NUCLEO E GENOMA 26/10/15. Funzioni del Nucleo e Ciclo Cellulare DNA: T = A C G. Acido desossiribonucleico (DNA) Acido ribonucleico (RNA)

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "NUCLEO E GENOMA 26/10/15. Funzioni del Nucleo e Ciclo Cellulare DNA: T = A C G. Acido desossiribonucleico (DNA) Acido ribonucleico (RNA)"

Transcript

1 NUCLEO E GENOMA Funzioni del Nucleo e Ciclo Cellulare Acido desossiribonucleico (DNA) Acido ribonucleico (RNA) Unità del polimero: nucleotide Ogni nucleotide è composto di 3 elementi : zucchero 5C + base azotata + Acido Fosforico Acidi nucleici Acidi nucleici Acidi Nucleici Citosina Timina Uracile (in RNA) Pirimidine Appaiamento complementare tra le basi (legami a ponte di idrogeno) 5 DNA: T = A C G Purine 3 Adenina Guanina Nucleotide Desossiribosio Ribosio Pentosi Polinucleotide Nucleotidi: Timidina, Citidina, Uridina - Adenosina, Guanosina 5 3 I due filamenti sono antiparalleli (corrono in direzione opposta) Nucleotidi: Timidina, Citidina - Adenosina, Guanosina 1

2 Appaiamento complementare tra le basi (legami a ponte di idrogeno) DNA: T = A C G Acidi Nucleici RNA: U, A, C, G Acidi Nucleici Nucleotidi: Citidina, Uridina - Adenosina, Guanosina RNA: U, A, C, G Acidi Nucleici Il DNA si duplica, in modo semi-conservativo Acidi nucleici 3 RNA DNA C 5 Complementarietà tra DNA e RNA in trascrizione: U = A C G 2

3 N15>N14>14 3

4 Acidi nucleici Eucarioti: La sintesi dei filamenti complementari avviene in modo semidiscontinuo La sintesi avviene in direzione 5 > 3 per tutti gli acidi nucleici 5 Acidi nucleici Primer di RNA Duplicazione: a livello di più replisomi Replisoma: DNA Pol, elicasi, topoisomerasi I e II, ligasi, nucleosidi trifosfati... Aumentano o diminuiscono il grado di super-avvolgimento del DNA 4

5 Nei procarioti Eucarioti Acidi nucleici Duplicazione del DNA Eucromatina > Precoce Eterocromatina > Tardiva Sintesi e associazione con istoni 5

6 Flusso dell informazione Espressione genica Espressione genica TRASCRIZIONE TRADUZIONE Fattori di trascrizione Trascrizione [hnrna] Processamento del trascritto primario Capping in 5 <G PoliA in 3 Spicing snrnp U1 e U2 > introni Traduzione Esoni Introni Il ciclo cellulare e la divisione cellulare 6

7 Il Ciclo Cellulare Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la duplicazione cellulare, la crescita e la progressiva specializzazione delle funzioni (differenziamento). Il meccanismo di duplicazione cellulare delle cellule, ad eccezione di quelle germinali è noto come mitosi. Il Ciclo Cellulare La mitosi o divisione mitotica di una singola cellula determina la produzione di due cellule figlie, ciascuna delle quali geneticamente identica alla cellula parentale. Dopo la mitosi, le cellule figlie entrano in un periodo di crescita e di attività metabolica prima di affrontare una successiva divisione mitotica. L intervallo di tempo tra le divisioni mitotiche, cioè il ciclo vitale di una singola cellula, è chiamato ciclo cellulare. cytokinesi o citodieresi Il Ciclo Cellulare Successione delle fasi cellulari tra una divisione e la successiva G2 La cellula si prepara alla alla divisione mitotica G 2 Interfase: (G1 S G2) S sintesi DNA M Interfase G 1 G 0 Ciclo cellulare Profase Metafase* Anafase Telofase Citocinesi o citodieresi G 0 G 0 metabolismo e biosintesi basali; differenziamento cellulare G1 trascrizione, traduzione, biosintesi di precursori e macromolecole, assemblaggio di strutture e organuli cellulari, accrescimento della massa cellulare 7

8 Durata: 12-24h Ciclo cellulare Fase quiescente Ciclo cellulare Nelle cellule proliferanti: cellule ciclanti Nelle cellule differenziate: cessazione della fase ciclante M M G 2 G 1 G 2 G 1 Interfase G 0 Interfase G 0 uscita transtitoria o permanente! 7-10 S sintesi DNA S sintesi DNA Nucleoli Cromatina Ciclo cellulare Ciclo cellulare La vita della cellula è controllata attraverso le diverse fasi del suo ciclo cellulare La mitosi rappresenta la distribuzione di copie esatte del materiale genetico La lunghezza della fase G1 dipende dal tipo cellulare E lunga nelle cellule che non si dividono, breve nelle cellule embrionali che si dividono attivamente Interfase (G1-G0) => espressione genica Proliferazione: => continui cicli cellulari (p.es. cellule germinative epitelio, ) Differenziamento: => non si dividono > G0 irrev. (muscolari, nervose, granulociti) => non si dividono > G0 rev. o facoltative (osteoblasti, satelliti, staminali) Cromosomi Morte: programmata, o apoptosi => programma genetico di regressione della cellula (morfogenesi, metamorfosi, regressione luteo ecc...) Si distingue dalla necrosi che si manifesta in seguito a danni cellulari provocati da tossine, meccanici, 8

9 Come è regolato il ciclo? Cyclin B Cyclin E Cyclin B SAC (spindle assembly Checkpoint) Cyclin E Mitosi e divisione cellulare La mitosi è un processo continuo che viene suddiviso schematicamente in quattro fasi: Profase-metafase-anafase-telofase Ogni fase è riconoscibile al microscopio ottico. La mitosi richiede la presenza di una struttura chiamata apparato mitotico che comprende un fuso costituito da microtubuli disposti longitudinalmente tra due strutture, I centrioli posti nei centrosomi. Il fuso, visibile nel citoplasma solo durante la fase M del ciclo, viene disassemblato al termine della mitosi che si conclude con la citodieresi 9

10 Citodieresi o citocinesi 10

11 Coesin 11

12 Dineina cinesina bipolare

13 Fuso mitotico Mitosi Procarioti unico cromosoma circolare 13

14 Mitosi => formazione del fragmoplasto sulla piastra cellulare equatoriale Formazione del fragmoplasto Il fragmoplasto origina dal fuso mitotico modificato Complesso Golgi => Organizzazione microtubulare e migrazione di vescicole dal Golgi e reticolo Microtubuli R. Endoplasmatico Complesso Golgi Origine dei plasmodesmi: La fusione delle vescicole intrappola membrane del reticolo 14

15 Escape from the cell cycle Apoptosi e Nucleo 200 bp 1200 bp 1000 bp 800 bp 600 bp 400 bp 15

16 2 Cromatids Ciclo cellulare, cromosomi e mitosi A scanning electron micrograph of a human X chromosome. (Reproduced by permission of Photo Researchers, Inc.) Ciclo cellulare, cromosomi e mitosi 2 cromatidi 2 Cromosomi omologhi Cariotipo centromero A scanning electron micrograph of a human X chromosome. (Reproduced by permission of Photo Researchers, Inc.) 16

17 Nome N. di coppie Specie comune cromosomiche Zanzara Culex pipiens 3 Mosca Musca domestica 6 Rospo Bufo americanus 11 Cariotipo 2 cromatidi centromero Cromosoma Cariotipo: caratteristiche del corredo cromosomico Autosomi (n coppie di cromosomi omologhi) Eterocromosomi (mammiferi X e Y) Riso Oryza sativa 12 Rana Rana pipiens 13 Alligatore Alligator missisipiensis 16 Telomeri Scimmia Rhesus Macaca mulatta 21 Grano Triticum aestivum 21 Uomo Homo sapiens 23 Telocentrico Acrocentrico (bovino, pecora, capra) Patata Solanum tuberosum 24 Bovino Bos taurus 30 Asino Equus asinus 31 (dove si forma il complesso del cinetocore) Cavallo Equus caballus 32 Cane Canis familiaris 39 Carpa Cyprinus carpio 52 Cariotipo 17

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti.

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. 5.1 La divisione cellulare La divisione cellulare è il processo in seguito al quale una cellula si divide in due cellule figlie; generalmente

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà

Le basi cellulari della riproduzione e dell ereditarietà Le basi cellulari della riproduzione e dell ereditarietà riproduzione e divisione cellulare Negli organismi in cui avviene la riproduzione asessuata, la progenie è la copia genetica esatta dell unico genitore

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

Mitosi, ciclo cellulare e sua regolazione.

Mitosi, ciclo cellulare e sua regolazione. Mitosi, ciclo cellulare e sua regolazione www.fisiokinesiterapia.biz La dinamica del DNA nel corso della mitosi Schema delle fasi della mitosi Immagine al microscopio ottico di cellule vegetali in interfase

Dettagli

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per:

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per: Nucleo L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: 1. Citoplasma 2. Materiale Genetico 3. Membrana Plasmatica Differiscono tra loro per: Forma Dimensione Funzione

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Test di BIOLOGIA. 6. Gli enzimi sono costituiti da: a. polisaccaridi b. proteine c. acido ribonucleico d. proteine e acido desossiribonucleico

Test di BIOLOGIA. 6. Gli enzimi sono costituiti da: a. polisaccaridi b. proteine c. acido ribonucleico d. proteine e acido desossiribonucleico Test di BIOLOGIA 1. Che cosa rappresenta la reazione chimica 6 C02 + 6 H20 = C6H1206 + 602? a. L'equazione chimica della glicolisi b. L'equazione chimica della principale funzione mitocondriale c. L'equazione

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU)

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU) http://www 3.unipv.it/webbio/anatcomp/freitas/freitas.html Insegnamento Biologia della Cellula Animale e Vegetale (9 CFU) Unità didattica: Biologia della Cellula Animale (6 CFU) Esempi di Testi da utilizzare

Dettagli

Immagini e concetti della biologia

Immagini e concetti della biologia Sylvia S. Mader Immagini e concetti della biologia 2 A3 Le molecole biologiche 3 Il carbonio è l elemento di base delle biomolecole Una cellula batterica può contenere fino a 5000 tipi diversi di composti

Dettagli

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm)

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm) Il nucleo IL NUCLEO IL NUCLEO Nelle cellule eucariote c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Il concetto di riproduzione e la divisione cellulare 8.1 Il simile genera (quasi) sempre il simile Negli organismi in cui avviene la

Dettagli

Nucleotidi 26/10/2014. Nucleotidi (1)

Nucleotidi 26/10/2014. Nucleotidi (1) I Nucleotidi Hanno Tre Componenti Base azotata Nucleotidi https://www2.chemistry.msu.edu/faculty/reusch/virttxtjml/nucacids.htm Base azotata Qualsiasi composto che manifesta proprietà basiche per via della

Dettagli

Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg http://270c81.medialib.glogster.com/media/3b/3b966af047cca0605f106aa1a34dd3451287c5e41a0c7ce8ce537f74bbb795eb/main

Dettagli

Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri).

Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri). Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri). Un nucleotide è formato da: uno zucchero: (Ribosio o Deossiribosio), a 5 atomi di carbonio in forma ciclica

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE 1 4.1 Il simile genera (più o meno) il simile Gli organismi si riproducono secondo due modalità Riproduzione asessuata I figli ereditano il DNA di un

Dettagli

MOLTIPLICAZIONE CELLULARE

MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

27/01/2012. Ciclo Cellulare. Biotecnologie 2011 M.G. Bottone

27/01/2012. Ciclo Cellulare. Biotecnologie 2011 M.G. Bottone Ciclo Cellulare Biotecnologie 2011 M.G. Bottone 1 FASI DEL CICLO CELLULARE INTERFASE (1) Il ciclo di divisione della maggior parte delle cellule eucariotiche è suddiviso in quattro fasi distinte: M, G

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare Università degli Studi del Sannio Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a. 2010-2011 Programma di Biologia Cellulare (Prof Massimo Mallardo, I semestre, I anno) massimo.mallardo@unina.it

Dettagli

Ciclo Cellulare 10/01/2016. Genoma

Ciclo Cellulare 10/01/2016. Genoma Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg Genoma

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

CARIOLOGIA. 4.1 Introduzione. 4.2 Cromatina e cromosomi

CARIOLOGIA. 4.1 Introduzione. 4.2 Cromatina e cromosomi 4 CARIOLOGIA 4.1 Introduzione Nel capitolo precedente abbiamo visto che il progetto biologico di ogni organismo vivente è contenuto nel suo DNA, un composto organico la cui molecola è dotata di proprietà

Dettagli

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL CICLO CELLULARE, MITOSI E MEIOSI NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CELLULA DEVE CRESCERE

Dettagli

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali Strutture cellulari comuni tra cellule animali e vegetali: CITOPLASMA CITOSCHELETRO RIBOSOMI RETICOLO ENDOPLASMATICO APPARATO DEL GOLGI MITOCONDRI NUCLEO PEROSSISOMI CITOPLASMA materiale gelatinoso incolore

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

Ciclo di divisione cellulare Mitosi

Ciclo di divisione cellulare Mitosi iclo di divisione cellulare Mitosi Prof.ssa Flavia Frabetti aa. 2010-11 RESIMENO E DIVISIONE DIVISIONE ELLULRE RESI ELLULRE E DUPLIZIONE DEI ROMOSOMI SEREZIONE DEI ROMOSOMI unicellulari riproduzione pluricellulari

Dettagli

LA GENETICA MOLECOLARE

LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica

Dettagli

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S CONOSCERE IL CORPO UMANO PARTE 1 DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S. 2007-2008 1 CONOSCERE IL CORPO UMANO: GLOSSARIO ANATOMIA Scienza che studia e illustra la forma, l architettura e la

Dettagli

LICEO SCIENTIFICO STATALE GALILEO GALILEI Siena

LICEO SCIENTIFICO STATALE GALILEO GALILEI Siena LICEO SCIENTIFICO STATALE GALILEO GALILEI Siena Docente: Francesco Parigi Classe: 2 D Materia: Scienze naturali Origine e storia della biologia. Il metodo scientifico. Caratteristiche degli esseri viventi.

Dettagli

LE UNITÀ MORFOFUNZIONALI

LE UNITÀ MORFOFUNZIONALI LE UNITÀ MORFOFUNZIONALI «Con la cellula, la biologia ha scoperto i suoi atomi» La cellula La cellula èun unitàmorfofunzionale, cioèdi forma e funzione, la piùpiccola struttura che può essere classificata

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli