I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA"

Transcript

1 I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA Il primo livello di compattazione della molecola di DNA eucariotico consiste nell avvolgimento del DNA attorno agli istoni per formare i nucleosomi: a) vero, se si sta parlando dell eterocromatina costitutiva; b) vero, se si sta parlando del cromosoma X inattivo; c) vero, se il DNA è ipermetilato; d) vero, sempre; e) falso, sempre 2. L eterocromatina costitutiva: a) è la cromatina presente sul cromosoma X inattivato; b) nei mammiferi appare come corpo di Barr; c) è la porzione di cromatina permanentemente condensata in tutti i tessuti e in tutti gli stadi di sviluppo di un organismo; d) è la porzione di cromatina condensata solo in certe cellule e in certi momenti dello sviluppo; e) si distingue dall eterocromatina facoltativa in base alla diversa colorabilità 3. L eterocromatina facoltativa rappresenta: a) la cromatina presente nei centromeri; b) la cromatina presente nei telomeri; c) la cromatina attiva; d) la cromatina associata alle sequenze satellite; e) la cromatina presente sul cromosoma X inattivato 4. Il passaggio da eterocromatina inattiva ad eucromatina attiva avviene per: a) metilazione DNA e deacetilazione istonica; b) demetilazione DNA e acetilazione istonica; c) acetilazione DNA e demetilazione istonica; d) deacetilazione DNA e metilazione istonica; e) nessuna di queste 5. Quale delle seguenti affermazioni sul cariotipo umano è FALSA? a) i cromosomi sessuali sono diversi nel maschio e uguali nella femmina; b) le coppie di cromosomi sono numerate in ordine di dimensioni crescenti; c) i cromosomi appaiati nel cariotipo sono detti omologhi; d) le varie coppie di cromosomi sono diversi per dimensioni e forma; e) per determinare i cromosomi omologhi si osserva il bandeggio cromosomico 6. L eterocromatina costitutiva rappresenta: a) la cromatina poco colorata nei nuclei in interfase; b) la cromatina presente nelle braccia lunghe dei cromosomi; c) la cromatina presente nei centromeri; d) la cromatina associata alle sequenze satellite; e) la cromatina presente sul cromosoma X inattivato 7. La forte condensazione dell eterocromatina può causare: a) la metilazione; b) lo splicing dell mrna; c) l ubiquitinazione; d) la promozione della trascrizione; e) il silenziamento della trascrizione 8. Quali strutture e sequenze sono presenti sulle braccia corte dei cromosomi acrocentrici? a) sequenze alfoidi, geni enhancer; b) sequenze di regolazione; c) satelliti e geni dell rrna; d) geni per la regolazione della meiosi; e) sequenze di inizio della replicazione 9. Quale delle seguenti procedure implica l utilizzo di Quinacrina fluorescente per l analisi del cariotipo? a) Bandeggio C; b) Bandeggio G; c) Bandeggio Q; d) bandeggio R; e) bandeggio T 10. Quale delle seguenti procedure implica l utilizzo di tripsina e colorazione con Giemsa per l analisi del cariotipo? a) Bandeggio C; b) Bandeggio G; c) Bandeggio Q; d) bandeggio R; e) bandeggio T 11. In cosa consiste la differenza tra cromosomi acrocentrici, metacentrici e submetacentrici? a) tipo di telomeri; b) posizione del centromero; c) tipo di centromero; d) diversa composizione di sequenze nucleotidiche; e) posizione del centromero e composizione in basi del centromero 12. Le tecniche di bandeggio applicate ai preparati cromosomici servono a evidenziare: a) alterazioni numeriche e strutturali dei cromosomi; b) solo alterazioni numeriche; c) solo alterazioni strutturali; d) mutazioni puntiformi; e) il corpo di Barr 13. Quale delle seguenti procedure viene usata come tecnica di routine per l analisi del cariotipo con il microscopio ottico? a) Bandeggio C; b) Bandeggio G; c) Bandeggio Q; d) bandeggio R; e) bandeggio T 14. Quale dei seguenti valori si avvicina di più alla risoluzione raggiunta dal bandeggio cromosomico e dalla microscopia ottica? a) 40 Mb; b) 4 Mb; c) 400 kb; d) 40 kb; e) 4 kb 15. Descrivere come si possono ottenere i cromosomi profasici o prometafasici 16. Quale tra i seguenti NON è un eteromorfismo cromosomico: a) dimensioni del braccio lungo del cromosoma Y (Yq); b) dimensioni dell eterocromatina centromerica; c)

2 variazioni del numero dei geni ribosomiali nei satelliti dei cromosomi acrocentrici; d) dimensioni del braccio corto del cromosoma X (Xp); e) costrizioni secondarie soggette a rottura 17. L effetto mutageno delle radiazioni ionizzanti: a) è limitato alle cellule del tessuto cutaneo; b) riguarda sia le cellule germinali quanto quelle somatiche; c) è limitato alle cellule germinali; d) consiste nell induzione di aberrazioni cromosomiche ma non di mutazioni puntiformi; e) consiste nell induzione di lesioni che non possono essere riparate 18. Quale tra i seguenti è un agente mutageno fisico? a) il fumo; b) l acido nitroso; c) le radiazioni; d) gli analoghi delle basi; e) agenti intercalanti 19. La principale fonte di radiazioni ionizzanti cui siamo sottoposti come popolazione è costituita da: a) radiodiagnostica; b) impianti termonucleari; c) esperimenti nucleari bellici; d) radioterapia; e) radiazioni naturali 20. Descrivere i metodi descritti a lezione per determinare se una sostanza chimica è mutagena 21. Quali di queste affermazioni sulle mutazioni somatiche NON è corretta? a) si esauriscono con l'individuo; b) possono determinare la trasformazione neoplastica; c) determinano mosaicismo; d) sono ereditarie; e) sono tutte corrette 22. Quali tipi di mutazioni puntiformi possono essere introdotti da errori nella replicazione del DNA? a) solo le transizioni; b) solo le transversioni; c) qualsiasi tipo di mutazione puntiforme; d) solo delezioni e inserzioni; e) solo mutazioni introniche 23. Che cosa si intende per mutazione germinale: a) una mutazione avvenuta in una cellula somatica; b) una mutazione che avviene nello zigote; c) una mutazione che altera la funzionalità dei gameti; d) una mutazione in una cellula che darà origine ai gameti; e) una mutazione che non può essere trasmessa alla generazione successiva 24. La sintesi di una proteina anomala può derivare dalla presenza di una mutazione: a) nei siti di splicing; b) sinonima; c) di stop; d) sono corrette la risposta a e la risposta c; e) sono corrette le risposte a, b, c 25. Le seguenti motivazioni per cui una mutazione del DNA può NON avere alcun effetto fenotipico sono tutte esatte, tranne una. Quale? a) una mutazione può avvenire in un introne; b) il codice genetico è degenerato; c) il codice genetico è senza virgole; d) una mutazione può causare la sostituzione di un aminoacido in un dominio della proteina non essenziale per la funzione; e) una mutazione può causare la sostituzione di un aminoacido funzionalmente simile 26. In quale caso le mutazioni missenso hanno un fenotipo più grave delle mutazioni di stop? a) proteine con nuova funzione; b) proteine con acquisto di funzione; c) proteine con perdita di funzione; d) proteine multimeriche; e) tutte le precedenti 27. Quale tipo di mutazione aumenta all aumentare dell età paterna? a) mutazione da delezione; b) mutazione da inversione; c) mutazione da duplicazione; d) mutazione da espansione; e) mutazione puntiforme 28. Una mutazione silente può portare a: a) una proteina diversa che è il risultato di uno scivolamento del registro di lettura; b) l utilizzo di un diverso trna durante la traduzione; c) una sostituzione aminoacidica; d) una alterazione dei livelli di espressione del gene; e) una proteina con alterata funzionalità 29. L aploinsufficienza descrive una situazione in cui una sola copia funzionale del gene non è sufficiente affinché si abbia uno sviluppo normale: a) vero, e il genotipo è omozigote; b) vero, e determina un fenotipo recessivo; c) falso perché l imprinting comporta che sia sempre un solo allele ad esprimersi; d) falso perché l imprinting comporta che siano entrambi gli alleli ad esprimersi; e) vero, e determina un fenotipo dominante 30. Le mutazioni che generano proteine che hanno un attività biochimica del tutto assente sono chiamate: a) con perdita di funzione; b) dominanti negative; c) polimorfismi; d) eteromorfismi; e) dominanti 31. Un allele nullo può essere dominante su uno funzionante a causa: a) della perdita di funzione; b) della codominanza; c) della dominanza incompleta; d) dell aploinsufficienza; e) della penetranza incompleta

3 32. Una mutazione che porta all assenza di proteina può: a) essere una mutazione frameshift; b) aver interessato la regione del promotore del gene; c) essere una mutazione non senso; d) avere interessato siti di modificazione post-traduzionale importanti per la stabilità della proteina; e) tutte le risposte sono corrette 33. Una mutazione non senso può: a) causare una sostituzione aminoacidica; b) cambiare le dimensioni di una proteina; c) far revertire una mutazione silente; d) generare una proteina con sequenza aminoacidica diversa per scivolamento del registro di lettura; e) generare una proteina con alterati livelli di espressione 34. Una mutazione frameshift (scorrimento di cornice di lettura) è causata da: a) errore post-traduzionale; b) delezione di tre basi nel DNA; c) inserzione di tre basi nel DNA; d) inserzione di una singola base nel DNA; e) un errore nella trascrizione del DNA 35. Una mutazione frameshift (scorrimento di cornice di lettura) tenderà a produrre: a) una proteina con una sequenza diversa; b) una riduzione quantitativa della proteina; c) un effetto solo in omozigosi; d) una proteina con effetto dominante; e) sarà letale 36. Una mutazione frameshift (scorrimento di cornice di lettura) tenderà a produrre: a) la mancata aggregazione dei ribosomi; b) un mrna più corto; c) un mrna più lungo; d) una proteina non funzionante; e) nessuna risposta è corretta 37. Una mutazione di stop tenderà a produrre: a) un fenotipo dominante; b) una proteina tronca; c) la mancata aggregazione dei ribosomi; d) un mrna più corto; e) nessuna risposta è corretta; 38. Quale dei seguenti tipi di mutazione non può aver luogo nella sequenza di un promotore? a) indotta; b) delezione; c) transversione; d) transizione; e) missenso 39. Elencare le cause per cui alcune mutazioni puntiformi sono silenti, cioè non causano alterazioni nella proteina 40. La causa di grandi delezioni o duplicazioni di interi geni è dovuta a: a) errori nella sintesi del DNA; b) errori nel riparo del DNA; C) errori nella sintesi e nel riparo del DNA; d) presenza di sequenze ripetute; e) tutte le risposte sono corrette 41. La diversità genetica dei gameti prodotti dopo la meiosi, rispetto alle cellule progenitrici, è dovuta a: a) crossing-over tra cromosomi omologhi; b) assortimento indipendente dei cromosomi omologhi; c) dimezzamento del numero dei cromosomi; d) le risposte corrette sono a e b; e) tutte le risposte sono corrette 42. In quale stadio del ciclo cellulare la cellula replica il proprio DNA? a) citodieresi; b) profase; c) fase S; d) metafase; e) fase G1 43. In quale fase rimangono bloccati tutti gli ovociti primari durante l ovogenesi? a) profase I; b) profase II, c) metafase I; d) metafase II; e) anafase I 44. Ogni oocita che entra nella profase della seconda divisione meiotica contiene: a) 23 cromatidi, 23 centromeri, 23 cromosomi; b) 46 cromatidi, 23 centromeri, 23 cromosomi; c) 46 cromatidi, 23 centromeri, 46 cromosomi; d) 46 cromatidi, 46 centromeri, 46 cromosomi; e) 46 cromatidi, 46 centromeri, 23 cromosomi 45. I cromosomi omologhi presentano: a) identica sequenza di nucleotidi del DNA; b) identica sequenza di geni; c) diversa sequenza di geni; d) diversa modalità di associazione degli istoni; e) identica sequenza di alleli 46. Una cellula con dieci paia di cromosomi si divide per mitosi. Quanti cromosomi avrà ciascuna cellula figlia? a) venti paia; b) dieci; c) cinque; d) cinque paia; e) venti 47. Quanti cromosomi umani sono contenuti in uno spermatogonio? a) 2 miliardi; b) 46; c) 23; d) 10 milioni; e) 20 milioni 48. Nell ovocita umano la meiosi II si completa: a) nel feto; b) subito dopo la fecondazione; c) al momento della pubertà; d) appena prima dell ovulazione; e) durante l ovulazione

4 49. La ricombinazione meiotica (crossino-over) implica la rottura e la riunione di molecole di DNA tra: a) zigoti maschili e femminili; b) cromatidi fratelli omologhi; c) gameti paterni e materni; d) cromosomi non omologhi; e) cromatidi omologhi non fratelli 50. Elencare le cause di diversità genetica nei gemelli monozigoti 51. Descrivere le conseguenze genetiche della meiosi 52. La legge dell assortimento indipendente: a) spiega le osservazioni della F2 nell incrocio monoibrido; b) spiega le osservazioni della F2 nell incrocio diibrido; c) spiega le differenze tra caratteri dominanti e recessivi; d) riguarda la trasmissione dei caratteri associati (linked); e) spiega le osservazioni della F1 nell incrocio diibrido 53. Quale aspetto del comportamento dei cromosomi omologhi spiega la legge di Mendel della segregazione? a) il crossing-over tra i cromosomi omologhi durante la profase I della meiosi; b) il movimento dei cromatidi fratelli ai poli opposti durante l anafase II della meiosi; c) il movimento dei cromosomi omologhi ai poli opposti durante l anafase I della meiosi; d) la replicazione dei cromosomi prima della meiosi; e) il movimento dei cromosomi omologhi ai poli opposti durante la profase I della meiosi 54. L idea che differenti coppie di alleli siano trasmesse alla progenie in maniera autonoma è il principio di Mendel detto: a) purezza dei gameti; b) segregazione; c) assortimento indipendente; d) concatenazione; e) dominanza 55. L idea che, per ogni particolare carattere, la coppia di alleli di ciascun genitore si separi e solo un allele da ciascun genitore sia trasmesso ai figli è il principio di Mendel detto: a) segregazione; b) ibridizzazione; c) fecondazione; d) assortimento indipendente; e) dominanza 56. In un incrocio mendeliano monoibrido, quale generazione è sempre completamente eterozigote? a) la generazione F1; b) la generazione F2; c) quella risultatnte dall incrocio Aa x aa; d) la generazione P; e) quella risultante dall incrocio Aa xaa 57. In un incrocio mendeliano monoibrido, quale generazione è sempre completamente omozigote? a) la generazione F2; b) la generazione P; c) quella risultante dall incrocio AA x Aa; d) la generazione F1; e) quella risultante dall incrocio AA x aa 58. Quali tipi di gameti produce un individuo di genotipo AaBb? a) A,a,B,b; b) Ab,ab; c) Aa,Bb,AB,ab; d) AB,Ab,aB,ab; e) AA,aa,BB,bb 59. In un incrocio AAbb x aabb, quale sarà la frequenza degli individui AaBB? a) 1/16; b) 0; c) 1/8; d) 1/4; e) 1/2 60. La progenie F1 di un incrocio monoibrido mostrerà il/i genotipo/i: a) AA e Aa; b) Aa e aa; c) AA, Aa, aa; d) AA; e) Aa 61. La progenie F2 di un incrocio monoibrido mostrerà il/i genotipo/i: a) AA e Aa; b) Aa e aa; c) AA, Aa, aa; d) AA; e) Aa 62. Se il 50% della progenie di un test cross mostra il fenotipo recessivo aa, allora il genitore a genotipo sconosciuto ha: a) un genotipo eterozigote Aa; b) un genotipo omozigote AA; c) un alta frequenza di ricombinazione; d) un genotipo sconosciuto; e) alleli identici aa 63. Quale dei seguenti avrà un fenotipo diverso dagli altri? a) Rr; b) rr; c) rr; d) RR; e) sono tutti uguali 64. La probabilità che si verifichi uno qualunque di due eventi che si escludono a vicenda è data da: a) la frequenza di ricombinazione; b) la legge dell assortimento indipendente; c) la regola del prodotto; d) la legge della segregazione; e) la regola della somma 65. La probabilità che due o più eventi indipendenti si verifichino contemporaneamente è data da: a) la regola della somma; b) la legge dell assortimento indipendente; c) la regola del prodotto; d) la legge della segregazione; e) la frequenza di ricombinazione

5 RISPOSTE 1. d) vero, sempre 2. c) è la porzione di cromatina permanentemente condensata in tutti i tessuti e in tutti gli stadi di sviluppo di un organismo; 3. e) la cromatina presente sul cromosoma X inattivato 4. b) demetilazione DNA e acetilazione istonica 5. b) le coppie di cromosomi sono numerate in ordine di dimensioni crescenti 6. c) la cromatina presente nei centromeri 7. e) il silenziamento della trascrizione 8. c) satelliti e geni dell rrna 9. c) Bandeggio Q 10. b) Bandeggio G 11. b) posizione del centromero 12. a) alterazioni numeriche e strutturali dei cromosomi 13. b) Bandeggio G 14. b) 4 Mb 15. Descrivere come si possono ottenere i cromosomi profasici o prometafasici 16. d) dimensioni del braccio corto del cromosoma X (Xp) 17. b) riguarda sia le cellule germinali quanto quelle somatiche 18. c) le radiazioni 19. e) radiazioni naturali 20. Descrivere i metodi descritti a lezione per determinare se una sostanza chimica è mutagena 21. d) sono ereditarie 22. c) qualsiasi tipo di mutazione puntiforme 23. d) una mutazione in una cellula che darà origine ai gameti; 24. d) sono corrette la risposta a e la risposta c 25. c) il codice genetico è senza virgole 26. d) proteine multimeriche 27. e) mutazione puntiforme 28. b) l utilizzo di un diverso trna durante la traduzione 29. e) vero, e determina un fenotipo dominante 30. a) con perdita di funzione 31. d) dell aploinsufficienza 32. e) tutte le risposte sono corrette 33. b) cambiare le dimensioni di una proteina 34. d) inserzione di una singola base nel DNA 35. a) una proteina con una sequenza diversa

6 36. d) una proteina non funzionante; 37. b) una proteina tronca 38. e) missenso 39. Elencare le cause per cui alcune mutazioni puntiformi sono silenti, cioè non causano alterazioni nella proteina 40. d) presenza di sequenze ripetute 41. d) le risposte corrette sono a e b 42. c) fase S 43. a) profase I 44. b) 46 cromatidi, 23 centromeri, 23 cromosomi 45. b) identica sequenza di geni 46. e) venti 47. b) b) subito dopo la fecondazione 49. e) cromatidi omologhi non fratelli 50. Elencare le cause di diversità genetica nei gemelli monozigoti 51. Descrivere le conseguenze genetiche della meiosi 52. b) spiega le osservazioni della F2 nell incrocio diibrido 53. c) il movimento dei cromosomi omologhi ai poli opposti durante l anafase I della meiosi 54. c) assortimento indipendente 55. a) segregazione 56. a) la generazione F1 57. b) la generazione P 58. d) AB,Ab,aB,ab 59. b) e) Aa 61. c) AA, Aa, aa 62. a) un genotipo eterozigote Aa 63. c) rr 64. e) la regola della somma 65. c) la regola del prodotto

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Alterazioni della struttura dei cromosomi

Alterazioni della struttura dei cromosomi Alterazioni della struttura dei cromosomi Più di un migliaio di sindromi RARE incidenza complessiva 4/1000 nati sono dovute a riarrangiamenti cromosomici Contribuiscono per un 3-5% alle cause di aborto

Dettagli

6) Una cellula con 10 coppie di cromosomi entra in mitosi. Quanti cromosomi avrà ognuna delle due cellule figlie? a) 5 b) 20 coppie e) 20 d) 10

6) Una cellula con 10 coppie di cromosomi entra in mitosi. Quanti cromosomi avrà ognuna delle due cellule figlie? a) 5 b) 20 coppie e) 20 d) 10 Corso di Laurea in Scienze Ambientali Genetica e Biologia delle popolazioni Autovalutazione n. 1 1)Il fenotipo è: a) l insieme dei geni di un organismo b) il numero di cromosomi di un individuo c) la capacità

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

3 modulo didattico - Le

3 modulo didattico - Le 3 modulo didattico - Le mutazioni del DNA e le malattie monogeniche. Le mutazioni del genoma umano Mutazione: qualsiasi cambiamento permanente ed ereditabile del DNA Mutazione ereditata proveniente dai

Dettagli

Mutazioni genetiche 2

Mutazioni genetiche 2 Mutazioni genetiche 2 Cosa sono le mutazioni? Le proteine sono in grado di svolgere la loro funzione solo se la loro sequenza amminoacidica è quella corretta. In caso contrario si possono generare delle

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1.

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Insieme delle caratteristiche contenute nei geni, sia quelle manifeste, sia

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

N.B. Queste sono solo alcune delle possibili domande d esame.

N.B. Queste sono solo alcune delle possibili domande d esame. Per facilitare lo studio, accanto ad alcuni argomenti del programma, sono riportate alcune domande a cui si deve saper rispondere se si è padroni dell argomento. Possono essere considerate come una verifica

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Genetica della trasmissione dei caratteri. Genetica molecolare. Genetica di popolazione

Genetica della trasmissione dei caratteri. Genetica molecolare. Genetica di popolazione Genetica della trasmissione dei caratteri Genetica molecolare Genetica di popolazione Individuò regole attraverso cui i caratteri dei genitori si ripresentano nella progenie caratteristiche della prole

Dettagli

Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso

Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso Nel DNA dei cromosomi sono codificati i caratteri specifici per ogni individuo, in settori detti geni un carattere

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

SECONDA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 8-14) AA

SECONDA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 8-14) AA SECONDA PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 8-14) AA 2014-2015 1. Nella epistasi: A) una porzione di cromosoma viene eliminata; B) un gene regola l espressione di altri geni; C) il comportamento

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna GENETICA GENERALE - 1 CFU Modulo Biologia Applicata e Genetica generale CORSO INTEGRATO: SCIENZE BIOLOGICHE - 7 CFU Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

GENETICA prima parte

GENETICA prima parte GENETICA prima parte Le caratteristiche di ogni persona formano il patrimonio ereditario e sono trasmesse dai genitori ai figli. Gregor Mendel per primo spiegò come si trasmettono questi caratteri. Vissuto

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B1 Da Mendel ai modelli di ereditarietà 3 Mendel, il padre della genetica

Dettagli

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura Università di Bari Teoria Cromosomica Alcune caratteristiche fenotipiche di D. melanogaster Incrocio di un maschio white con femmina selvatica in D. melanogaster P SE FOSSE IL SEMPLICE FATTORE MEDELIANO?

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

SECONDA LEGGE DI MENDEL

SECONDA LEGGE DI MENDEL SECONDA LEGGE DI MENDEL Seconda Legge di Mendel: principio dell assortimento indipendente Il rapporto fenotipico 9:3:3:1 in incroci di diibridi Seconda Legge di Mendel: principio dell assortimento indipendente

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

Gli eventi caratteristici della meiosi sono:

Gli eventi caratteristici della meiosi sono: Gli eventi caratteristici della meiosi sono: 1. la segregazione (=separazione) dei cromosomi omologhi; 2. l assortimento indipendente dei cromosomi; 3. il crossing-over LA COMPRENSIONE DI COME I GENI SI

Dettagli

Allestimento di un cariotipo di cromosomi umani

Allestimento di un cariotipo di cromosomi umani Allestimento di un cariotipo di cromosomi umani The picture that established 46 as the chromosome number in man. Reproduced with permission from Ref. 1 (1956) Mendelian Society of Lund for the Scandinavian

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

GENETICA. La mappatura dei cromosomi eucariotici mediante la ricombinazione

GENETICA. La mappatura dei cromosomi eucariotici mediante la ricombinazione GENETICA La mappatura dei cromosomi eucariotici mediante la ricombinazione Mappatura: : domande Se 2 geni sono localizzati sullo stesso cromosoma (linked)) si possono scoprire nuove combinazioni di alleli

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

2. ANALISI dei CROMOSOMI

2. ANALISI dei CROMOSOMI 2. ANALISI dei CROMOSOMI Citogenetica classica - il cariotipo - allestimento di un preparato tessuti analizzabili principali patologie di numero e struttura Citogenetica molecolare tecniche di ibridazione

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

1 modulo didattico - Impatto clinico delle malattie genetiche e

1 modulo didattico - Impatto clinico delle malattie genetiche e 1 modulo didattico - Impatto clinico delle malattie genetiche e fondamenti di genetica GENETICA MEDICA OBBIETTIVI FORMATIVI Conoscere le basi cellulari e molecolari dell eredità Conoscere le basi genetiche

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per

Dettagli

PROF. Edoardo Soverini

PROF. Edoardo Soverini PROGRAMMA SVOLTO A.S. 2015-2016 PROF. Edoardo Soverini MATERIA: Scienze Naturali CLASSE IIB Liceo I. CONTENUTI DISCIPLINARI, FINALITÀ E OBIETTIVI FORMATIVI DELLA DISCIPLINA UNITÀ DIDATTICHE - MODULI PERIODO

Dettagli

Da Mendel ai modelli di ereditarietà

Da Mendel ai modelli di ereditarietà Capitolo B1 Da Mendel ai modelli di ereditarietà 1 Mendel, il padre della genetica Gregor Mendel (1822-1894), monaco e naturalista, condusse esperimenti di genetica in un orto del monastero di Brno, nell

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

ASSENTE ASSENTE ESAME DI GENETICA MEDICA 18 GIUGNO De Nisi Giada. Losito Alessandro. De Carolis Mascia. Galeotti Daniele. Iossa Francesca Maria

ASSENTE ASSENTE ESAME DI GENETICA MEDICA 18 GIUGNO De Nisi Giada. Losito Alessandro. De Carolis Mascia. Galeotti Daniele. Iossa Francesca Maria ESAME DI GENETICA MEDICA 18 GIUGNO 2015 De Nisi Giada 30 Losito Alessandro 28 De Carolis Mascia 27 Galeotti Daniele 21 Iossa Francesca Maria 28 Stronati Martina 25 Gigli Silvia 30 Caratelli Marco Zaro

Dettagli

CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE

CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE 1 Questa opera è protetta dalla Legge sul diritto d autore (Legge n. 633/1941: http://www.giustizia.it/cassazione/leggi/l633_41.html). Tutti

Dettagli

ANALISI MENDELIANA. GENOTIPO: costituzione genetica di un individuo, sia riferito ad un singolo gene, sia all insieme dei suoi geni.

ANALISI MENDELIANA. GENOTIPO: costituzione genetica di un individuo, sia riferito ad un singolo gene, sia all insieme dei suoi geni. ANALISI MENDELIANA ANALISI MENDELIANA GENOTIPO: costituzione genetica di un individuo, sia riferito ad un singolo gene, sia all insieme dei suoi geni. FENOTIPO: manifestazione fisica di un carattere genetico,

Dettagli

Lezione 1. Le molecole di base che costituiscono la vita

Lezione 1. Le molecole di base che costituiscono la vita Lezione 1 Le molecole di base che costituiscono la vita Le molecole dell ereditarietà 5 3 L informazione ereditaria di tutti gli organismi viventi, con l eccezione di alcuni virus, è a carico della molecola

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

Elementi di Genetica Vegetale

Elementi di Genetica Vegetale Elementi di Genetica Vegetale Roberto Tuberosa Dipartimento di Scienze agrarie Viale Fanin 44 Tel. 051-2096646 roberto.tuberosa@unibo.it www.distagenomics.unibo.it Titolo: Genetica e genomica Autori: Barcaccia

Dettagli

Ampliamenti delle leggi di Mendel

Ampliamenti delle leggi di Mendel Ampliamenti delle leggi di Mendel 1 La dominanza incompleta Nella dominanza incompleta gli eterozigoti mostrano un fenotipo intermedio a quello dei genitori, in accordo con le leggi di Mendel. Entrambi

Dettagli

Tipi. MUTAZIONI: Tipi, Origini, Conseguenze

Tipi. MUTAZIONI: Tipi, Origini, Conseguenze MUTAZIONI Tipi MUTAZIONI: Tipi, Origini, Conseguenze Origini Mutazioni spontanee MUTAZIONI: Tipi, Origini, Conseguenze FORME TAUTOMERICHE Origini Mutazioni spontanee MUTAZIONI: Tipi, Origini, Conseguenze

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

Ricombinazione di geni associati sullo stesso cromosoma e mappe genetiche

Ricombinazione di geni associati sullo stesso cromosoma e mappe genetiche Ricombinazione di geni associati sullo stesso cromosoma e mappe genetiche doppio eterozigote Segregazione indipendente di due caratteri: geni non associati omozigote recessivo M= foglie normali m= foglie

Dettagli

Come indicare i cromosomi sessuali negli incroci

Come indicare i cromosomi sessuali negli incroci Come indicare i cromosomi sessuali negli incroci Femmina eterozigote per un carattere autosomico A ed uno X-linked B A a B 1 1 X X b OPPURE AaBb Se volete scriverlo e se avete queste informazioni Maschio

Dettagli

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton)

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton) Mutazioni nelle cellule somatiche e genetica del cancro (Teoria Boveri - Sutton) Walter Stanborough Sutton Theodor Boveri Walter S. Sutton: Teoria dell ereditarietà dei cromosomi 1914: Teoria cromosomica

Dettagli

Nucleotide / aminoacido? 4 aa. 2 Nucleotide / aminoacido? 4 2 = 16 aa. 3 Nucleotide / aminoacido? 4 3 = 64 aa. UNIVERSALE e DEGENERATO

Nucleotide / aminoacido? 4 aa. 2 Nucleotide / aminoacido? 4 2 = 16 aa. 3 Nucleotide / aminoacido? 4 3 = 64 aa. UNIVERSALE e DEGENERATO La#scoperta#della#stru.ura#a#doppia#elica# nel#1953#ha#fa.o#immediatamente# sorgere#una#domanda:## come#l informazione#gene;ca#può#essere# codificata#dal#dna?# Nucleotide / aminoacido? 4 aa 2 Nucleotide

Dettagli

CAPITOLO 11: Mendel e la genetica classica

CAPITOLO 11: Mendel e la genetica classica PROGRAMMA MATERIA : DI SCIENZE NATURALI,CHIMICA E GEOGRAFIA A.S. : 2015-2016 DOCENTE: FRAU BASILIA CLASSE: 3 SEZ. B CAPITOLO 11: Mendel e la genetica classica 11.1 Nascita della genetica 11.2 La legge

Dettagli

Genetica: Lo studio dell eredità

Genetica: Lo studio dell eredità Genetica: Lo studio dell eredità Perché la progenie assomiglia ai genitori? Perché alcuni individui in una popolazione differiscono? Giardino di Mendel nel monastero. Piano sperimentale di Mendel 1. Buona

Dettagli

Cromosomi sessuali. Le cellule maschili e femminili differiscono per i cromosomi sessuali o

Cromosomi sessuali. Le cellule maschili e femminili differiscono per i cromosomi sessuali o Cromosomi sessuali Le cellule maschili e femminili differiscono per i cromosomi sessuali o cromosomi del sesso o eterosomi (cosiddetti perché hanno forma diversa). Nell uomo e in molte altre specie (ma

Dettagli

Cromosomi sessuali. cromosomi del sesso o eterosomi (cosiddetti perché hanno forma

Cromosomi sessuali. cromosomi del sesso o eterosomi (cosiddetti perché hanno forma Cromosomi sessuali Le cellule maschili e femminili differiscono per i cromosomi sessuali o cromosomi del sesso o eterosomi (cosiddetti perché hanno forma diversa). Nell uomo e in molte altre specie (ma

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Matematicandoinsieme. Mendel e l ereditarietà

Matematicandoinsieme. Mendel e l ereditarietà Matematicandoinsieme Mendel e l ereditarietà 1 Gregor Mendel: il padre della genetica Gregor Mendel(1822-1894) Monaco e naturalista austriaco. Condusse i suoi studi sulle piante del pisello odoroso nel

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO CORSO DI GENETICA IL CROMOSOMA EILCARIOTIPO Dal DNA ai cromosomi I cromosomi Il materiale ereditario degli eucarioti è organizzato in cromosomi il cui numero e la cui morfologia sono costanti nelle varie

Dettagli

Le classi fenotipiche F2 così ottenute sono compatibili con una ipotesi di geni indipendenti? Motivare la vostra conclusione.

Le classi fenotipiche F2 così ottenute sono compatibili con una ipotesi di geni indipendenti? Motivare la vostra conclusione. Nella petunia il carattere petalo rosso (R) è dominante su petalo bianco (r) ed il carattere stelo lungo (L) dominante su stelo corto (l). Da un incrocio fra linee pure di piante a fiore rosso e stelo

Dettagli

Libri di testo consigliati:

Libri di testo consigliati: BIOLOGIA GENERALE II Modulo I: Genetica Anno accademico 2003-2004 Docente: Dr. Filippo Geuna DIPROVE - Sez. Coltivazioni Arboree Tel: 02-50316550 E-mail: filippo.geuna@unimi.it Appunti I principi della

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli

La regina Vittoria d Inghilterra ( )

La regina Vittoria d Inghilterra ( ) Il caso emofilia La regina Vittoria d Inghilterra (1819-1901) Cromosoma X umano (Daltonismo Emofilia ) Daltonismo Cosa osservate di differente in questi due pedigree? Emofilia Daltonismo Emofilia Daltonismo

Dettagli

MENDEL E LE SUE LEGGI

MENDEL E LE SUE LEGGI MENDEL E LE SUE LEGGI Gregor Mendel (1822 1884) Era un monaco boemo considerato il padre della genetica, a cui si debbono le prime fondamentali leggi sull ereditarietà (1865). E importante ricordare un

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico In Drosophila meta delle mutazioni sono generate da elementi genetici mobili Generalmente le componenti mobili

Dettagli

La citogenetica studia la struttura e le alterazioni dei cromosomi.

La citogenetica studia la struttura e le alterazioni dei cromosomi. La citogenetica studia la struttura e le alterazioni dei cromosomi. I cromosomi si presentano come piccoli bastoncelli, a loro volta divisi in due longitudinalmente ed uniti in una zona detta centromero,

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

I ESERCITAZIONE GENETICA

I ESERCITAZIONE GENETICA 2-04-2008 _ Dott.Baratta I ESERCITAZIONE GENETICA 1) Definizione di Probabilità (eventi elementari) 2) Calcolo della Probabilità di eventi composti (Regola del prodotto e della somma) 3) Predizione dei

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Esistono 2 tipi di variazioni nel numero dei cromosomi eteroploidia a. poliploidia 3n, 4n,5n b. aploidia n

Esistono 2 tipi di variazioni nel numero dei cromosomi eteroploidia a. poliploidia 3n, 4n,5n b. aploidia n Mutazioni cromosomiche strutturali Esistono 5 tipi principali di mutazione della struttura dei cromosomi delezione duplicazione inversione traslocazione (reciproca e non reciproca) trasposizione numeriche

Dettagli

Alberi Genelogici. Le malattie genetiche autosomiche recessive. Mendeliana. Trasmissione ereditaria di un singolo gene. monofattoriale) (eredità

Alberi Genelogici. Le malattie genetiche autosomiche recessive. Mendeliana. Trasmissione ereditaria di un singolo gene. monofattoriale) (eredità Alberi Genelogici I II SCHEMA DI ALBERI GENEALOGICI 1 2 3 4 1 2 3 4 5 6 7 Trasmissione ereditaria di un singolo gene Mendeliana (eredità monofattoriale) Autosomica Dominante. (AD) III IV 1 2 3 1 4 2 5

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà GENETICA... lessico Genetica: studio dei geni e dell'ereditarietà Geni: porzioni di DNA contenenti un'informazione che permette di decodificare una certa proteina. Es: gene che determina il colore dei

Dettagli

CENNI SULLA REPLICAZIONE E RIPARO DEL DNA

CENNI SULLA REPLICAZIONE E RIPARO DEL DNA Corso di Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 CENNI SULLA REPLICAZIONE E RIPARO DEL DNA Mutageni fisici e chimici Replicazione

Dettagli

Cenni storici. leggi dell ereditarietà. Pisello odoroso (Pisum Sativum) 10/05/2012 L-1 1

Cenni storici. leggi dell ereditarietà. Pisello odoroso (Pisum Sativum) 10/05/2012 L-1 1 Cenni storici prima di Mende la teoria più accreditata era quella della ereditarietà intermedia : una volta che due caratteri si combinano è impossibile separarli nuovamente Pisello odoroso (Pisum Sativum)

Dettagli