Il DNA funziona da stampo per la sintesi di molecole di RNA. In questo modo l informazione genetica diventa direttamente utilizzabile per la cellula

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il DNA funziona da stampo per la sintesi di molecole di RNA. In questo modo l informazione genetica diventa direttamente utilizzabile per la cellula"

Transcript

1 TRASCRIZIONE

2 Il DNA funziona da stampo per la sintesi di molecole di RNA. In questo modo l informazione genetica diventa direttamente utilizzabile per la cellula Capacità di esprimersi dell informazione genetica DOGMA CENTRALE DNA (linguaggio chimico=nucleotidi) TRASCRIZIONE RNA (linguaggio chimico=nucleotidi) TRADUZIONE PROTEINE (linguaggio chimico=aminoacidi)

3

4 mrna: porta l'informazione per la sintesi di una determinata proteina. trna: molecola adattatrice - ogni trna è specifico per il trasporto di un determinato aminoacido converte sequenze di nucleotidi in sequenze di amminoacidi Ribosoma: INTERAZIONE TRA mrna, trna e RIBOSOMI officina che permette il corretto appaiamento tra mrna e i diversi trna e partecipa attivamente alla formazione della catena proteica.

5

6 Nel piano: il filamento 5' 3' assume una forma detta a quadrifoglio -zone a bracci in cui le basi sono appaiate -anse senza appaiamento per basi modificate post-trascrizionalmente Iniziando dal 5 : - ANSA D: vi si lega l'enzima aminoacilsintetasi specifico per legare un determinato aminoacido al suo trna. - ANSA dell'anticodone: contiene una tripletta complementare e antiparallela al codone che sull'mrna codifica per un determinato aminoacido. - Un'ansa variabile STRUTTURA MOLECOLARE DEL trna - ANSA del TϕC (ϕ=pseudouracile): necessaria per il legame tra il trna e rrna 5S presente nella subunità grande del ribosoma. Il trna termina al 3' con un codone CCA (aggiunto postrascrizionalmente) a cui viene legato l'aminoacido specifico di quel trna.

7 Il trna nello spazio si ripiega in una struttura detta a L rovesciata dove rimangono bene accessibili l'ansa dell'anticodone e l'aminoacido legato.

8 Esempio di reazione di legame dell'aminoacido al trna aminoacilsintetasi leu (specifico per leucina) trna + LEUCINA+ ATP (energia) trna LEU + AMP+P+P L'aminoacido con il suo gruppo carbossilico (-COOH) si lega all'-oh del C 3 del ribosio del nucleotide (A) al 3' del trna. Le aminoacil-sintetasi aminoacido. sono 20 una per ogni Ognuna trasferisce un AA diverso sul rispettivo trna. I trna sono più di 20 (circa in procarioti e anche 50 in Eucarioti) per cui ad alcuni aminoacidi corrisponde più di un trna.

9

10 STRUTTURA MOLECOLARE DEL RIBOSOMA Il ribosoma ha una struttura molecolare complessa formata da rrna e proteine ribosomiali. In eucarioti gli rrna vengono prodotti nel nucleolo (tranne il 5S prodotto nel nucleo) dove entrano anche le proteine ribosomiali prodotte nel citoplasma che si assemblano con i rispettivi rrna per dare i ribosomi. In procarioti tutto ciò avviene nel citoplasma. I ribosomi procariotici sono più piccoli dei ribosomi eucariotici. Le differenze tra ribosomi procariotici ed eucariotici sono dovute al numero e alle grandezze diverse degli rrna e al numero e alle grandezze diverse delle proteine. I ribosomi sono formati da due subunità (piccola e grande) che si assemblano solo al momento della traduzione (le due subunità ribosomiali si assemblano e diventano funzionali solo in presenza di mrna).

11 Assemblaggio del ribosoma citoplasma Proteine del ribosoma citoplasma nucleolo Nucleo Pori nucleari

12 Sito A per l aminoacil-trna Sito P per il peptidil-trna

13 IN PROCARIOTI STRUTTURA DEGLI mrna Il filamento di mrna inizia con una sequenza detta LEADER, che non viene tradotta in proteina, contenente la sequenza di Shine-Delgarno. Tale sequenza si appaia durante la traduzione con l'rrna 16S. La sequenza codificante inizia sempre con la tripletta AUG e termina con una tripletta detta di STOP. Segue un tratto detto TRAILER (rimorchio) non codificante. I geni che codificano per proteine sono POLICISTRONICI (ad un unico promotore seguono tutti i geni di una determinata via metabolica per cui vengono trascritti tutti contemporaneamente). IN EUCARIOTI L'mRNA ha struttura simile a quella dei Procarioti. In aggiunta: -5 CAP (7-metilguanosina): si legherà all'rrna 18S durante la traduzione -coda di polia al 3'. I geni che codificano per proteine sono MONOCISTRONICI (ciascun gene ha il suo proprio promotore).

14

15 IL CODICE GENETICO Perché avvenga la traduzione è necessario passare da un linguaggio fatto di NUCLEOTIDI ad un linguaggio di AMINOACIDI. Gli aminoacidi presenti in tutte le proteine sono 20 mentre le basi sono solo 4. Se ogni base specificasse per 1 amminoacido, avremmo solo 4 aminoacidi specificati 4 1 =4. Se la combinazione di due basi specificasse per 1 aminoacido, avremmo:4 2 =16 aminoacidi specificati. Se la combinazione di tre basi specificasse per 1 aminoacido, avremmo: 4 3 =64 combinazioni per 20 aminoacidi. Il codice pertanto è a triplette, cioè la combinazione di tre basi specifica per 1 aminoacido. Ogni tripletta è detta CODONE. Esistono 3 triplette non codificano per nessun aminoacido e sono dette di STOP (UAG; UAA; UGA).

16 Poiché ci sono 64-3 (codoni di stop)=61 triplette per 20 aminoacidi si dice che il codice è DEGENERATO o RIDONDANTE cioè ogni aminoacido può essere specificato da più di un codone. Esempio: leucina 6 codoni, valina 4 codoni, triptofano e metionina 1 codone, etc. (Si può osservare inoltre che i diversi codoni per un aminoacido sono diversi soprattutto nella 3 base). CARATTERISTICHE DEL CODICE GENETICO Il codice genetico è UNIVERSALE cioè uguale per tutti gli esseri viventi tranne alcune eccezioni. Il codice genetico NON E' AMBIGUO cioè un determinato codone specifica per un solo aminoacido. Il codice genetico è senza punteggiature cioè viene letto linearmente (di tre basi in tre basi) e non è sovrapponibile (es. la stessa base non può essere letta come l ultima di un codone e la prima del successivo).

17

18

19 MUTAZIONI PUNTIFORMI IN ZONE CODIFICANTI una base -Transizione da purina a purina (A o G) o da pirimidina a pirimidina (C o T) -Trasversione da purina a pirimidina o viceversa Conseguenze: 1) nessuna se ad essere colpita è la terza base di un codone e il nuovo codone codifica per lo stesso aminoacido 2) cambio dell'aminoacido specificato dal codone ora mutato 3) proteina più corta se un codone per l'aminoacido si tramuta in un codone di STOP Es. UUA UAA (Leu stop) 4) proteina più lunga se ad esempio da un codone di stop per mutazione si passa ad un aminoacido qualsiasi B) DELEZIONE o INSERZIONE di una base Cambio della cornice di lettura. Da quel nucleotide (deleto o inserito) la proteina sarà tutta diversa perché a codoni diversi corrisponderanno AA diversi AUG CAA CCC GGA UAA GCU UAA (delezione) AUG CAA CCC GGU AAG CUU AA

20

21

22 TRADUZIONE 1) La lettura dell'mrna procede in direzione 5' 3 2) La sintesi proteica procede dall'estremità N-terminale all'estremità C-terminale del polipeptide 3) La traduzione ha inizio sempre con Formil-metionina in Procarioti Metionina in Eucarioti. Il codone per Metionina è AUG L'anticodone è UAC.

23 1) INIZIO: L'mRNA si lega alla SUBUNITA' PICCOLA ribosomiale e al trna met (codone con anticodone) grazie a fattori di inizio (3 in procarioti, 7/8 in eucarioti) e ad 1 GTP GMP+P+P che dona energia necessaria per il legame. L'mRNA in procarioti si lega con la sequenza SHINE-DALGARNO al 16S rrna mentre in eucarioti l'mrna si lega con il cappuccio (5-metilguanosina) al 18S rrna. Successivamente si assembla la SUBUNITÀ GRANDE contenente due siti detti A e P per accogliere i trna. Solo il 1 trna met si lega direttamente al sito P.

24

25

26 2) ALLUNGAMENTO Il 2 trna con l AA corrispondente si lega all'mrna (2 codone/anticodone) e alla subunità grande, nel sito A del ribosoma, grazie a fattori di allungamento (in Procarioti Ts e Tu, in Eucarioti Ef1-Ef1β) e ad 1 molecola di GTP che si scinde donando energia. Il legame che si forma tra i due AA avviene tra il gruppo carbossilico (-COOH) della metionina e il gruppo amminico (-NH 2 ) del 2 AA (legame peptidico). Enzima responsabile è la Peptidil-transferasi. Dopo la formazione del legame peptidico il 1 trna, rimasto scarico della metionina, viene allontanato dal sito P. Avviene quindi la traslocazione: l'mrna scivola di un codone trascinandosi il 2 trna che passa dal sito A al sito P, lasciando il sito A libero per l'attacco del 3 trna. Questa traslocazione è mediata da un fattore di traslocazione e dalla scissione di una molecola di GTP. Il ciclo si ripete tante volte quanti sono gli AA che devono essere legati.

27

28 3) TERMINAZIONE Quando sul sito A si trova un codone di STOP, a cui non corrisponde nessun trna, la sintesi si arresta. Inoltre esistono fattori di rilascio che si legano al sito A impedendo comunque l'attacco dei trna. La catena polipeptidica si stacca dall'ultimo trna grazie ad un enzima (idrolasi) con consumo di una molecola di GTP. Le due subunità ribosomiali si disassemblano.

29

30

31

32

33 Esempio: IL VACILLAMENTO DELLE BASI Il legame tra codone e anticodone è complementare e antiparallelo. 3'CAG5' (anticodone) 5'GUC3' (codone) Il numero dei codoni (61) è più grande di quello degli anticodoni. 61 codoni (3 sono codoni di stop) mentre i trna sono circa in procarioti e anche 50 in Eucarioti) Questo implica che alcune molecole di trna con il loro anticodone sono capaci di accoppiarsi a più di un codone.

34 Alcuni trna hanno una struttura tale da richiedere un appaiamento accurato nelle prime due posizioni del codone (5') e da tollerare un appaiamento scorretto (oscillante) in terza posizione. Questo appaiamento approssimativo rende possibile combinare 20 AA ai loro 61 codoni servendosi per esempio di solo 30/50 molecole di trna. Frequentemente al 5' dell'anticodone (corrispondente alla terza base del codone) esiste la base modificata inosina capace di complementarsi sia con A, C, U.

35 BILANCIO ENERGETICO DELLA TRADUZIONE Esempio proteina di 100 aa 1 GTP per il complesso di inizio 99 GTP per l'attacco dei 99 trna 99 GTP per la traslocazione dei 99 trna 1 GTP per il rilascio della proteina Totale 200 GTP che corrisponde a 2 GTP per ogni aminoacido. Riassumendo 1AA=2GTP

36

37 PROTEINE Le proteine sono dei polimeri di aminoacidi detti anche catene polipeptidiche. Gli aminoacidi possono essere destrogiri (D-) e levogiri (L-). Negli organismi viventi sono presenti solo L-aminoacidi. Gli aminoacidi sono 20. Ciascun aminoacido è costituito da un Cα a cui sono legati un gruppo carbossilico (COOH), un gruppo amminico (NH 2 ), un H, e un gruppo variabile detto radicale. I radicali conferiscono ad ogni aminoacido la propria specificità.

38 -APOLARI (idrofobici) che contengono nel radicale un gruppo idrofobico ( es.- CH3) -POLARI (idrofilici) che si suddividono in: POLARI ACIDI che contengono nel radicale un gruppo acido (es.-cooh), POLARI BASICI che contengono nel radicale un gruppo basico (es.-nh2), POLARI NON CARICHI che contengono nel loro radicale sia un gruppo acido che un gruppo basico o comunque un gruppo idrofilico per cui il loro ph è neutro.

39 Gli aminoacidi tra loro sono legati con un legame peptidico che si forma tra il gruppo COOH di un aminoacido e il gruppo NH 2 del successivo aminoacido con l'eliminazione di una molecola di acqua. Questo legame è un legame covalente più forte perché più breve del singolo legame e quindi si avvicina ad avere le caratteristiche di un doppio legame.

40 Le proteine presentano tre livelli di struttura e alcune anche un quarto livello. STRUTTURA PRIMARIA LE PROTEINE E LORO STRUTTURA E' rappresentata dalla sequenza lineare degli aminoacidi legati da legami peptidici determinata dal gene. STRUTTURA SECONDARIA Gran parte delle proteine, anche se in alcuni punti hanno una struttura irregolare, presentano lunghi tratti con una struttura regolare ad α-elica o a foglietto pieghettato β. L'α-elica e il foglietto pieghettato β sono dati da legami ad H che si instaurano tra differenti gruppi peptidici. Nell' α-elica l'ossigeno carbossilico di ciascun legame peptidico forma un legame ad idrogeno con l'idrogeno del gruppo amminico dell'aminoacido che si trova quattro residui più avanti nella sequenza lineare. Nel foglietto pieghettato β i legami ad H si instaurano tra gli atomi che formano i legami peptidici appartenenti a catene polipeptidiche diverse o a porzioni dello stesso polipeptide ripiegato su se stesso.

41

42

43 STRUTTURA TERZIARIA La struttura terziaria è determinata da legami che si formano tra radicali di diversi aminoacidi che organizzati nelle strutture secondarie vengono a trovarsi vicino. Tali legami possono essere di tutti i tipi ( ionici, covalenti, ad idrogeno, idrofobici etc ) e determinano la struttura tridimensionale della catena polipeptidica (es. proteine globulari). La struttura terziaria viene modificata inoltre dalle interazioni degli aminoacidi con l'ambiente in cui la catena polipeptidica si trova. (es. proteine di membrana tenderanno ad esporre all'esterno gli aminoacidi idrofobici capaci di interagire con i lipidi ). STRUTTURA QUATERNARIA Alcune proteine specialmente quelle con funzione enzimatica, possono assumere una struttura quaternaria che deriva dall'associazione di più catene polipeptidiche. Se le catene polipeptidiche sono uguali si parlerà di dimeri (2 catene polipeptidiche), tetrameri (4), etc Le catene che si associano possono essere differenti e ciascuna prende il nome di subunità (vedi RNA-polimerasi in procarioti).

44

45

46

47 Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte gli introni

48 La TATA box è una sequenza presente: 1. Al 5 dei geni in procarioti 2. Al 5 dei geni per mrna in eucarioti 3. Sull mrna nella sequenza leader 4. Al 5 dei geni per rrna in eucarioti 5. Al 5 dei geni per trna in eucarioti

49 Descrivete le possibili conseguenze nella traduzione del seguente mrna mutato rispetto a quello nativo 5 UUCCCAAUCACAUAAGUAGCC 3 RNA mutato 5 UUCCCAAUCACAUACGUAGCC 3 RNA nativo (codoni di stop UAG, UAA, UGA)

50 La polimerasi I è la polimerasi che trascrive: 1. Tutti gli RNA in procarioti 2. trna e 5S ribosomiali in eucarioti 3. Gli snrna e si trova nel nucleolo 4. Gli rrna e si trova nel nucleolo 5. Gli hnrna in eucarioti

51 RNA-POLIMERASI I Si trova nel nucleolo 1) Trascrive un filamento precursore 45S da cui vengono poi ritagliati i tre rrna: 28S, 18S, 5,8S. 2) Il DNA contenente i geni per gli rrna si trova nel nucleolo. 3) La trascrizione avviene nel nucleolo 4) Le proteine ribosomiali vengono prodotte nel citoplasma e successivamente rientrano nel nucleo e quindi nel nucleolo dove si assemblano con i rispettivi rrna per dare le due subunità ribosomiali. 1) La polimerasi I ha bisogno di 2 fattori trascrizionali generali (B ed S) per poter iniziare la trascrizione che si legano al promotore (da -100/-50 a +20). RNA-POLIMERASI III Si trova nel nucleo. 1) Trascrive i diversi trna e l' rrna 5S (unico ribosomiale non prodotto nel nucleolo dove poi migrerà). 2) La polimerasi III ha bisogno di fattori di trascrizione generali per iniziare (A,B,C per rrna 5S e B,C per i trna). 3) Le zone regolatrici di attacco dei fattori trascrizionali e RNA-polimerasi non sono a monte del trascritto ma a valle: Promotori Interni.

52 RNA-POLIMERASI II Si trova nel nucleo. 1) Trascrive RNA primari (hnrna) che successivamente verranno modificati (maturazione) per dare mrna funzionanti. 2) Per iniziare ha bisogno di fattori trascrizionali generali (D, B, F, E, H). 3) Tali fattori si legano ad una sequenza del promotore detta TATA BOX (- 40). Esistono anche a monte della TATA BOX sequenze ricche di CG e CAAT BOX.

INTERAZIONE TRA mrna, trna e RIBOSOMI

INTERAZIONE TRA mrna, trna e RIBOSOMI INTERAZIONE TRA mrna, trna e RIBOSOMI mrna: porta l'informazione della sequenza degli aminoacidi di una determinata proteina. trna: ogni trna è specifico per il trasporto di un determinato aminoacido Ribosoma:

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica Il Codice Genetico La decodifica della sequenza nucleotidica in sequenza aminoacidica La sequenza del mrna viene letta a gruppi di 3 nucleotidi, senza interruzioni e senza sovrapposizioni; 4 3 = 64 ---------64

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Definizione Composti quaternari: C H O N S P Fe Mg I

Definizione Composti quaternari: C H O N S P Fe Mg I PROTIDI Definizione Composti quaternari: C H O N S P Fe Mg I ORIGINE cellulare ogni cellula sintetizza le sue prote CARATTERISTICHE insolubili in acqua sensibili a variazioni di ph coagulano in presenza

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO http://www.atdbio.com/img/articles/rna wobble base pairs large.png CODICE GENETICO Codice mediante il quale la sequenza nucleotidica

Dettagli

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA

all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA Il Codice Genetico The genetic code consists of 64 triplet codons (A, G, C, U) 4 3 = 64 all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA AUG (methionine)

Dettagli

Allineamento dei 2 RNA

Allineamento dei 2 RNA La traduzione 2 codone Allineamento dei 2 RNA anticodone Studi Molecolari hanno dimostrato che: 3 residui nucleotidici del mrna sono necessari per codificare ciascun amminoacido Il linguaggio contenuto

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

SUBUNITA MAGGIORE = 60S (rrna 28S, 5.8S e 5S + 45 proteine) SUBUNITA MAGGIORE = 50S (rrna 23S e 5S + 34 proteine)

SUBUNITA MAGGIORE = 60S (rrna 28S, 5.8S e 5S + 45 proteine) SUBUNITA MAGGIORE = 50S (rrna 23S e 5S + 34 proteine) TRADUZIONE I RIBOSOMI I Ribosomi hanno un diametro di circa 15-30 nm, sono costituiti da proteine ed rrna e sia nei Procarioti che negli Eucarioti, sono costituiti da una subunità maggiore e da una subunità

Dettagli

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine da sequenze del DN definite geni. Si tratta di un processo a più fasi Nelle sue linee fondamentali questo processo

Dettagli

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

SINTESI DELLE PROTEINE

SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

mrna + 20 aminoacidi In vitro nulla

mrna + 20 aminoacidi In vitro nulla La sintesi proteica mrna + 20 aminoacidi In vitro nulla Il codice genetico I geni controllano la struttura delle proteine: in che modo? 4 nucleotidi A, T, C, G 20 aminoacidi Esiste un codice che converte

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Codice Genetico (segue) 29/10/2014 CODICE GENETICO

Codice Genetico (segue) 29/10/2014 CODICE GENETICO CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. CODICE GENETICO Consiste di codoni a tre nucleotidi

Dettagli

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La

Dettagli

Definizione TRADUZIONE

Definizione TRADUZIONE Sintesi proteica Definizione La sintesi proteica è costituita da una sequenza di eventi che portano alla formazione di un polimero di amminoacidi (proteina o polipeptide) ad opera dei ribosomi a partire

Dettagli

IL CODICE GENETICO E I CARATTERI EREDITARI

IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni Evoluzione del concetto di gene Da Mendel ai giorni nostri passando per diverse definizioni Fino al 1940 Teoria perle di una collana, considerate come unità indivisibili Gene = Unita dell informazione

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

C1. Il codone di inizio parte dal quinto nucleotide. La sequenza aminoacidica sarà Met Gly Asn Lys Pro Gly Gln STOP.

C1. Il codone di inizio parte dal quinto nucleotide. La sequenza aminoacidica sarà Met Gly Asn Lys Pro Gly Gln STOP. Soluzioni ai problemi del Capitolo 13 Domande concettuali C1. Il codone di inizio parte dal quinto nucleotide. La sequenza aminoacidica sarà Met Gly Asn Lys Pro Gly Gln STOP. C2. Quando si dice che il

Dettagli

Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi. Possono assumere forme diverse a seconda della funzione

Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi. Possono assumere forme diverse a seconda della funzione Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi Hanno elevato PM Possono assumere forme diverse a seconda della funzione svolgono molteplici funzioni Tra le proteine

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

Codice genetico CODICE GENETICO [1]

Codice genetico CODICE GENETICO [1] Codice genetico CODICE GENETICO [1] Codice mediante il quale la sequenza nucleotidica di una molecola di DNA, tramite un mrna, specifica la sequenza amminoacidica di un polipeptide. Consiste di codoni

Dettagli

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- odice genetico- Traduzione dl Infermieristica aa. 2011/12 Prof.ssa Frabetti ESPRESSIONE

Dettagli

Biologia Molecolare. CDLM in CTF La riparazione del DNA

Biologia Molecolare. CDLM in CTF La riparazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La riparazione del DNA I tipi di mutazione e le conseguenze Le classi di danno al DNA Meccanismi di riparazione La necessità di codificare l informazione L informazione

Dettagli

La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi)

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi) enhancer promotore regione trascritta TATA trascrizione 5 3 splicing mrna 5 3 traduzione Proteina NH2 COOH Funzione biologica TRADUZIONE I tre ruoli svolti dall RNA: 1. Messaggero 2. Transfer (legato agli

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE BIOLOGIA MOLECOLARE DEGLI EUCARIOTI Roberto Giacominelli Stuffler 1. I geni ed il DNA degli eucarioti 2. La replicazione, la trascrizione e la

Dettagli

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT2 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 IL MATERIALE GENETICO 2 2 Per svolgere il proprio ruolo, il materiale genetico

Dettagli

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la

Dettagli

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO.

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO. TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

sono le unità monomeriche che costituiscono le proteine hanno tutti una struttura comune

sono le unità monomeriche che costituiscono le proteine hanno tutti una struttura comune AMINO ACIDI sono le unità monomeriche che costituiscono le proteine sono 20 hanno tutti una struttura comune sono asimmetrici La carica di un amino acido dipende dal ph Classificazione amino acidi Glicina

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

LE PROTEINE. SONO Polimeri formati dall unione di AMMINOACIDI (AA) Rende diversi i 20 AA l uno dall altro UN ATOMO DI C AL CENTRO

LE PROTEINE. SONO Polimeri formati dall unione di AMMINOACIDI (AA) Rende diversi i 20 AA l uno dall altro UN ATOMO DI C AL CENTRO LE PROTEINE SONO Polimeri formati dall unione di ATOMI DI C, H, N, O CHE SONO AMMINOACIDI (AA) Uniti tra loro dal Legame peptidico 20 TIPI DIVERSI MA HANNO STESSA STRUTTURA GENERALE CON Catene peptidiche

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza di aminoacidi. Come le mutazioni

Dettagli

CODICE GENETICO E TRADUZIONE

CODICE GENETICO E TRADUZIONE CODICE GENETICO E TRADUZIONE Dogma centrale della Biologia molecolare (Francis Crick): Flusso dell informazione genetica: schematizzato in figura. Gli esperimenti su Neurospora crassa (muffa del pane)

Dettagli

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA 2. Trasmissione dell informazione genetica dal gene alla proteina LA TRASCRIZIONE NEI PROCARIOTI E NEGLI EUCARIOTI PROCARIOTI EUCARIOTI LA TRASCRIZIONE

Dettagli

BIOMOLECOLE (PROTEINE)

BIOMOLECOLE (PROTEINE) BIOMOLECOLE (PROTEINE) Proteine: funzioni Strutturale (muscoli, scheletro, legamenti ) Contrattile (actina e miosina) Di riserva (ovoalbumina) Di difesa (anticorpi) Di trasporto (emoglobina, di membrana)

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Lezione 1. Le molecole di base che costituiscono la vita

Lezione 1. Le molecole di base che costituiscono la vita Lezione 1 Le molecole di base che costituiscono la vita Le molecole dell ereditarietà 5 3 L informazione ereditaria di tutti gli organismi viventi, con l eccezione di alcuni virus, è a carico della molecola

Dettagli

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA Corso di Laurea in Chimica e Tecnologie Farmaceu,che a.a. 2014-2015 Università di Catania Il Codice Gene,co Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del

Dettagli

scaricato da www.sunhope.it Proteine semplici costituite dai soli amminoacidi

scaricato da www.sunhope.it Proteine semplici costituite dai soli amminoacidi Proteine semplici costituite dai soli amminoacidi Proteine coniugate costituite dagli amminoacidi + porzioni di natura non amminoacidica dette GRUPPI PROSTETICI Le Proteine coniugate prive del gruppo prostetico

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Corso di Genetica -Lezione 12- Cenci

Corso di Genetica -Lezione 12- Cenci Corso di Genetica -Lezione 12- Cenci Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE 1 AMMINOACIDI Gli amminoacidi sono composti organici composti da atomi di carbonio, idrogeno, ossigeno e azoto e in alcuni casi anche da altri elementi come lo zolfo. Gli amminoacidi

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

LA REGOLAZIONE GENICA DEI PROCARIOTI.

LA REGOLAZIONE GENICA DEI PROCARIOTI. LA REGOLAZIONE GENICA DEI PROCARIOTI www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con cui viene

Dettagli

Biologia. Lezione 09/11/2010

Biologia. Lezione 09/11/2010 Biologia Lezione 09/11/2010 Tutte le molecole contenute nelle cellule sono costituite da composti del carbonio Zuccheri Lipidi Proteine Acidi nucleici Polimeri Sono macromolecole formate da unità (MONOMERI)

Dettagli

07/01/2015. Inizio della sintesi proteica-i. Inizio della sintesi proteica-ii. Inizio della sintesi proteica-iii

07/01/2015. Inizio della sintesi proteica-i. Inizio della sintesi proteica-ii. Inizio della sintesi proteica-iii Inizio della sintesi proteica-i Coinvolge le subunità ribosomali trna d inizio Fattori di inizio (IFs) Inizio della sintesi proteica-ii Il trna iniziatore è caricato con formil-metionina Nei Bacteria vi

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Università Telematica Pegaso. Indice

Università Telematica Pegaso. Indice LE PROTEINE PROF.SSA AUSILIA ELCE Indice 1 INTRODUZIONE -------------------------------------------------------------------------------------------------------------- 3 2 TRASCRIZIONE--------------------------------------------------------------------------------------------------------------

Dettagli

Alcol + alcol etere R-OH + R -OH R-O-R + H 2 O Aldeide + alcol emiacetale R-CHO + R -OH R-CHOH-O-R Acido + Acido anidride R-COOH + R -COOH

Alcol + alcol etere R-OH + R -OH R-O-R + H 2 O Aldeide + alcol emiacetale R-CHO + R -OH R-CHOH-O-R Acido + Acido anidride R-COOH + R -COOH Nomenclatura AMIDI Alcol + alcol etere R-OH + R -OH R-O-R + H 2 O Aldeide + alcol emiacetale R-CHO + R -OH R-CHOH-O-R Acido + Acido anidride R-COOH + R -COOH R-CO-O-CO-R + H 2 O Alcol + Acido estere R-COOH

Dettagli

LE MUTAZIONI E L EVOLUZIONE

LE MUTAZIONI E L EVOLUZIONE UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE LE MUTAZIONI E L EVOLUZIONE Roberto Giacominelli Stuffler LE MUTAZIONI 2 LE MUTAZIONI LE SOSTITUZIONI LE DELEZIONI LE INSERZIONI 3 LE MUTAZIONI

Dettagli

LIVELLI DI STRUTTURA DELLE PROTEINE

LIVELLI DI STRUTTURA DELLE PROTEINE FUNZIONI E STRUTTURA DELLE PROTEINE PROF.SSA AUSILIA ELCE Indice 1 INTRODUZIONE -------------------------------------------------------------------------------------------------------------- 3 2 LIVELLI

Dettagli

Composti organici. I composti organici. Atomi e molecole di carbonio. Atomi e molecole di carbonio. Gruppi funzionali. Isomeri

Composti organici. I composti organici. Atomi e molecole di carbonio. Atomi e molecole di carbonio. Gruppi funzionali. Isomeri I composti organici Atomi e molecole di carbonio Carboidrati Lipidi Proteine Acidi nucleici Composti organici Materiale composto da biomolecole - Formate in buona parte da legami ed anelli di carbonio.

Dettagli

Espressione genica: trascrizione

Espressione genica: trascrizione Espressione genica: trascrizione Corso di Genetica per Scienze per l Ambiente e la Natura Alberto Pallavicini Schema generale Nel 1956 Crick postulò il Dogma centrale: DNA RNA PROTEINE Non tutti i geni

Dettagli

CARBOIDRATI C H O ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO

CARBOIDRATI C H O ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO CARBOIDRATI ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO C H O carboidrati C n H 2n O n H C O C O Il glucosio è un monosaccaride con 6 atomi di carbonio GLUCOSIO Forma ciclica Forma lineare a ph 7 circa lo 0,0026%

Dettagli

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

Le proteine. Sono polimeri di amminoacidi dispos$ in sequenza. Due amminoacidi si legano tra loro formando un legame pep-dico.

Le proteine. Sono polimeri di amminoacidi dispos$ in sequenza. Due amminoacidi si legano tra loro formando un legame pep-dico. Le proteine Sono polimeri di amminoacidi dispos$ in sequenza. Due amminoacidi si legano tra loro formando un legame pep-dico. Cur$s et al. Invito alla biologia.blu Zanichelli editore 2011 1 Struttura e

Dettagli

Il flusso dell informazione genica Le proteine natura ed informazione Il codice genetico La traduzione (sintesi proteica) Cenni sul folding delle

Il flusso dell informazione genica Le proteine natura ed informazione Il codice genetico La traduzione (sintesi proteica) Cenni sul folding delle Il flusso dell informazione genica Le proteine natura ed informazione Il codice genetico La traduzione (sintesi proteica) Cenni sul folding delle proteine Genotipo e fenotipo Mutazioni e polimorfismi Il

Dettagli

Mutazioni genetiche 2

Mutazioni genetiche 2 Mutazioni genetiche 2 Cosa sono le mutazioni? Le proteine sono in grado di svolgere la loro funzione solo se la loro sequenza amminoacidica è quella corretta. In caso contrario si possono generare delle

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

Immagini e concetti della biologia

Immagini e concetti della biologia Sylvia S. Mader Immagini e concetti della biologia 2 A3 Le molecole biologiche 3 Il carbonio è l elemento di base delle biomolecole Una cellula batterica può contenere fino a 5000 tipi diversi di composti

Dettagli

Formula generale di un amminoacido

Formula generale di un amminoacido Formula generale di un amminoacido Gruppo carbossilico Gruppo amminico Radicale variabile che caratterizza i singoli amminoacidi Le catene laterali R degli amminoacidi di distinguono in: Apolari o idrofobiche

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli