Struttura ed espressione del Gene

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Struttura ed espressione del Gene"


1 Struttura ed espressione del Gene PowerPoint Lectures for Essential Biology, Third Edition Neil Campbell, Jane Reece, and Eric Simon Essential Biology with Physiology, Second Edition Neil Campbell, Jane Reece, and Eric Simon Lectures by Chris C. Romero Copyright 2007 Pearson Education Inc., publishing as Pearson Benjamin Cummings

2 Relazione tra Geni e Proteine 1. Lo studio dei difetti metabolici ha portato alla scoperta che i geni codificano per le proteine 2. La Trascrizione e la Sintesi Proteica sono i due principali processi che legano i geni alle proteine 3. Il Codice Genetico: Legame tra DNA e Amminoacidi 4. Il Codice Genetico deve essersi evoluto molto precocemente nella storia della vita

3 Dal Gene alle Proteine Un Gene-una catena Polipeptidica Inizialmente è stato ipotizzato un gene-un enzima. successivamente quest ipotesi è stata modificata: Gli enzimi, sono proteine, ma non tutte le proteine sono enzimi (es. Cheratina, Insulina, etc..) Le proteine che non sono enzimi sono però prodotti genici. Perciò è più corretto pensare in termini di un gene-una proteina. Tuttavia, molte proteine sono costituite da due o più catene polipeptidiche, ognuna delle quali codificata da un suo gene specifico (es. catene dell Emoglobina). Alla luce di queste informazioni, la precedente ipotesi è stata corretta in un gene-una catena polipeptidica.

4 Il dogma centrale della biologia molecolare: DNA RNA Proteina 1. L informazione Genetica è conservata nel DNA 2. I segmenti di DNA che codificano per le proteine sono definiti geni 3. Le sequenze geniche sono trascritte in RNA messaggero (mrna) 4. Gli mrna sono codificati in proteine che svolgono la maggior parte delle funzioni vitali dell essere vivente

5 Acidi Nucleici Sequenza di Nucleotidi I Nucleotidi sono composti di: Basi Azotate: -Purine -Pirimidine Zuccheri -Ribosio -Deossiribosio Fosfato

6 DNA Acido Deossiribonucleico 4 Basi Adenina NH 2 Purine Adenina Guanina O O P CH 2 N N N N Pirimidine O O Citosina Timina Lo zucchero è il Deossiribosio H OH H H Copyright 2007 Pearson Education Inc., publishing as Pearson Benjamin Cummings

7 RNA Acido Ribonucleico 4 Nucleotidi Purine O Adenina N NH 2 N Adenina Guanina Pirimidine O P O CH 2 O N N Cytocina Uracile* Lo zucchero è il Ribosio Copyright 2007 Pearson Education Inc., publishing as Pearson Benjamin Cummings H OH OH H

8 Proteine Polimeri costituiti da monomeri di Amminoacidi 20 Amminoacidi naturali Raggruppati in base alla catena laterale in: Idrofobici Amminoacido Idrofilici H Acidi H O N C C Basici H OH R

9 Geni I geni sono localizzati in particolari regioni di un cromosoma (loci) e hanno una sequenza di basi (nucleotidi) ordinata in modo specifico

10 Cos è un locus? un locus descrive la regione di un cromosoma nel quale è localizzato un gene. 11p15.5 è il locus per il gene dell insulina umana. 11 è il cromosoma, p indica il braccio corto del cromosoma e 15.5 è il numero della banda assegnato a quella particolare regione del cromosoma. Quando i cromosomi sono colorati, essi appaiono come bande chiare e scure, e ogni banda è numerata. Più il numero è alto, più lontana è la banda dal centromero. Copyright 2007 Pearson Education Inc., publishing as Pearson Benjamin Cummings

11 Esoni e Introni I geni degli Eucarioti sono costituiti da introni ed esoni. Gli Esoni contengono le sequenze nucleotidiche che codificano per gli amminoacidi delle proteine. Gli Esoni sono separati gli uni dagli altri da segmenti di DNA non codificante definiti introni. Essi devono essere rimossi dopo la sintesi dell mrna mediante un processo chiamato splicing. Gli esoni vengono fusi uno dopo l altro in seguito alla rimozione degli introni; L mrna privo di introni è usato come stampo per fare le proteine attraverso un processo definito sintesi proteica.

12 Splicing Gli Esoni sono sequenze di DNA che sono usati per costruire le proteine. Gli Introni sono sequenze di DNA che non servono per fare le proteine. DNA Pre-mRNA mrna processato Copyright 2007 Pearson Education Inc., publishing as Pearson Benjamin Cummings

13 Esoni e Codice Genetico Come vengono codificate le sequenze esoniche per posizionare correttamente gli amminoacidi in una catena polipeptidica? La sequenza di DNA esonico codifica per una catena polipeptidica, tuttavia è possibile che alcune sequenze esoniche non siano utilizzate per fare le proteine. Porzioni of esoni o esoni interi possono essere costituiti da sequenze non utilizzate per costruire le proteine, queste regioni vengono definite untranslated regions or UTRs. Le UTRs si trovano a monte e a valle della sequenza codificante.

14 In conclusione, i geni programmano la sintesi delle proteine attraverso messaggeri genetici definiti mrna: DNA RNA Proteina

15 La scoperta del Codice Genetico La corrispondenza di un codone con un amminoacido è stata studiata fin dagli inizi degli anni 60 del secolo scorso. Marshall Nirenberg ha scoperto il primo matching, dove la sequenza UUU codifica per l amminoacido fenilalanina. Ha creato un RNA artificiale composto solo da uracile al quale ha aggiunto una mistura di amminoacidi, ribosomi, e altri componenti per la sintesi delle proteine. Questo poli(u) è stato codificato in una lunga catena polipeptidica costituita interamente da fenilalanine.

16 Nel Codice Genetico, i gli amminoacidi sono codificati da triplette (codoni) di nucleotidi Se il codice genetico fosse costituito da un singolo nucleotide o da un paio di nucleotidi per codificare un amminoacido, non ci sarebbero abbastanza combinazioni (rispettivamente 4 e 16 combinazioni), visto che gli amminoacidi sono 20. Con un codone costituito da triplette ci sarebbero abbastanza combinazioni per codificare tutti gli amminoacidi. Con il codice in triplette triplet code, tre basi consecutive codificano per un amminoacido, possedendo 4 3 (64) possibili combinazioni. Le istruzioni genetiche per costruire una catena polipeptidica sono scritte nel DNA come una serie di tre-nucleotidi definiti triplette. es. la tripletta AGT sul filamento codificante del DNA corrisponde all amminoacido Serina.

17 L intero codice genetico è stato decifrato già dagli anni 60 del secolo scorso 61 of 64 triplette codificano per i 20 amminoacidi. Il codone AUG non solo codifica per la metionina, ma è anche il segnale per L inizio della traduzione. Tre codoni non codificano per amminoacidi ma sono il segnale per lo stop della traduzione (UAA, UGA e UAG).

18 Nel Codice Genetico c è rindondanza, ma non ambiguità. Più codoni cofificano per uno stesso amminoacido. Ma, ogni codone è specifico per un solo amminoacido. Un codone; un aminoacido. Un aminoacido; più codoni, tranne la metionina ed il triptofano che sono codificati da un solo codone. Es. GAA e GAG codificano per il glutammato, ma non per altri amminoacidi e sono detti codoni sinonimi. I Codoni sinonimi spesso differiscono solo nell ultima base (terzo nucleotide della tripletta).

19 L ordine esatto delle triplette di nucleotidi è un linguaggio molecolare della cellula. Questo ordine è definito come fase di lettura o reading frame. Reading Frame: il corretto raggruppamento delle triplette di nucleotidi (sequenza) che codificano per gli amminoacidi di una catena polipeptidica. es. la sequenza degli amminoacidi Trp Phe Gly- Arg Phe viene codificata dai codoni UGG UUU GGC CGU UUU dell mrna La cellula legge il messaggio nel corretto frame come una serie di triplette non sovrapposte UGG UUU- GGC- CGU- UUU

20 I Geni del DNA non sono tradotti direttamente in amminoacidi, ma sono prima trascritti come codoni di mrna. Il Codone è una sequenza di tre-nucleotidi nell mrna che codifica per l amminoacido che verrà incorporato nella catena polipeptidica nascente; Esso è l unità di base del Codice Genetico.

21 Durante la trascrizione, un filamento di DNA, il template strand o filamento stampo, fa da stampo per comporre la sequeza di nucleotidi dell mrna nascente. La molecola di RNA complementare viene sintetizzata attraverso la complementarietà delle basi e l uracile viene incorporato al posto della timina. Durante la sintesi proteica i codoni composti dalle triplette sono codificati, nella sequenza di amminoacidi di una catena polipeptidica.

22 Il meccanismo di base della trascrizione e della traduzione è simile sia negli eucarioti che nei procarioti. Tuttavia i batteri non hanno il nucleo, perciò trascrizione e traduzione sono accoppiati. I Ribosomi si attaccano all mrna nascente mentre la trascrizione sta ancora funzionando.

23 Gli mrna trascritti dal DNA dei procarioti Trascrizione

24 Gli Eucarioti hanno un nucleo che separa la trascrizione dalla traduzione; La trascrizione di un gene eucariotico risulta in un pre-mrna che è chiamato trascritto primario nel nucleo, il quale contiene gli introni. Il Pre-mRNA è processato nel nucleo e poi viene trasportato nel citoplasma dove avviene la traduzione. Questo è tipico degli eucarioti.

25 In conclusione, l informazione genetica è codificata come sequenza di triplette nonsovrapposte, ognuna delle quali è tradotta in uno specifico amminoacido durante la sintesi proteica.

26 Expressione Genica Il genotipo di un organismo, è l insieme dei suoi geni sul DNA. Il fenotipo rappresenta gli specifici tratti somatici, che sono dovuti all azione di una varietà di differenti proteine. Il flusso dell informazione genetica è dovuto alla conversione del DNA (gene) in mrna e poi esso viene tradotto in un polipeptide.

27 Sommario dei passaggi dell espressione genica

28 Sommario dei passaggi dell espressione genica

29 Sommario dei passaggi dell espressione genica

30 Sommario dei passaggi dell espressione genica

31 Sommario dei passaggi dell espressione genica

32 Sommario dei passaggi dell espressione genica

33 Sommario espressione genica I Geni nel DNA contengono le informazioni per fare le proteine. I geni sul DNA vengono copiati in mrna. L mrna è tradotto sui Ribosomi per produrre le proteine.

34 Tipi di RNA mrna Trasporta l informazione genetica dal DNA e serve per la sintesi proteica. E sintetizzato nel nucleo. rrna rappresenta l 80% di tutti gli RNA della cellula, E un importante componente dei ribosomi. trna E la più piccola classe di RNA. Durante la traduzione, i trna trasportano gli amminoacidi sul ribosoma legandosi al codone dell mrna mediante un anticodone.

35 Principali tipi di RNA Tipo di RNA Localizzazione Funzione RNA Messaggero (mrna) RNA Transfer (trna) Prodotto nel nucleo, viene processato e spedito nel citoplasma Citoplasma Contiene l informazione genetica Trasporta gli amminoacidi Table 10.3 RNA Ribosomale (rrna) Citoplasma Componente strutturale dei ribosomi

36 RNA Polimerasi Le RNA polimerasi compiono le stesse reazioni in tutte le cellule I Batteri hanno una singola RNA polimerasi Mentre gli eucarioti ne possiedono tre: RNA Pol I, II e III

37 RNA Polimerasi L RNA Pol II serve per trascrivere l mrna nelle cellule eucariotiche. L RNA Pol I trascrive gli RNA precursori ribosomiali. L RNA Pol III trascrive principalmente i geni dei trna.

38 Trascrizione Reazione di polimerizzazione catalizzata dall RNA polimerasi Necessita di rntps Necessita di uno stampo Srotola e riavvolge il DNA 4 steps Riconoscimento e legame al filamento stampo Inizio Allungamento Termine e rilascio

39 Filamenti stampo e codificante Filamento codificante (+) 5 TCAGCTCGCTGCTAATGGCC 3 3 AGTCGAGCGACGATTACCGG 5 trascrizione Filamento stampo del DNA detto anche antisenso (-) 5 UCAGCUCGCUGCUAAUGGCC 3 mrna

40 In che modo l RNA Pol II riconosce il sito di inizio della trascrizione? Quattro elementi sul DNA detti sequenze promotrici permettono questo fenomeno

41 Trascrizione Figure 10.7 Proteine e RNA polimerasi si legano alla regione promotrice

42 L inizio della trascrizione è dettata da sequenze nucleotidiche chiamate promotori. La prima fase della trascrizione è detta inizio: L RNA polimerasi si attacca al promotore. Inizia la sintesi dell mrna. La seconda fase della trascrizione è l allungamento: L mrna si allunga. Trascrizione La terza fase della trascrizione è detta termine: L RNA polimerasi riconosce una sequeza sul DNA chiamata terminatore.

43 Trascrizione Figure 10.8 L RNA polimerasi incorpora I nucleotidi partendo dal filamento stampo in direzione 5 3 e crea un mrna con la stessa sequenza nucleotidica del filamento codificante del DNA.

44 Il gruppo OH al 3 dell RNA si lega al fosforo sul nucleotide trifosfato formando un legame fosfoestere con il nucleotide monofosfato, liberando PPi Questa reazione è catalizzata dall RNA polimerasi

45 Si forma una bolla di trascrizione Eucarioti: Differenti RNA polimerasi Non c è un riconoscimento diretto delle sequenze promotrici Occorrono i fattori di trascrizione

46 Allungamento e Termine L allungamento è controllato da: Siti di pausa, dove l RNA Pol rallenta Fattori di allungamento positivi (P-TEF) Fattori di allungamento negativi (N-TEF) Termine Permette la fine della trascrizione; negli eucarioti la sequenza terminatore è AAUAAA

47 Trascrizione

48 Trascrizione

49 Trascrizione

50 Trascrizione

51 Trascrizione

52 Trascrizione

53 Trascrizione

54 La cellula eucariotica processa l mrna dopo la trascrizione. Il processamento dell mrna include: Aggiunta del cap site e della coda di poli A Rimozione degli introni Cucitura degli esoni Trascrizione

55 Caratteristiche generali della sintesi dell RNA Simile alla sintesi del DNA tranne per: I precursori sono ribonucleosidi trifosfati. Al posto della Timina viene incorporato l Uracile. Solo un filamento del DNA è usato come stampo. Le catene dell RNA possono essere sintetizzate de novo (non sono necessari degli inneschi). La molecola di RNA è complementare al filamento stampo del DNA (antisenso) ed è identica (tranne che per l Uracile) al filamento coding del DNA (senso). La sintesi dell RNA è catalizzata dall RNA polimerasi e procede sempre in direzione 5 3.


IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune





DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni



CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso


07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale


Dal gene alla proteina

Dal gene alla proteina Dal gene alla proteina Il collegamento tra geni e proteine La trascrizione e la traduzione sono i due principali processi che legano il gene alla proteina: uno sguardo panoramico Le informazioni genetiche



LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in


Codice Genetico (segue)

Codice Genetico (segue) CODICE GENETICO Nucleotidi, acidi nucleici CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. Consiste


E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento


Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la


COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?


LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si






TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi



IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena


Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:


Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine da sequenze del DN definite geni. Si tratta di un processo a più fasi Nelle sue linee fondamentali questo processo


La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti


Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO wobble base pairs large.png CODICE GENETICO Codice mediante il quale la sequenza nucleotidica


Definizione Composti quaternari: C H O N S P Fe Mg I

Definizione Composti quaternari: C H O N S P Fe Mg I PROTIDI Definizione Composti quaternari: C H O N S P Fe Mg I ORIGINE cellulare ogni cellula sintetizza le sue prote CARATTERISTICHE insolubili in acqua sensibili a variazioni di ph coagulano in presenza











Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie


Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni Evoluzione del concetto di gene Da Mendel ai giorni nostri passando per diverse definizioni Fino al 1940 Teoria perle di una collana, considerate come unità indivisibili Gene = Unita dell informazione



TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione


RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso


Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La


Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui


Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata


E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la


Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- odice genetico- Traduzione dl Infermieristica aa. 2011/12 Prof.ssa Frabetti ESPRESSIONE


La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)



IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi



TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una


Codice Genetico (segue) 29/10/2014 CODICE GENETICO

Codice Genetico (segue) 29/10/2014 CODICE GENETICO CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. CODICE GENETICO Consiste di codoni a tre nucleotidi


SDD Seconde Gli acidi nucleici. Gli acidi nucleici

SDD Seconde Gli acidi nucleici. Gli acidi nucleici 1 Capire come le informazioni genetiche sono immagazzinate nelle cellule e come avviene la trasformazione di queste informazioni nei meccanismi metabolici delle cellule. Quattro mattoncini La cellula ha


LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6


La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza



LE BASI AZOTATE PIRIMIDINE PURINE LE BASI AZTATE PURIE PIRIMIDIE Le basi azotate sono composti eterociclici aromatici con azoti portanti doppietti basici. Possono avere un solo anello (pirimidine) o due (purine). Le basi adenina, guanina



ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel


Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli


Allineamento dei 2 RNA

Allineamento dei 2 RNA La traduzione 2 codone Allineamento dei 2 RNA anticodone Studi Molecolari hanno dimostrato che: 3 residui nucleotidici del mrna sono necessari per codificare ciascun amminoacido Il linguaggio contenuto



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


Definizione TRADUZIONE

Definizione TRADUZIONE Sintesi proteica Definizione La sintesi proteica è costituita da una sequenza di eventi che portano alla formazione di un polimero di amminoacidi (proteina o polipeptide) ad opera dei ribosomi a partire


MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti



SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati


IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957 IL FLUSSO DELL INFORMAZIONE GENETICA DNA à RNA à PROTEINA Dogma centrale della biologia molecolare di Francis Crick, 1957 DNA/RNA (seq polinucleotidica) DNA à RNA mrna trna rrna RNA à PROTEINA Proteina


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


Biologia Molecolare. CDLM in CTF La riparazione del DNA

Biologia Molecolare. CDLM in CTF La riparazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La riparazione del DNA I tipi di mutazione e le conseguenze Le classi di danno al DNA Meccanismi di riparazione La necessità di codificare l informazione L informazione


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza di aminoacidi. Come le mutazioni


David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi



LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole


lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2


Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica Il Codice Genetico La decodifica della sequenza nucleotidica in sequenza aminoacidica La sequenza del mrna viene letta a gruppi di 3 nucleotidi, senza interruzioni e senza sovrapposizioni; 4 3 = 64 ---------64


FISIOPATOLOGIA (Prof. Condorelli)

FISIOPATOLOGIA (Prof. Condorelli) FISIOPATOLOGIA (Prof. Condorelli) LA CELLULA E IL DNA La cellula La cellula è la più piccola struttura ad essere classificabile come vivente; nel corpo umano è possibile individuare più di 200 tipi cellulari


La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici



INTERAZIONE TRA mrna, trna e RIBOSOMI INTERAZIONE TRA mrna, trna e RIBOSOMI mrna: porta l'informazione della sequenza degli aminoacidi di una determinata proteina. trna: ogni trna è specifico per il trasporto di un determinato aminoacido Ribosoma:


GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto.

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto. ceppo S 1 Griffith and Avery 1930 deceduto ceppo R 2 vivo ceppo S ucciso al calore 3 ceppo R 4 vivo ceppo S ucciso al calore deceduto Riproduzione del ceppo S Preparazione del fattore trasformante lisi


Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri


Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


Modulo 8: I nucleotidi e gli acidi nucleici

Modulo 8: I nucleotidi e gli acidi nucleici Modulo 8: I nucleotidi e gli acidi nucleici Modulo 10: Acidi nucleici Filamento di DNA fuoriuscito da una cellula di Escherichia coli Struttura e funzioni dei nucleotidi Funzioni dei nucleotidi: Unità


flusso dell'informazione genetica è monodirezionale

flusso dell'informazione genetica è monodirezionale 5. La Trascrizione contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale dogma centrale della biologia molecolare flusso dell'informazione


Immagini e concetti della biologia

Immagini e concetti della biologia Sylvia S. Mader Immagini e concetti della biologia 2 A3 Le molecole biologiche 3 Il carbonio è l elemento di base delle biomolecole Una cellula batterica può contenere fino a 5000 tipi diversi di composti


FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina



all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA Il Codice Genetico The genetic code consists of 64 triplet codons (A, G, C, U) 4 3 = 64 all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA AUG (methionine)


Corso di Genetica -Lezione 12- Cenci

Corso di Genetica -Lezione 12- Cenci Corso di Genetica -Lezione 12- Cenci Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza


La Terminazione della Trascrizione

La Terminazione della Trascrizione La Terminazione della Trascrizione I geni batterici possiedono dei terminatori della trascrizione. I Terminatori sono sequenze dell RNA che promuovono il distacco dell RNA polimerasi dal templato Ne esistono


Codice genetico CODICE GENETICO [1]

Codice genetico CODICE GENETICO [1] Codice genetico CODICE GENETICO [1] Codice mediante il quale la sequenza nucleotidica di una molecola di DNA, tramite un mrna, specifica la sequenza amminoacidica di un polipeptide. Consiste di codoni


1) Un gene-un enzima 2) Un gene- una catena polipeptidica

1) Un gene-un enzima 2) Un gene- una catena polipeptidica 1) Un gene-un enzima 2) Un gene- una catena polipeptidica 3) Un gene è una unità funzionale di DNA che codifica per la sequenza amminoacidica di uno o più polipeptidi o alternativamente per uno o più tipi


Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito





Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare


mrna + 20 aminoacidi In vitro nulla

mrna + 20 aminoacidi In vitro nulla La sintesi proteica mrna + 20 aminoacidi In vitro nulla Il codice genetico I geni controllano la struttura delle proteine: in che modo? 4 nucleotidi A, T, C, G 20 aminoacidi Esiste un codice che converte


Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE


Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza



ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione


La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione


La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3


Nozioni base di Biologia

Nozioni base di Biologia Nozioni base di Biologia Ripercorriamo velocemente i principali concetti di biologia indispensabili per capire la Bioinformatica: verranno approfonditi in altri corsi. Gli organismi viventi possiedono



LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:





MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte


Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti



ACIDI GRASSI INSATURI LIPIDI ACIDI GRASSI SATURI ACIDI GRASSI INSATURI TRIGLICERIDI TRIGLICERIDI Grassi neutri o lipidi semplici glicerolo + 1 acido grasso monogliceride glicerolo + 2 acidi grassi digliceride glicerolo + 3





Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA Corso di Laurea in Chimica e Tecnologie Farmaceu,che a.a. 2014-2015 Università di Catania Il Codice Gene,co Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del


SUBUNITA MAGGIORE = 60S (rrna 28S, 5.8S e 5S + 45 proteine) SUBUNITA MAGGIORE = 50S (rrna 23S e 5S + 34 proteine)

SUBUNITA MAGGIORE = 60S (rrna 28S, 5.8S e 5S + 45 proteine) SUBUNITA MAGGIORE = 50S (rrna 23S e 5S + 34 proteine) TRADUZIONE I RIBOSOMI I Ribosomi hanno un diametro di circa 15-30 nm, sono costituiti da proteine ed rrna e sia nei Procarioti che negli Eucarioti, sono costituiti da una subunità maggiore e da una subunità


Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo


Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi





Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni


Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,


Composti organici. I composti organici. Atomi e molecole di carbonio. Atomi e molecole di carbonio. Gruppi funzionali. Isomeri

Composti organici. I composti organici. Atomi e molecole di carbonio. Atomi e molecole di carbonio. Gruppi funzionali. Isomeri I composti organici Atomi e molecole di carbonio Carboidrati Lipidi Proteine Acidi nucleici Composti organici Materiale composto da biomolecole - Formate in buona parte da legami ed anelli di carbonio.



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma
