PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi"


1 PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

2 PROGETTO DNA chiavi in mano

3 PROGETTO DNA chiavi in mano


5 PROGETTO DNA chiavi in mano Finalita Stimolare la conoscenza scientifica in campo biologico privilegiando l approccio laboratoriale Offrire un opportunità di aggiornamento teorico e pratico agli studenti del triennio Attuare azioni di orientamento per gli studenti delle classi quarte e quinte. Stimolare l interesse per le Biotecnologie e per i risvolti bioetici Avvicinare mondo della ricerca e mondo della scuola

6 Laboratorio Didattico IFOM

7 MICROPIPETTE per prelevare VORTEX per miscelare I NOSTRI STRUMENTI MICROCENTRIFUGA per separare componenti TRANSILLUMINATORE per visualizzare il DNA su gel di agarosio TERMOCICLATORE per amplificare sequenze di DNA FORNO MICROONDE per riscaldare CELLA ELETTROFORETICA e GENERATORE DI CORRENTE per la corsa elettroforetica

8 Al lavoro nel nostro laboratorio

9 PROGETTO DNA chiavi in mano Attività laboratoriale Apertura del laboratorio ad altre scuole Interna Extracurricolare Curricolare Corsi di potenziamento


11 ELETTROFORESI La tecnica ci permetterà di evidenziare il DNA utilizzando - la forza di un campo elettrico - il supporto di un gel di agarosio

12 GEL di AGAROSIO L'agarosio è un polimero naturale di galattosio e 3,6 anidro-galattosio. Viene sciolto in opportuno tampone (TBE o TAE) e fatto gelificare su un supporto di vetro o di plastica.

13 Ecco cosa fare... Versa l agarosio nel TAE Scalda Aggiungi il Sybr Safe Inserisci il pettine Versa l agarosio nella slitta


15 La separazione del DNA

16 Il campo elettrico Gel di agarosio Polo Negativo DNA (carico -) Polo Positivo Tampone di corsa TAE (Tris Acetato EDTA) Pozzetto (dove carichiamo il DNA) TAE: il Tris consente il mantenimento di un valore costante di ph della soluzione; l acido Acetico fornisce l appropriata forza ionica al tampone; l EDTA chela i cationi bivalenti, come il magnesio ( la maggior parte delle nucleasi richiede cationi bivalenti per funzionare).



19 BPB e XC E' possibile visualizzare la corsa elettroforetica grazie a coloranti inerti: - Blu di bromofenolo - Xilene cianolo che si muovono nel campo elettrico come molecole a PM noto, in relazione alla concentrazione del gel. 1% BPB XC 300 bp bp

20 Il Syber Safe Il DNA viene visualizzato nel gel usando un intercalante, il Sybr Safe, che emette luce verde sotto illuminazione con luce blu

21 Le bande di DNA Una banda rappresenta un area occupata da una popolazione di molecole distinguibile da un altra area.

22 Ecco cosa fare... Aggiungi il Loading Dye Carica i campioni Inizia la corsa Osserva il gel


24 Estrazione del DNA da cellule della mucosa boccale Trasferisci in una provetta sterile 200 m L della soluzione A Immergi lo spazzolino nella provetta sterile Raschia l interno della guancia destra con l apposito spazzolino per 2 minuti Raschia l interno della guancia sinistra con l apposito spazzolino per 2 minuti ECCO IL TUO DNA!! Trasferisci 200 m L di surnatannte in una nuova provetta contenente 300 m L di isopropanolo freddo Aggiungi 20 m L della soluzione B Osserva, poi miscela delicatamente per inversione e osserva nuovamente Miscela con il vortex e centrifuga Lascia in incubazione a 100 C per 10 minuti Miscela con il vortex


26 Digestione enzimatica ed elettroforesi Digestione enzimatica del DNA del Fago Lambda

27 Corsa elettroforetica dei frammenti di restrizione


29 La PCR (Polymerase Chain Reaction) fu inventata nel 1983 da Mullis permette di amplificare una sequenza di DNA (un gene o parte di esso) in vitro, cioe in una provetta, aggiungendo una serie di reagenti e utilizzando un termociclatore

30 Che cosa serve per fare una PCR? DNA che funge da stampo Nucleotidi precursori (dntps: datp, dctp, dgtp, dttp) Buffer o Tampone di reazione (fornisce la giusta concentrazione di Sali, tra cui il Magnesio Cloruro e il giusto ph) Primers Forward e Reverse DNA polimerasi, enzima che utilizza i nucleotidi precursori per copiare un DNA stampo e generarne nuove copie

31 La nostra reazione di PCR DNA : porzione del gene umano SRY Primers: 5 GAATATTCCCGCTCTCCGGA 3 5 GCTGGTGCTCCATTCTTGAG 3 Taq polimerasi

32 La nostra PCR Il termociclatore effettua 35 cicli di Denaturazione-Appaiamento-Polimerizzazione Denaturazione (94 C) Appaiamento dei primer (57 C) Polimerizzazione da parte della DNA polimerasi (72 C)

33 Il gene SRY FONTE UTILIZZATA: National Center for biotechnology Information

34 Questo gene privo di introni codifica un fattore di trascrizione che è il fattore di determinazione testicolare (TDF testis determining factor), che inizia la determinazione sessuale maschile. Mutazioni in questo gene danno origine a individui femminili XY con disgenesi gonadica (sindrome di Swyer); traslocazioni di parte del cromosoma Y contenete questo gene sul cromosoma X causa individui maschili XX

35 Dopo la corsa elettroforetica. Controllo positivo Banda positiva Banda negativa

36 Colleghe e Colleghi, che ne pensate? Vi interessa il nostro progetto? Contattatemi!

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in



PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi


PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica


Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine



REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità



DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti


Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!


Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione


Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato


PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you


Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento



TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi


III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA


Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza





Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento


Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica


PCR Polymerase Chain Reaction = Reazione a catena della polimerasi

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi PR Polymerase hain Reaction = Reazione a catena della polimerasi mplifica un frammento di D di cui si conosce almeno in parte la sequenza Utilizza un enzima, la D Polimerasi, per copiare una molecola di


La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (



ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni


Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. via Raffaele Garofalo, 133 a/b 00173 Roma (06)





Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è


Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva.

Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva. OBIETTIVO DEL LAVORO SPERIMENTALE: TIPIZZAZIONE DEI CROMOSOMI SESSUALI X e Y Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva. Cromosoma X Cromosoma y La tipizzazione


Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del


Biotecnologie e bonifica ambientale

Biotecnologie e bonifica ambientale Biotecnologie e bonifica ambientale Prof. Laura Martinis Liceo Scientifico G. Marinelli Prof. Massimo Vischi e Luca Marchiol - Facoltà di Scienze Agrarie dell Università di Udine Cl. III B Noi studenti


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione



SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:



AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita



ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi


U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario


Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno).

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Programma: Giorno 1Preparazione di DNA genomico da foglie 2 - Controllo qualità DNA


Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica



PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA


Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio



LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni


Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II


PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando


Progetto POF LAB 3 a.s. 2014-2015. Concorso CusMiBio Una settimana da ricercatore 2015

Progetto POF LAB 3 a.s. 2014-2015. Concorso CusMiBio Una settimana da ricercatore 2015 Progetto POF LAB 3 a.s. 2014-2015 Concorso CusMiBio Una settimana da ricercatore 2015 Nel precedente a.s. 2013-2014, alcuni studenti dell Istituto hanno partecipato all edizione 2014 del concorso Una settimana


Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni


PCR. (Reazione a Catena della Polimerasi) Kary Mullis

PCR. (Reazione a Catena della Polimerasi) Kary Mullis POLYMERASE CHAIN REACTION - PCR PCR Polymerase Chain Reaction (Reazione a Catena della Polimerasi) Kary Mullis Premio Nobel per la Chimica nel 1993, Kary Mullis è divenuto una leggenda per la scoperta


0,8% riesce a separare un range di dimensioni da circa 500 bp a circa bp.

0,8% riesce a separare un range di dimensioni da circa 500 bp a circa bp. L elettroforesi è una tecnica che utilizza un campo elettrico per separare e visualizzare frammenti di DNA in base al loro peso molecolare ed alla loro carica. Gli acidi nucleici, migrano sempre verso


Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare



PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi






DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando


Relazione conclusiva delle esperienze di laboratorio

Relazione conclusiva delle esperienze di laboratorio Relazione conclusiva delle esperienze di laboratorio Emiliano Giovanni Vavassori Allievo Ordinario Settore di Agraria Scuola Superiore di Studi Universitari e di Perfezionamento Sant


DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza


Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA


Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)


Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale


Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando


determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Metodi di studio delle proteine : determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Spettrofotometro cuvetta monocromatore rivelatore


Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare


PROGETTO BIOFORM. Tipizzazione del gene PV92

PROGETTO BIOFORM. Tipizzazione del gene PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole cellule. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto


Principali tecniche di base

Principali tecniche di base Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione (Southern blotting) PCR (Polymerase Chain Reaction) (Sequenziamento) Tecniche di base Enzimi di di restrizione


Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente


Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico.

Real Time PCR. La PCR Real Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. eal Time PC La PC eal Time è in grado di misurare in tempo reale la concentrazione iniziale di una sequenza target in un campione biologico. Gli strumenti per PC eal Time, oltre a fungere da termociclatori,


Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,


scienza come gioco i segreti del DNA

scienza come gioco i segreti del DNA IS science centre immaginario scientifico Laboratorio dell'immaginario Scientifico - Trieste tel. 040224424 - fax 040224439 - e-mail: - indice Estrazione


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT


Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti



PROCEDURA NEGOZIATA PER LA FORNITURA DI PRODOTTI PER BIOLOGIA MOLECOLARE OCCORRENTI ALLA U.O. DI EMATOLOGIA AZIENDA OSPEDALIERA REGIONALE SAN CARLO DI POTENZA Ospedale S. Carlo di Potenza Ospedale S. Francesco di Paola di Pescopagano Via Potito Petrone 85100 Potenza Tel. 0971-61 11 11 Codice Fiscale e Partita


Kit per la determinazione di contaminazioni in biologia molecolare REF 7091. 40 Reazioni

Kit per la determinazione di contaminazioni in biologia molecolare REF 7091. 40 Reazioni IT Istruzioni d uso Wipe test Controllo di contaminazione Kit per la determinazione di contaminazioni in biologia molecolare REF 7091 40 Reazioni 1. Descrizione del prodotto Per impedire le contaminazioni


Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Come «vedere» il DNA: la PCR PCR = Polymerase Chain Reaction (reazione a catena della polimerasi)


Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS


Elettroforesi in gel di Agarosio

Elettroforesi in gel di Agarosio Elettroforesi in gel di Agarosio Le molecole di DNA possono essere separate in base alla loro dimensione, facendole migrare attraverso una matrice polimerica sotto l attrazione di un campo elettrico 1


Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Moria del pero (Candidatus Phytoplasma pyri) Fitoplasmi: Microrganismi


Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni Corso di: GESTIONE FAUNISTICA Prof. Bernardino Ragni Università degli Studi di Perugia Facoltà di Scienze Matematiche Fisiche Naturali Corso di laurea in Scienze Naturali LAUREA MAGISTRALE Caso di studio:


Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM)

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) Lezione 7-8 Giovedì 18 Marzo 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) materiale del T-Rex system pfrt/laczeo = Flp-In target site vector for stable transfection


Kit didattico Edvotek: la Tecnica del DNA fingerprinting

Kit didattico Edvotek: la Tecnica del DNA fingerprinting International pbi S.p.A. Milano Copyright pbi MARZO 2003 Kit didattico Edvotek: la Tecnica del DNA fingerprinting Introduzione L analisi del profilo di restrizione del DNA, detto anche DNA fingerprinting,


ZytoLight SPEC ERG Dual Color Break Apart Probe

ZytoLight SPEC ERG Dual Color Break Apart Probe ZytoLight SPEC ERG Dual Color Break Apart Probe IVD Dispositivo medico-diagnostico in vitro Produttore: ZytoVision GmbH Codice: Z-2138-200 (0.2ml).. Per l identificazione della traslocazione che coinvolge


Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale


Istruzioni d uso HISTO TYPE SSP Kits Bassa risoluzione

Istruzioni d uso HISTO TYPE SSP Kits Bassa risoluzione Istruzioni d uso HISTO TYPE SSP Kits Bassa risoluzione 0123 Kits per la tipizzazione tissutale degli alleli HLA (Classe I: HLA-A, B, C e Classe II: HLA-DR, DQ) in biologia molecolare IVD 20 tipizzazioni





Laboratorio di Microbiologia Referente: Prof. Carla Vignaroli. I nostri inquilini invisibili

Laboratorio di Microbiologia Referente: Prof. Carla Vignaroli. I nostri inquilini invisibili Laboratorio di Microbiologia Referente: Prof. Carla Vignaroli I nostri inquilini invisibili Viviamo quotidianamente in compagnia di una moltitudine invisibile di microrganismi, che si trova nell ambiente



PROGETTO VERSO IL FUTURO CON L INGEGNERIA GENETICA a.s. 2012/2013 PROGETTO VERSO IL FUTURO CON L INGEGNERIA GENETICA a.s. 2012/2013 PROTOCOLLI SPERIMENTALI FASE 1: Preparazione delle cellule competenti modificato da Maniatis Metodo Materiali Motivazioni Strumenti Utilizzare


Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail:


PROGETTO BIOFORM. Tipizzazione del locus PV92

PROGETTO BIOFORM. Tipizzazione del locus PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole celle. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI


PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,


Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita.

Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. Elettroforesi Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. A qualunque ph diverso dal pi le proteine hanno una carica netta quindi,


Tecniche molecolari per la diagnosi di funghi fitopatogeni

Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche che consentono l identificazione, la diagnosi, la quantificazione di un organismo mediante l analisi degli acidi nucleici: DNA RNA Diagnosi


Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria


Tecniche di biologia molecolare

Tecniche di biologia molecolare Tecniche di biologia molecolare Obiettivi dello studio: conoscere i principi base delle tecnologie e le possibili applicazioni Cdl Tecnici di Lab. Biomedico Aa. 2011-12 Prof.ssa Flavia Frabetti Sensibilità:


Università degli Studi di Torino Dipartimento di Anatomia, Farmacologia e Medicina Legale Laboratorio di Scienze Criminalistiche.

Università degli Studi di Torino Dipartimento di Anatomia, Farmacologia e Medicina Legale Laboratorio di Scienze Criminalistiche. Università degli Studi di Torino Dipartimento di Anatomia, Farmacologia e Medicina Legale Laboratorio di Scienze Criminalistiche Genetica Forense Sarah Gino SAL (STATO AVANZAMENTO LAVORI) Informazioni



RISOLUZIONE ENO 24/2004 RICERCA DI SOSTANZE PROTEICHE DI ORIGINE VEGETALE NEI VINI E NEI MOSTI L'ASSEMBLEA GENERALE, Visto l'articolo 2 paragrafo 2 iv dell'accordo del 3 aprile 2001 che istituisce l'organizzazione internazionale


Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


5- Estrazione ed analisi di DNA

5- Estrazione ed analisi di DNA 5- Estrazione ed analisi di DNA Corso 240/350: Didattica di biochimica e biologia molecolare con laboratorio (2 CFU) 16 ore) Marco Scocchi ( BIO/10-11) La struttura del DNA La traduzione dell informazione


1. Quantificazione del genomico e determinazione della purezza

1. Quantificazione del genomico e determinazione della purezza ESERCITAZIONE 2 1. Quantificazione del genomico e determinazione della purezza Una volta estratto il DNA si procede con la quantificazione. Tale quantificazione viene fatta normalmente con l utilizzo di
