Nucleo 21/10/15. Nucleo. Nucleo. Involucro nucleare: sistema doppio di membrane separate, continuo al RER, senza ribosomi sulla faccia interna

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Nucleo 21/10/15. Nucleo. Nucleo. Involucro nucleare: sistema doppio di membrane separate, continuo al RER, senza ribosomi sulla faccia interna"

Transcript

1 Organulo più voluminoso (5 µm) Rapporto /plasmatico: indice caratteristico delle cellule somatiche di un organismo => divisione cellulare Forma: correlata alla cellula; regolare (fusata, sferica, ellittica...) o irregolare Posizione: correlata alla funzione (centrale, polare...) Numero: 1 (maggior parte), 2 o più (sincizi, come osteoclasti e macrofagi) Involucro nucleare: sistema doppio di membrane separate, continuo al RER, senza ribosomi sulla faccia interna 1

2 Involucro nucleare Composizione di membrana: Proteine 70 Lipidi 23 Membrana esterna => proteine RE simili Membrana interna => proteine integrali specifiche per l attacco della lamina fibrosa (nucleoscheletro) scheletro Lamina fibrosa o nucleare: reticolo di lamìne (Lamine A, B, C) a ridosso della membrana interna: è responsabile del mantenimento e della ricostituzione dell involucro nucleare. Vi aderisce la cromatina 7-9 nm nm 7-9 nm scheletro depolimerizzazione A e C (oligo- e monomeri) Mitosi cdc2 (Chinasi > fosforilazione) B legata Ripolimerizzazione e ri-formazione del nucleo Apoptosi Caspasi proteolisi Frammentazione del nucleo e morte cellulare 2

3 Poro nucleare Importine Esportine Funzioni di riconoscimento molecolare del traffico nucleo-citoplasma attraverso i pori nucleari (10-15 nm) Sistema di trasporto a due vie di macromolecole (5-60 kda), ATP dipendente Annulus o complesso del poro (125 nm) proteine globulari => porine (famiglia > 100) Complesso macromolecolare (120MDa!) 2 anelli (nucleare e citoplasmatico) 1 anello intermedio (colonnare) > 8 subunità colonnari 8 subunità radiali (annulari) > ancoraggio > Transporter componenti fibrillari (fibre citoplasmatiche e canestro nucleare) > riconoscimento molecolare NLS: Nuclear localization signal (sequenze 4-8 aa) NES: Nuclear exportation signal (sequenze 8-10 aa) Ran: GTPasi per energia trasporto attraverso il poro Importine α e β: Transfer citoplasma > nucleo Esportine: Transfer nucleo > citoplasma Traffic e Cromatina Citoplasma 3

4 Cromatina e DNA Cromatina Organizzata in strutture granulari, i nucleosomi (associazione con istoni) Architettura della cromatina: DNA e Istoni L aumento di complessità del genoma si accompagna con un aumento del suo grado di organizzazione DNA DNA Caratteristiche: Eucarioti Filamentoso Stabilità (correzione e riparazione) Quantità costante (2n > 4n > 2n, n) Procarioti Genoforo, unico cromosoma circolare Cromatina geni (mammals) geni 180 cm/cell H. sapiens 1.4 mm/ E.coli Cromosoma Cromatina: DNA e Istoni somi H2A, H2B, H3, H4 nucleo istonico del nucleosoma H1 blocco di chiusura del rocchetto istonico Protamine: istoni leggeri dello spermatozoo. Vengono sostituiti dopo la fecondazione. Alcuni procarioti possiedono proteine simil-istoniche 60 bp 147 bp 200 bp 4

5 Addendum Struttura (nucleo interfasico) Proteine non-istoniche - proteine della matrice nucleare e proteine strutturali legate al DNA e agli istoni (scaffold) - proteine contrattili (actina, miosina, α e β tubulina) - proteine regolatrici trascrizione genica: fattori di trascrizione, enhancers... (binding a specifiche sequenze DNA) - proteine di trascrizione e processamento RNA (RNA pol I, II, III; capping e poli-a, splicing) La componente fondamentale è la cromatina: Cromatina > DNA e proteine lo (1 o più) > RNA e proteine Matrice nucleare (nucleoplasma) ETEROCROMATINA 90%: condensata, zolle e addensamenti granulo-filamentosi >>> TRASCRIZIONALMENTE INATTIVA - proteine enzimatiche di duplicazione DNA (replisoma) - proteine di ricombinazione, riparazione, elicasi, topoisomerasi, ecc. EUCROMATINA 10%: dispersa, filamentosa, poco colorabile suddivisa in: >>> EUCROMATINA TRASCRIZIONALMENTE INATTIVA (maggior parte) >>> EUCROMATINA TRASCRIZIONALMENTE ATTIVA % di eucromatina ed eterocromatina varia a seconda dello stato funzionale della cellula (attività trascrizionale) Cromatina EU DNA a copia singola: geni strutturali (almeno 2 nella cellula 2n); codifica mrna DNA mediamente ripetitivo: centinaia di copie rrna e trna, geni strutturali di proteine istoniche, promoters e enhancers ET DNA altamente ripetitivo: centinaia di migliaia a milioni di copie sequenze brevi, non codificano RNA; denominato DNA satellite, localizzato in diverse zone dei cromosomi (eterocromatina costitutiva), centromero e telomeri... Ruolo? strutturale? eterocromatina facoltativa: può trasformarsi in eucromatina ed essere trascritta eterocromatina costitutiva: permanentemente inattiva Centromero: zona di unione dei cromosomi omologhi Telomeri: sequenze ripetute alle estremità del cromosoma (contatore mitotico > cloning) 5

6 Genoma silente: Metilazione del DNA (5-metil Citosina) Le regioni di eterocromatina (hanno DNA iper-metilato ed istoni deacetilati) Le regioni di eucromatina (hanno DNA de-metilato ed istoni iperacetilati) Genoma silente e genoma attivo: istoni e spiralizzazione del DNA Condensazione silenzia! cromosoma metafasico: nessuna trascrizione Genoma silente e genoma attivo: istoni e spiralizzazione Modificazioni post-traduzionali degli istoni Genoma silente e genoma attivo: istoni e spiralizzazione Ubiquitinazione: silenzia? Modificazioni posttraduzionali degli istoni IPERFOSFORILAZIONE dell Istone H1 durante la superspiralizzazione della cromatina a formare i cromosomi Fosforilazione: silenzia! ACETILAZIONE AMINOTERMINALE: ATTIVA LA CROMATINA Acetilazione: attiva! metilazione acetilazione 6

7 GBE, July 2014 Diff DNA methyl region Copy number variation Lamarck return? Ecological and Evolutionary Medicine 7

8 Sede di trascrizione e splicing dei rrna ed assemblaggio ribosomi Corpuscolo sferico il cui numero varia da 1 a 6 Incrementa in volume in funzione dell attività di sintesi proteica lo Costituito da: - DNA (organizzatori del nucleolo) - 80 proteine - RNA pol I e III (45S e 5S) - nucleolina (trasporto < >) - snrnp U3 Suddiviso in: Componente granulare (pars granularis) => Assemblaggio ribosomi Componente fibrillare (pars fibrillaris) => RNA DNA e proteine Cromatina associata al nucleolo o perinucleolare Cromatina associata al nucleolo lo Organizzatore del nucleolo No ha membrana! Nella componente fibrillare è presente la componente degli organizzatori del nucleolo, una porzione proveniente da diversi cromosomi (10 nell uomo) che scompare nella profase e si si ricostituisce alla fine della telofase lo Addendum Matrice nucleare: 3 componenti Lamina nucleare Reticolo fibronucleare Residui nucleolari plasma La matrice nucleare è un network proteico che fornisce una impalcatura per strutturare e per organizzare la cromatina, facilitandone nel contempo le attività di trascrizione e replicazione 40 Le proteine più rappresentate sono le nucleoplasmine e le lamine La lamina fibrosa contiene anche vimentina ed actina Il DNA si associa mediante specifiche sequenze alla matrice 60 8

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti 2011-2012 La cellula è l unità strutturale e funzionale degli organismi viventi 1 BASE CELLULARE DELLA VITA Teoria cellulare (Schleiden e Schwann 1839;

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA

ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA Costituisce gli gli organismi PROCARIOTI = unicellulari BACILLI (bastoncelli) COCCHI (sferici) SPIRILLI (spirale) 0.3-2 µm Streptococchi (catenella) Stafilococchi,

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia Ingegneria delle tecnologie per la salute Anatomia e istologia umana Cenni di Biologia Macromolecole: Glucidi Lipidi Proteine Acidi nucleici glucidi Monosaccaridi: glucosio, fruttosio, galattosio, desossiribosio,

Dettagli

Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg http://270c81.medialib.glogster.com/media/3b/3b966af047cca0605f106aa1a34dd3451287c5e41a0c7ce8ce537f74bbb795eb/main

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti NUCLEO Il nucleo è la centrale operativa che controlla i vari processi che si svolgono dentro la cellula. Contiene il materiale genetico DNA e proteine. Quando la cellula è a riposo il DNA è sotto forma

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

PARTE PRIMA EMBRIOLOGIA GENERALE

PARTE PRIMA EMBRIOLOGIA GENERALE PARTE PRIMA EMBRIOLOGIA GENERALE 21 Capitolo 1 L ovocita e lo spermatozoo Inizieremo lo studio dell embriologia umana con la descrizione di due cellule molto speciali che, interagendo in un processo chiamato

Dettagli

Fig.4.1 Cellula animale e organuli cellulari (da Hickman e Roberts, 2000).

Fig.4.1 Cellula animale e organuli cellulari (da Hickman e Roberts, 2000). CAP. 4 La cellula come base della vita. Cellula animale e vegetale. Organuli cellulari: morfologia e funzioni. Componenti della cellula: I componenti chimici della cellula possono essere classificati in:

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy astr.gsu.edu/hbase/biology/ribosome.html http://www.accessexcellence.org/rc/vl/gg/ecb/ecb_images/01_24_organelles.jpg

Dettagli

Proteine da stress e chaperon molecolari

Proteine da stress e chaperon molecolari Proteine da stress e chaperon molecolari Sono state recentemente descritte alcune proteine che sono coinvolte in generale nel ripiegamento di altre proteine. Furono, in origine, descritte come proteine

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie

Dettagli

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Docente: dott. Tiziano Baroni (tbaroni@unipg.it) Il corso (1 CFU=30 ore), affronterà argomenti teorici e pratici concernenti

Dettagli

INFORMAZIONI PER GLI APPELLI DI ESAME:

INFORMAZIONI PER GLI APPELLI DI ESAME: Biologia della Cellula e dei Tessuti (Corso A) 12 ECTS Docenti: I. Perroteau (Biologia della Cellula) B. Dore (Biologia dei Tessuti) S. De Marchis (laboratorio di colture cellulari) 1 INFORMAZIONI PER

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE

MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE MODIFICAZIONI POST-TRADUZIONALI DELLE PROTEINE Nell ultima fase della sintesi proteica la catena polipeptidica neosintetizzata assume spontaneamente la sua conformazione nativa (massimo numero di legami

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

LE MOLECOLE DI RNA: rrna trna mrna

LE MOLECOLE DI RNA: rrna trna mrna LE MOLECOLE DI RNA: rrna trna mrna RNA polimerasi Localizzazione Prodotti Effetti dell α-amanitina I Nucleolo 25S, 17S e 5.8S rrna Nessuno II Nucleoplasma mrna, U1, U2, U4 e U5 Fortemente inibitori III

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi Enorme diversità di forme Costanza di struttura interna La cellula è l unità fondamentale di tutti gli organismi viventi

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

LA MOLTIPLICAZIONE DEI VIRUS

LA MOLTIPLICAZIONE DEI VIRUS LA MOLTIPLICAZIONE DEI VIRUS I virioni, rappresentano la fase biologicamente inattiva, dei singoli virus. Le diverse famiglie di virus utilizzano strategie replicative a causa della differente organizzazione

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Costituzione dei viventi

Costituzione dei viventi Costituzione dei viventi La materia e costituita da elementi chimici in forma pura o in combinazioni dette composti 25 dei 92 elementi naturali sono costituenti essenziali dei viventi 4 (C, O,, N) costituiscono

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da

Dettagli

MOLTIPLICAZIONE CELLULARE

MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

TECNICHE DI ANALISI BIOLOGICHE

TECNICHE DI ANALISI BIOLOGICHE TECNICHE DI ANALISI BIOLOGICHE VENERDÍ 15.12.2006 Flow chart: 1. struttura cellulare; 2. genesi cellulare; 3. organizzazione cellulare; 4. compartimentazione cellulare; 5. struttura del d.n.a.; 6. topografia

Dettagli