La nuova biologia.blu

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La nuova biologia.blu"



2 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2

3 Capitolo B4 La regolazione genica 3

4 Il genoma procariotico /1 I genomi procariotici presentano delle differenze rispetto a quelli eucariotici: sono più piccoli; sono molto compatti; spesso contengono plasmidi. I batteri non possiedono un nucleo delimitato e le attività metaboliche avvengono nel citoplasma. 4

5 Il genoma procariotico /2 5

6 L operone Un operone regola l espressione genica nei batteri e comprende: uno o più geni strutturali; un tratto di DNA promotore; un operatore a cui si lega il repressore. 6

7 Operoni inducibili: l operone lac Gli operoni lac regolano le vie cataboliche il cui substrato funziona da induttore. 7

8 Operoni reprimibili: l operone trp Gli operoni trp regolano le vie anaboliche il cui substrato funziona da corepressore. 8

9 Il genoma eucariotico Il genoma eucariotico presenta le seguenti caratteristiche:! è più grande di quello dei procarioti;! è organizzato in cromosomi;! possiede i telomeri;! contiene sequenze ripetitive;! possiede molti geni interrotti;! contiene sequenze regolatrici;! trascrizione e traduzione avvengono in ambienti separati. 9

10 Le sequenze ripetute Il genoma degli eucarioti contiene sequenze ripetitive, che non codificano proteine:! sequenze altamente ripetitive, che non sono mai trascritte;! sequenze moderatamente ripetitive, che codificano per i trna e gli rrna;! trasposoni, sequenze mobili che si spostano nel genoma. 10

11 I geni interrotti e lo splicing I geni sono formati da sequenze codificanti, gli esoni, e sequenze non codificanti, gli introni. Il processo di rimozione degli introni e di saldatura degli esoni si chiama splicing dell RNA. 11

12 Il controllo dell espressione genica L espressione genica viene regolata in diversi momenti:! prima della trascrizione o traduzione;! durante la trascrizione o traduzione;! dopo la trascrizione o traduzione; e in ambienti cellulari differenti: o nel nucleo; o nel citoplasma. 12

13 Il rimodellamento della cromatina Prima che inizi la trascrizione, avviene un rimodellamento della cromatina. 13

14 Meccanismi di regolazione sull intero cromosoma In un nucleo in interfase si distinguono due tipi di cromatina:! l eucromatina, contenente il DNA che viene abitualmente trascritto;! l eterocromatina, che contiene geni o cromosomi inattivi. 14

15 Il cromosoma X inattivo Il cromosoma X inattivo nei mammiferi è un esempio di eterocromatica e si presenta sottoforma di corpo di Barr. 15

16 La trascrizione differenziale Tutti i tessuti dell organismo contengono lo stesso materiale genetico. Tuttavia cellule di tessuti differenti hanno bisogno di differenziare la loro espressione genica per produrre proteine diverse. Esistono però dei geni, detti housekeeping, che vengono espressi da tutte le cellule dell organismo. 16

17 I fattori di trascrizione La trascrizione del genoma è attivata da fattori di trascrizione proteici che si legano al promotore. 17

18 Le sequenze regolatrici Esistono sequenze con funzioni regolativi sulla trascrizione:! gli intensificatori o enhancers, che legano i fattori di trascrizione e stimolano l attività del complesso di trascrizione;! i silenziatori o silencers, che arrestano la trascrizione in seguito al legame con specifici repressori proteici. 18

19 Lo splicing alternativo Lo splicing alternativo permette di ottenere proteine diverse a partire dallo stesso pre-mrna. 19

20 La regolazione dopo la trascrizione I meccanismi di regolazione che controllanoil livello di proteina prodotta o da produrre possono essere:! traduzionali come i microrna;! post-traduzionali, come l ubiquitina e i proteosomi. 20

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni











Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per


Passiamo ora in rassegna i meccanismi di controllo nelle due principali suddivisioni di esseri viventi.

Passiamo ora in rassegna i meccanismi di controllo nelle due principali suddivisioni di esseri viventi. La regolazione dell espressione dei geni. (prof. Paolo Marchesi)..siete pregati di non divulgare questo materiale senza il consenso dell autore, grazie.. Problema: Il DNA di una cellula contiene i geni


RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso


La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)



IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi



IL CONTROLLO DELL ESPRESSIONE GENETICA IL CONTROLLO DELL ESPRESSIONE GENETICA INDICE Scopo della regolazione genica Geni costitutivi e non costitutivi Regolazione genica dei procarioti Il modello dell operone Operone del triptofano e del lattosio


Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di



CONTROLLO DELL ESPRESSIONE GENICA NEI PROCARIOTI CONTROLLO DELL ESPRESSIONE GENICA NEI PROCARIOTI Unità trascrizionale E. Coli possiede diversi fattori sigma generale shock da calore carenza di azoto sintesi flagellare stress calore e sali Fattori sigma


Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo


Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


Trascrizione negli Eucariotici

Trascrizione negli Eucariotici Trascrizione negli Eucariotici Cytoplasm DNA RNA Transcription RNA Processing mrna G Nucleus AAAAAA Export G AAAAAA CLASSI DI GENI Le unità di trascrizione eucariotiche sono più complesse di quelle procariotiche


Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,


Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO


Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi





Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:





eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni


CAPITOLO 11. I meccanismi molecolari della regolazione genica La regolazione della trascrizione nei procarioti

CAPITOLO 11. I meccanismi molecolari della regolazione genica La regolazione della trascrizione nei procarioti CAPITOLO 11 I meccanismi molecolari della regolazione genica Il principio predominante della regolazione genica è che alcuni geni controllano l espressione di altri geni. Per molti anni si è creduto che


Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico In Drosophila meta delle mutazioni sono generate da elementi genetici mobili Generalmente le componenti mobili


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze



ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui



NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla


Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di


Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni


MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti


CAPITOLO 11: Mendel e la genetica classica

CAPITOLO 11: Mendel e la genetica classica PROGRAMMA MATERIA : DI SCIENZE NATURALI,CHIMICA E GEOGRAFIA A.S. : 2015-2016 DOCENTE: FRAU BASILIA CLASSE: 3 SEZ. B CAPITOLO 11: Mendel e la genetica classica 11.1 Nascita della genetica 11.2 La legge


LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente:

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente: Materiale Didattico Titolo modulo: Biologia applicata alla ricerca Biomedica LA TRASCRIZIONE Docente: FLUSSI DI INFORMAZIONE ATTRAVERSO LA CELLULA 1. Accessibilità del genoma 2. Assemblaggio del complesso


Espressione ed utilizzo della informazione genetica III Regolazione

Espressione ed utilizzo della informazione genetica III Regolazione Espressione ed utilizzo della informazione genetica III Regolazione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Controllo o regolazione della espressione genica negli EUCARIOTI Scopo:



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)


Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c.

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c. Doutez de tout et surtout de ce que je vais vous dire Bouddha 556-480 a.c. Il punto: -genotipo fenotipo -eredita -gene Esercitazione Bonus: 0-1.5 Presenza obbligatoria -gene malattia -manipolazione del


-85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO

-85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO Replication -85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a 20000 geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO QUINDI AMBIGUI I processi epigenetici,tutti


LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2014-2015 corso A- L Docente: Massimo Gulisano Cell 3483391646 Email Componen' chimici della cellula: Importanza



LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello


Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2013-2014 corso A- L Docente: Massimo Gulisano Componen' chimici della cellula: Importanza dei legami deboli


Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione negli eucarioti I meccanismi della trascrizione Organizzazione generale delle sequenze regolative Il macchinario generale della trascrizione Si


Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici





L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale


E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento


CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono


Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri



TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una


Prefazione. Modulo A Dalla scoperta del DNA al codice genetico e struttura degli acidi nucleici 1

Prefazione. Modulo A Dalla scoperta del DNA al codice genetico e struttura degli acidi nucleici 1 Indice Prefazione V Modulo A Dalla scoperta del DNA al codice genetico e struttura degli acidi nucleici 1 Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2


La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Il corpo umano PLUS 2 Capitolo C6 Il sistema linfatico e l immunità 3 Il sistema linfatico /1 Il sistema linfatico


N.B. Queste sono solo alcune delle possibili domande d esame.

N.B. Queste sono solo alcune delle possibili domande d esame. Per facilitare lo studio, accanto ad alcuni argomenti del programma, sono riportate alcune domande a cui si deve saper rispondere se si è padroni dell argomento. Possono essere considerate come una verifica


Flusso dell informazione genetica

Flusso dell informazione genetica Flusso dell informazione genetica 1 Trascrizione dell RNA (1) Topoisomerasi La trascrizione è catalizzata dalla RNA polimerasi diretta dal DNA con un meccanismo molto simile alla DNA polimerasi Differenze


Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione


Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare Università degli Studi del Sannio Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a. 2010-2011 Programma di Biologia Cellulare (Prof Massimo Mallardo, I semestre, I anno)








Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


2. Negli Anfibi la circolazione e doppia ma incompleta. Il cuore di una rana ha pertanto:

2. Negli Anfibi la circolazione e doppia ma incompleta. Il cuore di una rana ha pertanto: Test n. 3 Dalle olimpiadi delle Scienze Naturali 2004 1. L uomo, come tutti i vertebrati, possiede un sistema circolatorio chiuso. Nei mammiferi la circolazione è doppia e completa, poiché il sangue ossigenato


Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da


La trascrizione negli eucarioti

La trascrizione negli eucarioti La trascrizione negli eucarioti Il meccanismo della trascrizione Trascrizione eucariotica Analoga a quella procariotica ma i complessi proteici delle RNApolimerasi contengono molte più proteine accessorie





L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione





Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1


Promotori ed elementi di regolazione

Promotori ed elementi di regolazione Promotori ed elementi di regolazione Elementi cis- e trans- per la regolazione dell espressione genica Cis-acting elements Sequenze di DNA nella vicinanza della regione codificante di un gene che sono



CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo CONTROLLO DELL ATTIVITÀ GENICA NEI PROCARIOTI CORSO DI GENETICA CONTROLLO DELL ATTIVITÀ GENICA NEI PROCARIOTI Trascrizione e traduzione La trascrizione è il processo con cui l informazione ereditaria viene trasferita dal DNA all RNA. La traduzione


Programma Didattico Annuale

Programma Didattico Annuale LICEO STATALE SCIENTIFICO - LINGUISTICO - CLASSICO GALILEO GALILEI - LEGNANO PdQ - 7.06 Ediz.: 1 Rev.: 0 Data 02/09/05 Alleg.: D01 PROG. M2 PROCEDURA della QUALITA' Programma Didattico Annuale Anno Scolastico



LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in


Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


Relatrice: dott.ssa Ilaria Pegoretti

Relatrice: dott.ssa Ilaria Pegoretti Relatrice: dott.ssa Ilaria Pegoretti IL LABORATORIO DI BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni 26 Novembre 2011 Auditorium Presidio Ospedaliero S.Chiara, Trento Scoperta


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January

Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January 1 Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January 2009. 2 3 4 Il gene della proteina repressore ed il


Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


Organizzazione del genoma umano I

Organizzazione del genoma umano I Organizzazione del genoma umano I LEZIONE 7 1 Oggi, uno degli obiettivi prioritari è la comprensione dei meccanismi mediante i quali le informazioni contenute nel materiale genetico portano, partendo da


Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito


a. s CLASSE IIIDs Insegnante Anna Carmela Fronda Disciplina Scienze Naturali

a. s CLASSE IIIDs Insegnante Anna Carmela Fronda Disciplina Scienze Naturali a. s. 2015-2016 CLASSE IIIDs Insegnante Anna Carmela Fronda Disciplina Scienze Naturali PROGRAMMA SVOLTO riproduzione sessuata e asessuata eventi della divisione cellulare scissione binaria nei procarioti


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello


Corso di Laurea in Scienze delle attività motorie e sportive

Corso di Laurea in Scienze delle attività motorie e sportive Corso di Laurea in Scienze delle attività motorie e sportive Biologia applicata Prof. Cinzia Di Pietro RECAPITI Cinzia Di Pietro 095 3782075 Via S. Sofia 87 Pal. C - piano 2 - stanza


Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE


Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Genetica batterica Materiale genetico presente nella cellula batterica Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Nucleoide (morfologia) È costituito da un unica unica molecola


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione
