3 splicing mrna 5 3 traduzione Proteina NH2 COOH Funzione biologica TRADUZIONE I tre ruoli svolti dall RNA: 1. Messaggero 2. Transfer (legato agli

Dettagli

1) Un gene-un enzima 2) Un gene- una catena polipeptidica

1) Un gene-un enzima 2) Un gene- una catena polipeptidica 1) Un gene-un enzima 2) Un gene- una catena polipeptidica 3) Un gene è una unità funzionale di DNA che codifica per la sequenza amminoacidica di uno o più polipeptidi o alternativamente per uno o più tipi

Dettagli

IL CODICE GENETICO E I CARATTERI EREDITARI

IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi

Dettagli

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA.

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Il progetto Genoma Umano è iniziato nel 1990. E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Progetto internazionale finanziato da vari paesi, affidato

Dettagli

AUG CODON DI INIZIO LA TRIPLETTA AUG CODIFICA PER L AMINOACIDO METIONINA, MA RAPPRESENTA ANCHE IL CODON DI INIZIO

AUG CODON DI INIZIO LA TRIPLETTA AUG CODIFICA PER L AMINOACIDO METIONINA, MA RAPPRESENTA ANCHE IL CODON DI INIZIO AUG CODON DI INIZIO LA TRIPLETTA AUG CODIFICA PER L AMINOACIDO METIONINA, MA RAPPRESENTA ANCHE IL CODON DI INIZIO IL SUO RUOLO E ESSENZIALE, DAL MOMENTO CHE DETERMINA LA DEFINIZIONE DELLA CORNICE DI LETTURA

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

L organizzazione del genoma. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

L organizzazione del genoma. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie L organizzazione del genoma L organizzazione del genoma Fino ad ora abiamo studiato la regolazione dell espressione genica prendendo come esempio singoli geni dei batteri. Ma quanti geni ci sono in un

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

I telomeri. In molti eucarioti le estremità dei cromosomi presentano delle sequenze ripetitive: i telomeri.

I telomeri. In molti eucarioti le estremità dei cromosomi presentano delle sequenze ripetitive: i telomeri. I telomeri 1 I telomeri In molti eucarioti le estremità dei cromosomi presentano delle sequenze ripetitive: i telomeri. A ogni duplicazione la cellula perde una porzione del DNA telomerico, fino a quando

Dettagli

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza di aminoacidi. Come le mutazioni

Dettagli

Il TRAFERIMENTO GENICO E LA RICOMBINAZIONE GENETICA. I batteri possiedono anche materiale genetico Extra-cromosomale.

Il TRAFERIMENTO GENICO E LA RICOMBINAZIONE GENETICA. I batteri possiedono anche materiale genetico Extra-cromosomale. Il TRAFERIMENTO GENICO E LA RICOMBINAZIONE GENETICA I batteri possiedono anche materiale genetico Extra-cromosomale FAGI e PLASMIDI rappresentano elementi genetici, di piccole e grandi dimensioni, che

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2017/2018 ati in Bioinformatica ocente: Raffaella Rizzi 1 Outline ü Cos è un NA genomico e un RNA? Outline

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Biochimica: le biomolecole. 1 I carboidrati B2. Per saperne di più. Anomeria e mutarotazione. Per saperne di più. I diastereoisomeri

Biochimica: le biomolecole. 1 I carboidrati B2. Per saperne di più. Anomeria e mutarotazione. Per saperne di più. I diastereoisomeri Indice B1 B2 le biomolecole l energia e gli enzimi 1 I carboidrati B2 Anomeria e mutarotazione I diastereoisomeri Green Chemistry Da rifiuti a risorse: le biomasse B6 B11 B12 2 I lipidi B13 Le vitamine

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

DNA: Struttura e caratteristiche

DNA: Struttura e caratteristiche DNA: Struttura e caratteristiche Il DNA è un acido nucleico formato da monomeri detti nucleotidi. Ogni nucleotide è formato da: Zucchero pentoso (desossiribosio) Gruppo fosfato Base azotata Basi azotate:

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Codice genetico CODICE GENETICO [1]

Codice genetico CODICE GENETICO [1] Codice genetico CODICE GENETICO [1] Codice mediante il quale la sequenza nucleotidica di una molecola di DNA, tramite un mrna, specifica la sequenza amminoacidica di un polipeptide. Consiste di codoni

Dettagli

Escherichia coli. Applicazioni biotecnologie con microrganismi procarioti. Una delle speci batteriche più biotecnologica è senza dubbio

Escherichia coli. Applicazioni biotecnologie con microrganismi procarioti. Una delle speci batteriche più biotecnologica è senza dubbio Applicazioni biotecnologie con microrganismi procarioti Escherichia coli, Bacillus subtilis con altri batteri appartenenti ai generi Pseudomonas, Rhizobium, Lactobacillus possono essere usati: - piani

Dettagli

Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January

Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January 1 Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January 2009. 2 3 4 Il gene della proteina repressore ed il

Dettagli

Allineamento dei 2 RNA

Allineamento dei 2 RNA La traduzione 2 codone Allineamento dei 2 RNA anticodone Studi Molecolari hanno dimostrato che: 3 residui nucleotidici del mrna sono necessari per codificare ciascun amminoacido Il linguaggio contenuto

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie Lezione 1 Il clonaggio 2 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi

Dettagli

Bioinformatica. Analisi del genoma

Bioinformatica. Analisi del genoma Bioinformatica Analisi del genoma GABRIELLA TRUCCO CREMA, 5 APRILE 2017 Cosa è il genoma? Insieme delle informazioni biologiche, depositate nella sequenza di DNA, necessarie alla costruzione e mantenimento

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Genetica batterica Materiale genetico presente nella cellula batterica Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Nucleoide (morfologia) È costituito da un unica unica molecola

Dettagli

Struttura ed espressione del Gene

Struttura ed espressione del Gene Struttura ed espressione del Gene PowerPoint Lectures for Essential Biology, Third Edition Neil Campbell, Jane Reece, and Eric Simon Essential Biology with Physiology, Second Edition Neil Campbell, Jane

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA Il Codice Genetico The genetic code consists of 64 triplet codons (A, G, C, U) 4 3 = 64 all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA AUG (methionine)

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA. Controllo trascrizionale in E. coli. Esempio: Lac operon

REGOLAZIONE DELL ESPRESSIONE GENICA. Controllo trascrizionale in E. coli. Esempio: Lac operon REGOLAZIONE DELL ESPRESSIONE GENICA Controllo trascrizionale in E. coli Esempio: Lac operon Nel genoma di un batterio ci sono circa 4000 geni Nel genoma umano ci sono circa 25000 geni. Espressione costitutiva:

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957 IL FLUSSO DELL INFORMAZIONE GENETICA DNA à RNA à PROTEINA Dogma centrale della biologia molecolare di Francis Crick, 1957 DNA/RNA (seq polinucleotidica) DNA à RNA mrna trna rrna RNA à PROTEINA Proteina

Dettagli

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica Il Codice Genetico La decodifica della sequenza nucleotidica in sequenza aminoacidica La sequenza del mrna viene letta a gruppi di 3 nucleotidi, senza interruzioni e senza sovrapposizioni; 4 3 = 64 ---------64

Dettagli

Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2016/2017 I dati in Bioinformatica Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

PROCARIOTI VS EUCARIOTI ANATOMIA CELLULARE COMPARATA ORGANIZZAZIONE DEL GENOMA E DEI CROMOSOMI REGOLAZIONE DELL ESPRESSIONE GENICA

PROCARIOTI VS EUCARIOTI ANATOMIA CELLULARE COMPARATA ORGANIZZAZIONE DEL GENOMA E DEI CROMOSOMI REGOLAZIONE DELL ESPRESSIONE GENICA PROCARIOTI VS EUCARIOTI ANATOMIA CELLULARE COMPARATA ORGANIZZAZIONE DEL GENOMA E DEI CROMOSOMI REGOLAZIONE DELL ESPRESSIONE GENICA CELLULE PROCARIOTICHE ED EUCARIOTICHE Eucariota: vero nucleo Procariota:

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Trascrizione dell RNA e Traduzione delle Proteine

Trascrizione dell RNA e Traduzione delle Proteine Trascrizione dell RNA e Traduzione delle Proteine 7 1 Flusso dell informazione genetica Dogma centrale 7 2 7 3 7 4 RNA differisce da DNA per: -zucchero, ribosio -zucchero non DEOSSI -basi azotate -a singolo

Dettagli

Corso di laurea magistrale in. Scienze per la diagnostica e conservazione dei beni culturali

Corso di laurea magistrale in. Scienze per la diagnostica e conservazione dei beni culturali Corso di laurea magistrale in Scienze per la diagnostica e conservazione dei beni culturali Insegnamento di Microbiologia applicata ai beni culturali RIEPILOGO DEI CONCETTI BASE DELLA MICROBIOLOGIA GENERALE

Dettagli

Il processo di regolazione dell espressione genica è critico per tutti gli organismi.

Il processo di regolazione dell espressione genica è critico per tutti gli organismi. Il processo di regolazione dell espressione genica è critico per tutti gli organismi. Le abitudini alimentari di ciascun individuo determinano completamente i nutrienti a disposizione di E. coli: esso

Dettagli

C.L. in TECNICHE DI FISIOPATOLOGIA CARDIOCIRCOLATORIA E PERFUSIONE CARDIOVASCOLARE C.I. Medicina Microbiologica AA Genetica batterica

C.L. in TECNICHE DI FISIOPATOLOGIA CARDIOCIRCOLATORIA E PERFUSIONE CARDIOVASCOLARE C.I. Medicina Microbiologica AA Genetica batterica C.L. in TECNICHE DI FISIOPATOLOGIA CARDIOCIRCOLATORIA E PERFUSIONE CARDIOVASCOLARE C.I. Medicina Microbiologica AA 2011-2012 Genetica batterica Giovanni Di Bonaventura, PhD, B.Sc. Genoma batterico Il genoma

Dettagli

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA The genetic code consists of 64 triplet codons (A, G, C, U) 4 3 = 64 all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA AUG (methionine) is the start codon

Dettagli

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- odice genetico- Traduzione dl Infermieristica aa. 2011/12 Prof.ssa Frabetti ESPRESSIONE

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Corso di Genetica -Lezione 12- Cenci

Corso di Genetica -Lezione 12- Cenci Corso di Genetica -Lezione 12- Cenci Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza

Dettagli

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA Corso di Laurea in Chimica e Tecnologie Farmaceu,che a.a. 2014-2015 Università di Catania Il Codice Gene,co Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del

Dettagli

Biotecnologie. Screening delle genoteche con le sonde geniche

Biotecnologie. Screening delle genoteche con le sonde geniche Biotecnologie Screening delle genoteche con le sonde geniche Giancarlo Dessì http://www.giand.it Licenza Creative Commons BY-NC-SA (BY: attribuzione, NC: uso non commerciale, SA: condividi allo stesso

Dettagli

I meccanismi di catalisi della sintesi di DNA e RNA sono identici

I meccanismi di catalisi della sintesi di DNA e RNA sono identici I meccanismi di catalisi della sintesi di DNA e RNA sono identici U U OH Ribo-nucleotide trifosfato TRASCRIZIONE La RNA polimerasi è totalmente processiva Non ha bisogno di innesco Inizia a livello di

Dettagli

Autonoma valutazione delle informazioni su argomenti e problemi biologici fornite dai mezzi di comunicazione di massa

Autonoma valutazione delle informazioni su argomenti e problemi biologici fornite dai mezzi di comunicazione di massa Anno scolastico 2017-2018 Classe 5 sez I Docente Ferrari Biancamaria Disciplina SCIENZE NATURALI- BIOLOGIA MOLECOLARE FINALITA DISCIPLINARI Fornire gli strumenti per conoscere le strutture e le funzioni

Dettagli

Lezione 2. Le molecole di base che costituiscono la vita

Lezione 2. Le molecole di base che costituiscono la vita Lezione 2 Le molecole di base che costituiscono la vita Graur and Li: Capitolo 1 5 3 Le molecole dell ereditarietà L informazione ereditaria di tutti gli organismi viventi, con l eccezione di alcuni virus,

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?

Dettagli

Produzione di Proteine Ricombinanti. pet-22b(+)

Produzione di Proteine Ricombinanti. pet-22b(+) Produzione di Proteine Ricombinanti pet-22b(+) 1 2 3 Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January

Dettagli

Regolazione dell espressione genica nei procarioti: OPERONI

Regolazione dell espressione genica nei procarioti: OPERONI Regolazione dell espressione genica nei procarioti: OPERONI LA REGOLAZIONE DELL ESPRESSIONE GENICA HA LUOGO A LIVELLO DELLA TRASCRIZIONE OPERONE: insieme di geni che vengono trascritti contemporaneamente

Dettagli

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine da sequenze del DN definite geni. Si tratta di un processo a più fasi Nelle sue linee fondamentali questo processo

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

piccoli e semplici procarioti, distinti dal punto di vista fenotipico (dagli

piccoli e semplici procarioti, distinti dal punto di vista fenotipico (dagli 1. INTRODUZIONE 1.1 Generalità sui micoplasmi I micoplasmi (dal greco muces, fungo; plasma, forma ) sono i più piccoli e semplici procarioti, distinti dal punto di vista fenotipico (dagli altri procarioti)

Dettagli

Marina Grasso S.C. Laboratorio di Genetica Umana E.O.Ospedali Galliera Genova

Marina Grasso S.C. Laboratorio di Genetica Umana E.O.Ospedali Galliera Genova Marina Grasso S.C. Laboratorio di Genetica Umana E.O.Ospedali Galliera Genova L Informazione contenuta nel è rappresentata dalla sequenza di 4 basi A T C T G A A T T C G A T A T C A T A G A C T T A A G

Dettagli

Lezione 2. costituiscono la vita

Lezione 2. costituiscono la vita Lezione 2 Le molecole di base che costituiscono la vita Graur Gau and Li: Capitolo o 1 Graur lectures 5 6 7 5 3 Le molecole dell ereditarietà L informazione i ereditaria i di tutti ttigli organismi iviventi,

Dettagli

informazione ed espressione genica

informazione ed espressione genica a.a. 2015-16 CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata informazione ed espressione genica Biologia Applicata_M.Greco 1 ACIDI NUCLEICI (DNA, RNA) Gli acidi nucleici trasmettono

Dettagli

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento III Regolazione espressione genica

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento III Regolazione espressione genica Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento III Regolazione espressione genica CdL Infermieirstica aa. 2011/12 Prof.ssa Frabetti Controllo o regolazione

Dettagli

La genetica batterica: Trasformazone, Coniugazione e Trasduzione

La genetica batterica: Trasformazone, Coniugazione e Trasduzione La genetica batterica: Trasformazone, Coniugazione e Trasduzione Prof. Renato Fani Lab. di Evoluzione Microbica e Molecolare Dip.to di Biologia Evoluzionistica,Via Romana 17-19, Università di Firenze,

Dettagli

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE BIOLOGIA MOLECOLARE DEGLI EUCARIOTI Roberto Giacominelli Stuffler 1. I geni ed il DNA degli eucarioti 2. La replicazione, la trascrizione e la

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI La tecnologia del DNA ricombinante è molto complessa dal punto di vista operativo, ma dal punto di vista concettuale si basa su criteri

Dettagli

un introduzione dei viventi 1 I composti organici C2 2 Gli idrocarburi saturi C6 Green Chemistry Biodiesel: un combustibile da fonti rinnovabili

un introduzione dei viventi 1 I composti organici C2 2 Gli idrocarburi saturi C6 Green Chemistry Biodiesel: un combustibile da fonti rinnovabili Indice C1 B1 Chimica Lo studio organica: un introduzione dei viventi le biomolecole 1 I composti organici C2 2 Gli idrocarburi saturi C6 Green Chemistry Biodiesel: un combustibile da fonti rinnovabili

Dettagli

Il genoma dei batteri

Il genoma dei batteri Il genoma dei batteri Trovare mutazioni nei geni batterici Mutazioni che colpiscono la morfologia della colonia, Mutazioni che conferiscono resistenza agli agenti battericidi Mutazioni che creano auxotrofi

Dettagli

MECCANISMI DI CONTROLLO TRASCRIZIONALI E TRADUZIONALI

MECCANISMI DI CONTROLLO TRASCRIZIONALI E TRADUZIONALI LEZIONE VI MECCANISMI DI CONTROLLO TRASCRIZIONALI E TRADUZIONALI Dott. Paolo Cascio Un principio fondamentale della biologia molecolare della cellula è: Le azioni e le proprietà di ogni tipo di cellula

Dettagli