= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "= ca. 1,7 mt. 3*10 9 (devono rientrare in uno"

Transcript

1 CROMATINA E CROMOSOMI

2 UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb

3 UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT GAGACCAGTGTTCCTGTAGTTACCCCTACAGCTAGCACAGCCCCTCCGGTTCCCGCAACTGCTCCTTCTCCTGCTCCTGCCGTT = ca. 1,7 mt. GCAGCTGCTGCTGCTGCCACTACTGCTGCCACCGCCGCTGCCACCACCACTACCACCACCTCCGCTGCCACCGCCACCACTGCTC CTCCTGCTCTAGATATCTTTGGTGATTTATTTGAGTCCACTCCTGAAGTTGCTGCAGCGCCTAAGCCAGATGCTGCTCCTAG 3*10 9 (devono rientrare in uno CATAGACCTGTTTAGTACAGATGCTTTCTCCTCTCCACCACAAGGGGCCTCTCCTGTGCCTGAGAGTTCTCTCACTGCTGACC TCTTATCTGTGGATGCATTTGCAGCACCATCTCCTGCAACCACTGCCTCGCCAGCAAAGGTGGATTCTTCAGGTGTCATAGA spazio ristretto di 5 um) CCTTTTTGGGGATGCATTTGGAAGTAGCGCTTCTGAACCCCAACCTGCATCTCAGGCTGCTTCTAGTTCATCAGCATCGGCA GACCTACTAGCTGGATTTGGGGGTTCTTTCATGGCGCCTTCCCCATCTCCAGTGACTCCAGCTCAGAATAACCTGCTACAGC CCAATTTTGAGGCAGCTTTTGGGACAACGCCTTCAACTTCCAGCAGCAGCTCCTTTGATCCATCAGTGTTTGATGGTCTAGG TGATCTTTTGATGCCAACCATGGCACCAGCTGGGCAGCCTGCACCTGTCTCAATGGTACCACCCAGTCCTGCAATGGCAGCC AGCAAAGCCCTTGGAAGTGATCTTGATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAATTTCTGGTACCACAACAAAA AAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGCAGCCTAAAGTAGCTCCAGCAACC TGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCAGTTCAGTTCCTCCTGTTGCCGGGGCCCC ATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAGGCATGCCCATGATGCCTCAGCAGCCGGTCATG TTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTACCTGGCACGCAGCTTTCTCCAAGCCCTACACCTGCCAG TCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGGATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGC AATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGACTTCAAATAAGATTGATGCTGAGTTTCAAAGGGAGCCAC 150*10 6 CAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAATGTGTAACACAGCCGTGAAAGTGAACATTAGGAATATGT ACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTATTTGGATTATTTGTGTATTGTACGATGTAAACAATGAAT GGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGAGGACAGATGATGCAGCTGTTGTGTGGCGAGCTATTTGG AAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAACTTTTGAACAAACCCCAAACTCTTCCCATAAATTATCTTTT CTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGATAATAAGGAAAACACTCATAAATATACAAAACTTTTTCA GTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTGTGAGAAATGTTTATTTTTGTGGCACTGTATATGTTAAG AAATTTTATTTTAAAAAATATAAAGGTTAACGTCCATAATAAATACTTCTCTTTGAAGCTACCTTATCAAGAACGAAAA ATCGTATGGGAAGAATCCCCTATTTATCACTGCTATATTAAAATATATATATTTTAATTATATTTGACAGGTTTTGCATC TAAATTGACCTATTTATTCATTCTTGATTAAATGCACTGAAAAGTAAAGGGTCTGTTTGTGTCATGTTCATGAAAATGCG GTTAGAGAGGTGCTATTCAAGTGATTCTGAAGGCACCCCAAGGTATATCTGTAATTTAAAGATTACTGCAAATATCTTTA CTTTACTGTGGGTTTTTAGTACATCTGTTAATTTAGTGTTTCTTTGTGTGTTTTGTAGACTAGTGTTCTTCCATCCTTCAA 1-5*10 6 CTGAGCTCAAAGTAGGTTTTGTTGTAACATTGTGATTAGGATTTAAACTAATTCAGAGAATTGTATCTTTTACTGTACAT ACTGTATTCTTTAAGTTTTAATTTGTTGTCATACTGTCTGTGCTGATGGCTTGGCTTAAGATTTTGATGCATAAATGAGG TCACTGTTGATCAGTGTTGCTAGTAGCTTGGCAGCTCTTCATAAAAGCATATTGGGTTGGAAAGGTGTTTGCCTATTTTTC AAATTATTTAATAGATGTATGGTACCATTTAAAAGTGGTTGTATCTGAATTTACTGTGGGGATAACATACACTGTAATG GGGAAAAATTACCTAAAACCAATTTCAAAATGGCTTTCTTTGTATTTCAGTTTAAAAACCCAGTGCATGTACGCCCTCTGA GATGCAATAAACACCTTGAACAAAG

4 La cromatina La cromatina è una costruzione sovramolecolare costituita dalle molecole di DNA genomico e da due diverse classi di proteine

5 Le proteine della cromatina sono: Gli istoni Proteine non istoniche

6 Gli istoni Sono presenti nel nucleo in quantità pressochè uguale a quella del DNA Sono proteine ricche di carica elettrica positiva perché ricche di aminoacidi basici (lisina e arginina) Possono essere suddivise in 2 classi

7 Classi di istoni Classe 1: H2A H2B H3 H4 (Formano strutture ottameriche rocchetti intorno ai quali si avvolge il DNA- che permettono la prima fase di compattamento: collana di perle ) Classe 2: H1 NOTA: Gli Istoni H2A H2B H3 H4 sono tra le proteine più conservate dal punto di vista evolutivo: la loro sequenza aminoacidica è estremamente simile in tutti gli esseri viventi

8 I nucleosomi I nucleosomi sono l unità fondamentale della cromatina. Tipicamente un nucleosoma è costituito da un core di istoni (ottamero composto da due tetrameri, ciascuno dei quali costituito dagli istoni H2A, H2B, H3 ed H4). intorno al quale si avvolge il DNA per circa 146 bp.

9 L organizzazione base della cromatina è una struttura a collana di perle Un segmento di DNA della lunghezza di 140 bp si avvolge attorno ad ogni ottamero di istoni (la perla), formandovi circa due giri che aderiscono stabilmente alla superficie dell ottamero mediante legami ionici

10 La molecola di DNA (il filo) si estende con continuità per tutta la sua lunghezza da un nucleosoma all altro, lasciando tra loro un tratto di collegamento di circa 60 bp (DNA linker)

11 La presenza dell istone H1 dà origine ad una struttura più compatta di 30nm (Fibra di 30 nm)

12 ISTONI + DNA + PROT. NON ISTONICHE = CROMATINA. [NOTA: GLI ISTONI, OLTRE A NEUTRALIZ= ZARE LE CARICHE NEGATIVE DEL DNA COSA CHE PERMETTE A DIVERSE MOLECOLE DI DNA ADDOSSATE L UNA ALL ALTRA DI NON RESPINGERSI-, SONO LE PROTEINE RESPONSABILI DEL GRADO DI COMPATTAMENTO DELLA CROMATINA STESSA

13 eucromatina: meno condensata e corrisponde a zone in cui vi è un'intensa attività di trascrizione per la sintesi proteica (ossia di copiatura delle molecole di DNA in molecole di RNA messaggero, mrna) eterocromatina: più condensata, non presenta attività di trascrizione.

14

15 L eucromatina è sempre attiva da un punto di vista trascrizionale. L eterocromatina si distingue in: I. Costitutiva (resta sempre allo stato di massimo compattamento in tutte le cellule, non viene mai trascritta); II. Facoltativa (viene inattivata in modo specifico in alcune fasi della vita dell organismo)

16 Le differenze strutturali tra i due tipi di cromatina possono essere imputate a: A. Una diversa interazione tra il DNA linker e l istone H1; B. Un diverso stato di acetilazione degli istoni; C. Un diverso stato di fosforilazione che interessa in particolare l istone H2B; D. Metilazione degli istoni; E. Ubiquitinazione o sumolazione degli istoni

17 Si definisce cromosoma una struttura molto compatta e colorabile, visibile al microscopio ottico durante la divisione cellulare, in particolare durante la metafase, quando viene raggiunto il massimo livello di compattamento della cromatina (spessore di circa 1400 nm)

18 Braccio corto (p) Braccio lungo (q) I cromosomi sono dicromatidici, fatti da 2 cromatidi fratelli (duplicati in fase S), associati a livello del centromero. Le proteine centromeriche che tengono uniti tra di loro i cromatidi fratelli prendono il nome di coesine.

19 Cromosomi Omologhi: Nella specie umana sono presenti due copie per ciascun cromosoma, pertanto i 46 cromosomi corrispondono a 23 coppie. Nella Specie Umana Il Corredo Cromosomico è pari a 46. L'Ultima coppia di Cromosomi (23) Cromosomi Sessuali, determina il sesso dell'individuo. La coppia XX determina la femmina, mentre la coppia XY determina il maschio. I Cromosomi non sessuali, sono detti Autosomi.

20 Tutte le cellule dell'organismo Umano contengono quindi 46 cromosomi, divisi in due coppie di 23 Cromosomi di cui 22 Autosomi e 1 di Cromosomi sessuali (cellule diploidi). Unica eccezione le cellule gonadiche (ovociti e spermatozoi) dette cellule aploidi che invece contengono solo 23 cromosomi singoli e non in coppia. In particolare ciascun Ovocita ha 22 autosomi ed 1 solo cromosoma sessuale che è sempre X. Mentre Lo spermatozoo, ha 22 autosomi ed un solo cromosoma sessuale che può essere o X o Y. Questo spiega perchè il sesso del nascituro è determinato dal maschio.

21

22 Il cariotipo di una cellula eucariota è dato dal numero e dalla morfologia dei suoi cromosomi.

23 La posizione del centromero permette di classificare i cromosomi in 4 tipi: acrocentrici: centromero in posizione terminale (A) telocentrici: centromero in posizione subterminale (B) submetacentrici: centromero in posizione submediana (C) metacentrici: centromero in posizione mediana (D)

24

25 Organism Homo sapiens(human) estimated size 3000 million bases estimated gene number ~20,000-25,000 Rattus norvegicus (rat) 2,750 million bases ~30,000 Mus musculus (mouse) 2500 million bases ~30,000 Drosophila melanogaster (fruit fly) Arabidopsis thaliana (plant) Caenorhabditis elegans (roundworm) Saccharomyces cerevisiae (yeast) Escherichia coli (bacteria) 180 million bases 13,600 average gene density 1 gene per 100,000 bases 1 gene per 100,000 bases 1 gene per 100,000 bases 1 gene per 9,000 bases chromosome number 125 million bases 25,500 1 gene per 4000 bases 5 97 million bases 19,100 1 gene per 5000 bases 6 12 million bases gene per 2000 bases million bases gene per 1400 bases 1 H. influenzae (bacteria) 1.8 million bases gene per 1000 bases Human immunodeficiency virus (HIV) gene per 1000 bases

26 PROGETTI GENOMA

27 IL GENOMA È FATTO SOLO DI GENI? ~20% ~80% ~6% ~94% (1,2% del genoma totale) 18,8% del genoma totale) (64% del genoma totale) (16% del genoma totale) ~80% ~20%

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO CORSO DI GENETICA IL CROMOSOMA EILCARIOTIPO Dal DNA ai cromosomi I cromosomi Il materiale ereditario degli eucarioti è organizzato in cromosomi il cui numero e la cui morfologia sono costanti nelle varie

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Dimensioni dei Genomi Eucariotici

Dimensioni dei Genomi Eucariotici Dimensioni dei Genomi Eucariotici plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

LA GENETICA MOLECOLARE

LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica

Dettagli

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide.

In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. Lodish et al. Molecular Cell Biology In molecular terms,

Dettagli

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c.

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c. Doutez de tout et surtout de ce que je vais vous dire Bouddha 556-480 a.c. Il punto: -genotipo fenotipo -eredita -gene Esercitazione Bonus: 0-1.5 Presenza obbligatoria -gene malattia -manipolazione del

Dettagli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Doppia membrana Pori Matrice

Dettagli

I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA

I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA I PROVA AUTOVALUTAZIONE GENETICA MEDICA (LEZIONI 1-7) AA 2014-2015 1. Il primo livello di compattazione della molecola di DNA eucariotico consiste nell avvolgimento del DNA attorno agli istoni per formare

Dettagli

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1.

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Insieme delle caratteristiche contenute nei geni, sia quelle manifeste, sia

Dettagli

Allestimento di un cariotipo di cromosomi umani

Allestimento di un cariotipo di cromosomi umani Allestimento di un cariotipo di cromosomi umani The picture that established 46 as the chromosome number in man. Reproduced with permission from Ref. 1 (1956) Mendelian Society of Lund for the Scandinavian

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Evoluzione del genoma. Silvia Fuselli, 29 novembre 2011

Evoluzione del genoma. Silvia Fuselli, 29 novembre 2011 Evoluzione del genoma Silvia Fuselli, fss@unife.it 29 novembre 2011 In questa lezione parleremo di Meccanismi di evoluzione del genoma Formazione di nuovi geni Dimensioni del genoma e complessità degli

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali Fattori di crescita Recettori di fattori di crescita Membrana citoplasmatica roteine trasduttrici del segnale Nucleo Fattori trascrizionali roteine del ciclo cellulare Ciclo di divisione cellulare Fattori

Dettagli

L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA. Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO

L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA. Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO L ordine più elevato di Avvolgimento del DNA è Il CROMOSOMA Ogni specie ha numero e dimensioni caratteristiche dei cromosomi, noti come CARIOTIPO CARIOTIPO UMANO: Struttura a corona di rosario 46 cromosomi:

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

Le cellule e le divisioni cellulari

Le cellule e le divisioni cellulari Le cellule e le divisioni cellulari ttp://www.saggiolab.com/genetica_aa_2007-08.php Tutti gli esseri viventi, ad eccezione dei virus, sono formati da cellule La cellula procariotica -Parete cellulare peptidoglicano

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Pori Matrice Nucleare

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una

Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp (150.000Mbp=150Gbp) di una Liliacea. Tra le graminacee il frumento ha un genoma

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna GENETICA GENERALE - 1 CFU Modulo Biologia Applicata e Genetica generale CORSO INTEGRATO: SCIENZE BIOLOGICHE - 7 CFU Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

Organizzazione del genoma umano

Organizzazione del genoma umano Organizzazione del genoma umano Famiglie di geni o geniche Copie multiple di geni, tutte con sequenza identica o simile. La famiglia multigenica corrisponde a un insieme di geni correlati che si sono evoluti

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti

Dettagli

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Lunghezza del cromosoma di E.coli (1,7 mm) paragonata alla lunghezza di una tipica cellula di E. coli (2μm) DNA di una cellula

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

DNA e cromosomi. Come costruirli

DNA e cromosomi. Come costruirli DNA e cromosomi Come costruirli Ogni cromosoma è formato dal DNA sotto forma di un filo chiamato cromatide. Quando è il momento di riprodursi, la cellula duplica il proprio DNA e vengono a formarsi

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

- Uno dei meccanismi biologici più importanti è connesso al controllo della divisione e proliferazione cellulare.

- Uno dei meccanismi biologici più importanti è connesso al controllo della divisione e proliferazione cellulare. - L obiettivo principale della ricerca biomedica consiste nel tentativo di comprendere, a livello molecolare, processi biologici complessi al fine di migliorare la salute ed il benessere dell uomo. - Uno

Dettagli

Come indicare i cromosomi sessuali negli incroci

Come indicare i cromosomi sessuali negli incroci Come indicare i cromosomi sessuali negli incroci Femmina eterozigote per un carattere autosomico A ed uno X-linked B A a B 1 1 X X b OPPURE AaBb Se volete scriverlo e se avete queste informazioni Maschio

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi!

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Esercizio 1 Di seguito puoi osservare il cariotipo (patrimonio cromosomico)

Dettagli

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo

Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo Come facciamo ad isolare un gene da un organismo? Utilizziamo una libreria ovvero una collezione dei geni del genoma del cromosoma di un organismo GENOMA di alcuni organismi viventi raffigurato come libri

Dettagli

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich.

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich. I cromosomi I cromosomi 1400 nm Modello di Saitoh and Laemmli Anse di cromatina piccole o lunghe G loops R loops G loops R loops Protein scaffold SARs AT-rich Scaffold AT-queue Chromatid fibers Anse piccole

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per:

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per: Nucleo L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: 1. Citoplasma 2. Materiale Genetico 3. Membrana Plasmatica Differiscono tra loro per: Forma Dimensione Funzione

Dettagli

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura Università di Bari Teoria Cromosomica Alcune caratteristiche fenotipiche di D. melanogaster Incrocio di un maschio white con femmina selvatica in D. melanogaster P SE FOSSE IL SEMPLICE FATTORE MEDELIANO?

Dettagli

La citogenetica studia la struttura e le alterazioni dei cromosomi.

La citogenetica studia la struttura e le alterazioni dei cromosomi. La citogenetica studia la struttura e le alterazioni dei cromosomi. I cromosomi si presentano come piccoli bastoncelli, a loro volta divisi in due longitudinalmente ed uniti in una zona detta centromero,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

2. I nucleosomi 11/02/16

2. I nucleosomi 11/02/16 2. I nucleosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale u Ordinato e dinamico u Formazione della struttura terziaria

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2011 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Nucleo. Contiene il materiale genetico DNA associato a proteine

Nucleo. Contiene il materiale genetico DNA associato a proteine Nucleo Contiene il materiale genetico DNA associato a proteine I cromosomi Sono depositari del materiale genetico. Sono composti da una lunga molecola di DNA, che costituisce il materiale genetico,e da

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

2. Negli Anfibi la circolazione e doppia ma incompleta. Il cuore di una rana ha pertanto:

2. Negli Anfibi la circolazione e doppia ma incompleta. Il cuore di una rana ha pertanto: Test n. 3 Dalle olimpiadi delle Scienze Naturali 2004 1. L uomo, come tutti i vertebrati, possiede un sistema circolatorio chiuso. Nei mammiferi la circolazione è doppia e completa, poiché il sangue ossigenato

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

2. ANALISI dei CROMOSOMI

2. ANALISI dei CROMOSOMI 2. ANALISI dei CROMOSOMI Citogenetica classica - il cariotipo - allestimento di un preparato tessuti analizzabili principali patologie di numero e struttura Citogenetica molecolare tecniche di ibridazione

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Compattamento del DNA nei cromosomi Il DNA cellulare e virale è associato a proteine in complessi detti cromosomi. Il compattamento è essenziale per vari motivi: a) contenimento

Dettagli