Nucleo. Contiene il materiale genetico DNA associato a proteine

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Nucleo. Contiene il materiale genetico DNA associato a proteine"

Transcript

1 Nucleo Contiene il materiale genetico DNA associato a proteine

2 I cromosomi Sono depositari del materiale genetico. Sono composti da una lunga molecola di DNA, che costituisce il materiale genetico,e da proteine che conferiscono al DNA una struttura organizzata Ogni cromosoma eucariotico tipico è costituito da una singola molecola di DNA(a doppia elica) lunga centinaia di migliaia di basi. Il cromosoma rappresenta il materiale genetico,ripiegato ed impacchettato,presente in una cellula in divisione.questo termine indica un unità distinta di materiale genetico Il termine cromatina indica il materiale genetico presente in una cellula non in divisione La cromatina non è un'entità indistinta ma è costituita da una serie di filamenti di DNA e proteine.

3 CROMOSOMA Il cromosoma è l'unità strutturale in cui il DNA, associato con specifiche proteine, si organizza all'interno delle cellule

4 Come avviene la SPIRALIZZAZIONE DELLA CROMATINA? Durante la profase Proteine istoniche associate al DNA

5 Il compattamento del DNA consiste nell avvolgimento della doppia elica intorno ad un gruppo di proteine chiamate istoni Queste proteine sono riferibili a cinque classi appartenenti alla categoria degli istoni 8 molecole istoniche,due per ogniuna delle prime 4 classi si associano a formare un ottamero detto rocchetto Ogni rocchetto con la doppia elica di DNA avvolta è detto nucleosoma

6 Il tratto di DNA che è contenuto in ogni nucleosoma è lungo 146/147 paia di basi. Le proteine istoniche sono basiche perché ricche di amminoacidi carichi positivamete,carica che attira la carica negativa dei fosfati del DNA DETERMINANDO LA FORMAZIONE DEL NUCLEOSOMA

7 I NUCLEOSOMI sono connessi da tratti di DNA di collegamento detti DNA linker che hanno una lunghezza variabile da 20 a 100bp a seconda della specie e del tipo cellulare. L ultima proteina istonica appartenente alla classe 5 lega due regioni linker adiacenti La struttura generale dei nucleosomi connessi tra loro ricorda una collana di perle

8

9

10 Il ruolo dei nucleosomi non è solo strutturale ma il loro arrangiamento regola le attività del DNA.

11 I nucleosomi sono ulteriormente compattati in fibre di 30 nm là dove le regioni linker sono avvolte in modo variabile e curvate a zig zag. Un ulteriore livello di compattamento comporta la formazione di domini ad ansa in cui le basi delle fibre di 30nm si ancorano ad una rete di proteine che costituiscono la matrice nucleare.

12

13

14

15

16 Ogni cromosoma è costituito da due cromatidi fratelli

17

18 Il livello di compattamento dei cromosomi, nel nucleo di una cellula,non è del tutto uniforme. Infatti nei cromosomi ci sono regioni altamente condensate, dove i domini ad anse sono ulteriormente compattati,che prendono il nome di eterocromatina(10% del genoma),inattive dal punto di vista trascrizionale in quanto la loro conformazione impedisce ai fattori di trascrizione di avere accesso ai geni E regioni meno condensate dette eucromatina che rappresentano le aree in cui vi è un intensa attività di trascrizione.

19 . Si distinguono due tipi di eterocromatina: l'eterocromatina costitutiva, che rimane tale durante tutto lo sviluppo, ed è presente in posizione identica su entrambi i cromosomi omologhi l'eterocromatina facoltativa, che varia di condizione (rilassata ed espressa/condensata e inattiva) a seconda dei diversi tipi cellulari (es: inattivazione cromosoma X per la formazione del corpo di Barr) e delle diverse fasi dello sviluppo.

20 Durante la divisione cellulare I CROMOSOMI RAGGIUNGONO LA MASSIMA COMPATTEZZA

21 TUTTI GLI ORGANISMI VIVENTI DAI BATTERI AGLI ANIMALI ALLE PIANTE SONO IL PRODOTTO DI CICLI RIPETUTI DI PROLIFERAZIONI E DIVISIONI CELULARI CHE RISALGONO ALL INIZIO DELLA VITA CIRCA 4 MILIARDI DI ANNI FA

22 CICLO CELLULARE CONSISTE IN UNA SERIE DI FASI CHE PORTANO ALLA DIVISIONE CELLULARE

23 CICLO CELLULARE fasi di crescita e divisione Ciclo cellulare:periodo che và dall inizio di una divisione all inizio di quella successiva e comprende: MITOSI ed INTRFASE Interfase:periodo che intercorre tra due divisioni successive,ossia dalla fine di una all inizio della successiva

24

25 La lunghezza del ciclo cellulare varia tra i diversi tipi di cellule da molti minuti a molti mesi. Nelle cellule dei mammiferi,che si dividono velocemente,il ciclo cellulare ha una durata di 24 h

26 INTERFASE comprende: Fase G1: crescita della cellula,incremento degli enzimi necessari per la sintesi del DNA Fase S: replicazione del DNA: ogni cromosoma si duplica in due cromatidi fratelli geneticamente identici,uniti a livello di una regione del DNA detta centromero (associato al centromero vi è il cinetocore,struttura discoidale proteica,che è il sito di attacco x i microtubuli del fuso) Fase G2 :duplicazione dei mitocondri e degli altri organuli,sintesi di microtubuli e proteine necessarie per entrare nella fase successiva di mitosi.

27

28

29 Fase G Sostituisce la fase G1 in una cellula che ha rimandato la decisione di dividersi o in una cellula differenziata terminalmente (cellule nervose animali adulti) che quindi non deve più dividersi

30 Mitosi Ha lo scopo di dividere il nucleo di una cellula in due nuclei distribuendo i cromosomi,duplicati in fase S,alle due cellule figlie in modo tale che ognuna riceva lo stesso complemento di cromosomi In moltissimi casi la mitosi è seguita dalla citodieresi ossia divisione del citoplasma per generare due cellule figlie distinte

31 Scopi della divisione cellulare mitotica Durante questo processo una cellula si divide producendo due cellule figlie identiche geneticamente alla cellula di origine.es. rigenerazione tissutale Uno degli scopi della mitosi è la riproduzione asessuata,alcuni organismi unicellulari eucariotici si riproducono per mitosi

32 Un altro scopo è la realizzazione del mantenimento della pluricellularità. organismi come piante ed animali,molti funghi,derivano da una singola cellula che è andata incontro a ripetute divisioni mitotiche

33 cariotipo Fornisce informazione sul numero,dimensioni e forma dei cromosomi I cromosomi nelle cellule somatiche di animali e piante superiori,sono presenti in coppia e queste cellule sono dette diploidi ossia presentano due corredi cromosomici. Le cellule sono invece dette aploidi quando presentano un solo corredo cromosomico. Nel caso dell uomo:cellule del corpo diploidi,gameti aploidi

34 uomo

35 Specie Diploidi I membri di una coppia di cromosomi sono detti omologhi e sono simili per dimensione,forma e posizione dei centromeri I cromosomi omologhi portano l informazione per il controllo degli stessi tipi di caratteristiche genetiche ossia un dato gene è presente su entrambi gli omologhi.es gene colore occhi

36 Nel caso della riproduzione sessuata: Due individui forniscono ciascuno un set cromosomico (gameti aploidi).l unione dei due gameti nello zigote darà origine ad una cellula diploide. Lo zigote andrà incontro a ripetute divisioni mitotiche dando origine ad un individuo le cui cellule saranno diploidi Poliploidia:organismo le cui cellule presentano più serie di cromosomi

37 Uomo Cariotipo con 23 coppie di cromosomi. Numero di cromosomi 46 Ultima coppia di cromosomi :sessuali differenti per dimensioni e composizione genica

38 CELLULA DIPLOIDE 2n(coppie di omologhi) CELLULA APLOIDE n(un solo cromosoma di ogni coppia) UOMO: numero aploide = 23 ; numero diploide = 46 Fusione dei gameti ricombinazione genetica nel contesto di una popolazione VARIABILITA GENETICA

39 Duplicazione del DNA Prima della duplicazione il DNA di ciascun cromosoma si trova in forma non condensata ossia è composto da una doppia elica lineare. Durante la fase S quando avviene la duplicazione del DNA i cromosomi appaiono come unità distinte,costituite da due cromatidi fratelli molto condensati e visibili al M.O.

40 I due cromatidi fratelli(cioè le due copie identiche derivate dalla duplicazione) sono associati a livello di un punto di costrizione detto centromero(sequenza specifica 220 nucleotidi)con specifica posizione su ogni cromosoma (associato al centromero vi è il cinetocore,struttura discoidale proteica,che è il sito di attacco x i microtubuli del fuso)

41 MITOSI Profase Metafase Anafase Telofase

42

43 Fuso mitotico E responsabile della ripartizione dei cromosomi. Si forma a partire dai due centrosomi (il centrosoma è stato anch esso duplicato in S) che sono i centri di organizzazione dei microtubuli.nelle cellule animali il centrosoma contiene una coppia di centrioli (anche questi vengono duplicati in S e saranno una coppia per ciascun centrosoma) dai microtubuli,strutture proteiche capaci di assemblarsi e disassemblarsi

44 Formazione del fuso mitotico Ogni coppia di centrosomi migra verso ogni polo della cellula,segnando pure la migrazione delle due coppie di centrioli. I microtubuli si estendono da ciascun polo verso i cromosomi,microtubuli polari,verso la membrana plasmatica in più direzioni formando l aster, struttura implicata anche nell ancoraggio dei centrioli alla membrana plasmatica,mentre i microtubuli del cinetocore legano i cinetocori di ciascun cromosoma I centrioli sono strutture non direttamente coinvolte nella formazione del fuso ma implicati nella formazione dei corpi basali di ciglia e flagelli

45

46

47 ANIMALI UNICELLULARI La decisione di dividersi è essenzialmente basata sulle condizioni ambientali Es.lieviti sufficiente nutriente esatta temp e ph di dividono

48 Organismi animali pluricellulari La divisione cellulare è regolata e controllata da fattori genetici I fattori di crescita sono un gruppo di proteine che stimolano la crescita e la divisione di alcuni tipi cellulari. Vengono secreti nel circolo sanguigno.

49 Come avviene questa stimolazione? I fattori di crescita seguono delle vie di segnalazione che provocano l aumento dell espressione di determinati geni che codificano per le proteine necessarie alla divisione cellulare

50 Tutte le cellule si originano x divisione di cellule preesistenti La divisione cellulare avviene attraverso i processi di mitosi e citocinesi In tutti gli animali la mitosi si svolge durante:crescita,processi rigenerativi La mitosi permette a ciascuna cellula figlia di ricevere una copia di ogni cromosoma della cellula madre(stesso numero, stesso tipo di cromosomi)

51 MITOSI come RIPR.ASESSUATA Cellule figlie identiche alla cellula genitrice La variabilità:cambiamenti genetici occasionali,opp. mutazioni MEIOSI RIPR.SESSUATA RICOMBINAZIONE GENETICA che deriva da cellule di due organismi diversi meiosi CELLULE SESSUALI(gameti) Zigote

52 Riproduzione sessuale e Meiosi

53 La riproduzione sessuale richiede un evento di fecondazione durante il quale i due gameti si uniscono per formare un unica cellula detta zigote.nel caso di molte specie pluricellulari,lo zigote si accresce e va incontro a ripetute divisioni mitotiche per dare origine ad un individuo pluricellulare

54 Il mantenimento di un numero costante di cromosomi nelle cellule delle generazioni successive di un organismo a riproduzione sessuata è assicurato dal processo di Meiosi

55 Infatti in seguito alla meiosi i gameti (che si dovranno unire nello zigote) avranno un numero aploide di cromosomi

56 meiosi È un processo attraverso il quale a partire da una cellula diploide si formano cellule aploidi per cui è un processo riduzionale I cromosomi vengono correttamente ripartiti e distribuiti in modo tale da ridurre a metà il loro numero iniziale e in modo tale che ogni gamete riceva un cromosoma da ciascuna delle coppie di omologhi di partenza

57 MEIOSI Inizia dopo che la cellula è progredita attraverso le fasi G1,S e G2 del ciclo cellulare (Fase S: Duplicazione del DNA) Prima divisione : MEIOSI Ι (riduzionale) Seconda divisione :MEIOSI ΙΙ (simile ad una mitosi)

58

59 Punti salienti della Meiosi I La cellula che si divide meioticamente è una cellula germinale diploide che quindi contiene coppie di omologhi ogniuno dei quali sarà costituito da due cromatidi fratelli(duplicazione in fase S) I cromosomi omologhi si allineano l uno a fianco all altro a formare le tetradi attraverso un processo di sinapsi Crossing-over ossia scambio fisico tra tratti di cromatidi omologhi(non fratelli).ricombinazione quindi variabilità genetica.

60

61 Dopo il crossing-over i bracci tendono a separarsi ma rimangono adesi nei punti di scambio detti chiasmi La rottura e successiva saldatura dei frammenti in corrispondenza dei chiasmi da vita ai cromatidi ricombinati

62

63 In metafasei le tetradi si allineano però vi è la formazione(a differenza della mitosi)di una doppia fila e la disposizione degli omologhi è casuale rispetto alla destra e sinistra della piastra metafasica.ciò implica aumento della variabilità genetica tra le cellule aploidi risultanti

64 Al termine della meiosi I La ripartizione è avvenuta entro ogni coppia di omologhi ossia migrano verso i poli opposti rispettivamente uno e l altro omologo due nuclei derivanti conterranno cromosomi i cui cromatidi sono stati ricombinati con il crossigover, i cromatidi ricombinati contengono una certa quantità di materiale genetico di derivazione materna e altro di derivazione paterno; nuclei non identici tra loro e neppure alla cellula madre

65 MEIOSI I Termine della meiosi I

66 Meiosi II Equivale ad una mitosi

67 MEIOSI II

68 Due nuclei figli :contenenti un solo set cromosomico (nucleo aploide) Con il crossing over variabilità

69

70 Ciclo biologico o vitale Sequenza di eventi che produce un altra generazione di organismi Per la riproduzione sessuale ciò implica:alternanza tra cellule(od organismi)aploidi e cellule (od organismi)diploidi

71 Ciclo vitale Animali Specie diploidi dominanti Funghi Specie aploidi dominanti Piante Specie con alternanza di generazione sporofiti diploidi,gametofiti aploidi

72

Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini pallavic@units.it MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

CICLO CELLULARE MITOSI MEIOSI

CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

Cromosomi MITOSI MEIOSI

Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

MERISTEMI APICALI. Apice del germoglio. Apice radicale

MERISTEMI APICALI. Apice del germoglio. Apice radicale MERISTEMI APICALI Apice del germoglio Apice radicale CICLO CELLULARE CHECK POINT 3 CHECK POINT 2 CHECK POINT 1 Le cellule vegetali differentemente da quelle animali possono abbandonare il ciclo di divisione

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti.

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. 5.1 La divisione cellulare La divisione cellulare è il processo in seguito al quale una cellula si divide in due cellule figlie; generalmente

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I LA MEIOSI Una coppia di cromosomi omologhi, presenti nel nucleo di una cellula diploide, è costituita da un primo cromosoma isolato di derivazione paterna e da un secondo cromosoma isolato di derivazione

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà

Le basi cellulari della riproduzione e dell ereditarietà Le basi cellulari della riproduzione e dell ereditarietà riproduzione e divisione cellulare Negli organismi in cui avviene la riproduzione asessuata, la progenie è la copia genetica esatta dell unico genitore

Dettagli

CICLO CELLULARE MITOTICO

CICLO CELLULARE MITOTICO Cellula Procariotica La divisione cellulare è rapida e semplice. I batteri non hanno un nucleo e contengono un solo cromosoma di DNA circolare attaccato alla membrana plasmatica dove resta mentre si duplica.

Dettagli

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Il concetto di riproduzione e la divisione cellulare 8.1 Il simile genera (quasi) sempre il simile Negli organismi in cui avviene la

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE 1 4.1 Il simile genera (più o meno) il simile Gli organismi si riproducono secondo due modalità Riproduzione asessuata I figli ereditano il DNA di un

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Cap. 12 La cellula. Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5

Cap. 12 La cellula. Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5 ( Cap. 12 La cellula 12.1 Le cellule Con l invenzione del microscopio l uomo ha potuto esplorare il ondo degli organismi molto piccoli il cui studio ha permesso di sviluppare la Teoria Cellulare. Questa

Dettagli

MITOSI. Ciclo del centrosoma CARIOTIPO UMANO (2N) LA FASE M DEL CICLO CELLULARE. Struttura del citoscheletro durante la fase M

MITOSI. Ciclo del centrosoma CARIOTIPO UMANO (2N) LA FASE M DEL CICLO CELLULARE. Struttura del citoscheletro durante la fase M LA FASE M DEL CICLO CELLULARE MITOSI La fase M del ciclo cellulare comprende mitosi e citochinesi ed è innescata da M-CdK (chinasi ciclinadipendente di fase M) e da M-ciclina. Struttura del citoscheletro

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

MOLTIPLICAZIONE CELLULARE

MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL CICLO CELLULARE, MITOSI E MEIOSI NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CELLULA DEVE CRESCERE

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Genetica e Biometria

Genetica e Biometria Genetica e Biometria Info utili 1. Corso a frequenza OBBLIGATORIA 2. Tutte le lezioni saranno disponibili sul sito biotech in format pdf dopo essere state tenute dal docente! 3. Sono previste 2 VERIFICHE:

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule.

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. LA CELLULA CELLULA La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. CELLULA La teoria cellulare Le cellule furono

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

I MECCANISMI ALLA BASE DEL CROSSING OVER

I MECCANISMI ALLA BASE DEL CROSSING OVER I MECCANISMI ALLA BASE DEL CROSSING OVER I quattro prodotti della meiosi di un fungo rimangono racchiusi in un contenitore chiamato asco Vantaggi dei funghi nell analisi genetica Facilità è rapidità di

Dettagli

La capacità di crescere è una caratteristica fondamentale degli esseri viventi

La capacità di crescere è una caratteristica fondamentale degli esseri viventi La capacità di crescere è una caratteristica fondamentale degli esseri viventi Negli organismi unicellulari, la divisione cellulare fa aumentare il numero totale degli individui di una popolazione Negli

Dettagli

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si LA CELLULA Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si nutre, respira, scambia sostanze con l ambiente

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

REGOLAZIONE DEL CICLO CELLULARE

REGOLAZIONE DEL CICLO CELLULARE REGOLAZIONE DEL CICLO CELLULARE Il sistema di controllo che regola la progressione del ciclo cellulare deve: 1) Garantire che tutti i processi associati con le diverse fasi siano portati a termine al tempo

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1.

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Insieme delle caratteristiche contenute nei geni, sia quelle manifeste, sia

Dettagli

LA RIPRODUZIONE. Prima di iniziare questo percorso tuttavia è necessario ripassare alcune nozioni di biologia apprese gli anni scorsi

LA RIPRODUZIONE. Prima di iniziare questo percorso tuttavia è necessario ripassare alcune nozioni di biologia apprese gli anni scorsi LA RIPRODUZIONE Caratteristica fondamentale che distingue i viventi dai non viventi è la riproduzione, che permette di generare nuovi individui mantenendo e diffondendo la specie nel tempo e nello spazio.

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

TEST BIOLOGIA 25/08 GENETICA

TEST BIOLOGIA 25/08 GENETICA 1. Il Crossing over avviene durante: A) La profase meiotica B) La metafase meiotica C) La profase mitotica D) La metafase mitotica E) L anafase meiotica TEST BIOLOGIA 25/08 GENETICA 2. La sequenza corretta

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

CROMOSOMI SESSUALI e ALLELI

CROMOSOMI SESSUALI e ALLELI CROMOSOMI SESSUALI e ALLELI Nelle due immagini che seguono possiamo osservare una fotografia dei 46 cromosomi di una cellula somatica umana (a sinistra) e gli stessi cromosomi sistemati, grazie ad un programma

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Doppia membrana Pori Matrice

Dettagli

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi!

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Esercizio 1 Di seguito puoi osservare il cariotipo (patrimonio cromosomico)

Dettagli