LA TRASCRIZIONE NEGLI EUCARIOTI

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "LA TRASCRIZIONE NEGLI EUCARIOTI"

Transcript

1 LA TRASCRIZIONE NEGLI EUCARIOTI

2 NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA.

3

4 INOLTRE, A DIFFERENZA DEI PROCARIOTI, TUTTI I TRASCRITTI SUBISCONO NEL NUCLEO UN PROCESSO DI MATURAZIONE

5 FIGURA 5.16 GENES VII = 7.14 GENE VI

6 FIGURA 3.6 GENOMI II

7 NEI PROCARIOTI UN UNICA RNA POLIMERASI TRASCRIVE TUTTI GLI RNA. NEGLI EUCARIOTI CI SONO 3 RNA POLIMERASI: LE RNA POLIMERASI I, II, E III CHE TRASCRIVONO RISPETTIVAMENTE I GENI PER GLI RNA RIBOSOMALI, I GENI CODIFICANTI PROTEINE E I GENI PER GLI RNA DI TRASPORTO.

8 FIGURA 9.18 GENOMI II TATA BOX PROMOTORE CORE

9 IL PROMOTORE CORE DELLA RNA POLIMERASI II COMPRENDE UNA TATA BOX CON SEQUENZA CONSENSO TATAWAW (W=A+T) POSTA IN POSIZIONE 25 ED UNA SEQUENZA INIZIATRICE (INR) CON SEQUENZA CONSENSO YYCARR LOCALIZZATA IN CORRISPONDENZA DEL SITO DI INIZIO DELLA TRASCRIZIONE (LA A RAPPRESENTA LA POSIZIONE +1). QUESTI DUE ELEMENTI SONO COMUNI ALLA MAGGIOR PARTE DEI GENI.

10 GLI ELEMENTI A MONTE DEL PROMOTORE CORE SONO INVECE DIVERSI DA GENE A GENE E RAPPRESENTANO IL PRESUPPOSTO PER LA REGOLAZIONE DELL ESPRESSIONE GENICA.

11 I FATTORI TRASCRIZIONALI GENERALI LEGANO IL PROMOTORE CORE

12 IL TASSO BASALE DI INIZIO DELLA TRASCRIZIONE DA PARTE DELLA RNA POLIMERASI II E MOLTO BASSO. PROTEINE ATTIVATRICI CHE SI LEGANO ALLE SEQUENZE A MONTE DEL PROMOTORE CORE POSSONO INCREMENTARE NOTEVOLMENTE IL TASSO TRASCRIZIONALE (ANCHE 1000 VOLTE) ED IN QUESTO MODO ATTIVARE L ESPRESSIONE GENICA.

13 GLI ATTIVATORI DELLA TRASCRIZIONE AGISCONO STABILIZZANDO IL LEGAME DELLA RNA POLIMERASI AL PROMOTORE.

14 FIGURA 9.27 GENOMI II.

15 GLI ATTIVATORI POSSONO AGIRE ANCHE LEGANDO SEQUENZE MOLTO DISTANTI DAL PROMOTORE CORE

16 IN QUESTO MODO UN SINGOLO GENE PUO ESSERE ACCESO MEDIANTE L INTERVENTO DI UNO SPECIFICO ATTIVATORE (O PIU SPESSO UNA COMBINAZIONE DI ATTIVATORI). IN TESSUTI DIVERSI, DIFFERENTI ATTIVATORI ACCENDONO DIFFERENTI GRUPPI DI GENI, DETERMINANDO LE CARATTERISTICHE STRUTTURALI E FUNZIONALI DELLE CELLULE DIFFERENZIATE.

17 MODIFICHE POST-TRASCRIZIONALI DELL RNA MESSAGGERO 1) FORMAZIONE DEL CAPPUCCIO O CAP ALL ESTREMITA 5 2) FORMAZIONE CODA DI POLI-A ALL ESTREMITA 3 3) SPLICING

18 LA FORMAZIONE DEL CAPPUCCIO O CAP CONSISTE NELL AGGIUNTA DI UNA MOLECOLA DI GUANOSINA TRIFOSFATO ALL ESTREMITA 5 DEL MESSAGGERO.

19 IL CAP SERVE A LEGARE IL RIBOSOMA AI FINI DELLA SINTESI PROTEICA

20 LA CODA DI POLI(A) COMPRENDE FINO A 250 ADENOSINE. ESSA STABILIZZA L RNA MESSAGGERO

21 LE SEQUENZE CODIFICANTI DEI GENI EUCARIOTICI SONO SPESSO INTERROTTE DA SEQUENZE NON CODIFICANTI DENOMINATE INTRONI

22 FIGURA GENOMI II GENE UMANO DELLA -GLOBINA

23 GLI INTRONI SONO TRASCRITTI INSIEME AGLI ESONI E SI RITROVANO QUINDI NEL TRASCRITTO PRIMARIO (PRE-mRNA). QUESTO SUBISCE POI UNA FORMA DI MATURAZIONE, DEFINITA SPICING, CHE RIMUOVE GLI INTRONI RISTABILENDO LA CONTINUITA DELLA SEQUENZA CODIFICANTE.

24 FIGURA 22.2 GENES VII = 30.2 IL GENE VI

25 LO SPLICING E CATALIZZATO DA ENZIMI NUCLEARI CHE SI ASSOCIANO A FORMARE UNA STRUTTURA DEFINITA SPLICEOSOMA.

26 UNO STESSO PRE-mRNA PUO ANDARE INCONTRO IN TESSUTI DIVERSI A DIFFERENTI SCHEMI DI SPLICING. QUESTO FENOMENO E DEFINITO SPLICING ALTERNATIVO.

27 FIGURA GENOMI N C N C

28 LO SPLICING ALTERNATIVO PERMETTE CHE UN SINGOLO GENE DIA ORIGINE A VARI mrna E QUINDI A VARIE PROTEINE. QUESTO FENOMENO CONSENTE QUINDI AMPLIARE LA GAMMA DI PROTEINE CHE UN ORGANISMO EUCARIOTE PUO PRODURRE CON UN NUMERO LIMITATO DI GENI.

29 PROCARIOTI: 1 GENE 1 RNA MESSAGGERO 1 PROTEINA EUCARIOTI: 1 GENE 1 TRASCRITTO PRIMARIO MOLTEPLICI RNA MESSAGGERI (PER EFFETTO DI SPLICING ALTERNATIVO) MOLTEPLICI PROTEINE.

30 STRUTTURA TIPICA DI UN GENE EUCARIOTICO ATG TAA, TAG O TGA SEQUENZA INIZIATRICE (INR) ESONE TATA BOX TERMINATORE SITO DI SPLICING

31 STRUTTURA TIPICA DI UN mrna EUCARIOTICO AUG UAA, UAG O UGA CAPPUCCIO O CAP SEQUENZA CODIFICANTE POLI(A)

32 REGOLAZIONE DELL ESPRESSIONE GENICA NEGLI EUCARIOTI

33 NEGLI EUCARIOTI PLURICELLULARI LA NECESSITA DI REGOLARE L ESPRESSIONE GENICA E EVIDENTE SE SI CONSIDERA LA NATURA DIVERSIFICATA DELLE CELLULE DIFFERENZIATE: CIASCUNA CELLULA POSSIEDE UN PARTICOLARE ASSETTO STRUTTURALE E METABOLICO CHE E DETTATO DALL ESPRESSIONE DI UNO SPECIFICO GRUPPO DI GENI.

34 I GENI HOUSEKEEPING SVOLGONO FUNZIONI DI BASE NECESSARIE ALLA VITA DI CIASCUNA CELLULA DELL ORGANISMO. NE SONO UN ESEMPIO I GENI DEGLI ENZIMI DELLA GLICOLISI, I GENI DELLE PROTEINE DEL CITOSCHELETRO ETC. QUESTI GENI SONO ATTIVI IN TUTTI I TIPI CELLULARI. L UOMO POSSIEDE CIRCA GENI HOUSE-KEEPING.

35 I GENI TESSUTO-SPECIFICI SVOLGONO FUNZIONI SPECIALIZZATE CORRELATE AD UNO O POCHI TIPI CELLULARI. NE SONO UN ESEMPIO I GENI CHE CODIFICANO LA CHERATINA, IL COLLAGENE, L EMOGLOBINA, L INSULINA, ETC. OVVIAMENTE QUESTE PROTEINE SONO ESPRESSE SOLO IN SPECIFICI TIPI CELLULARI. NELL UOMO CIASCUN ORGANO ESPRIME DA 3000 A 5000 GENI TESSUTO SPECIFICI.

36 COMPLESSIVAMENTE, LE CELLULE PROCARIOTICHE HANNO NECESSITA DI MODIFICARE IL PROPRIO PROTEOMA SOPRATTUTTO IN RELAZIONE A CAMBIAMENTI NEL TIPO DI NUTRIENTI DISPONIBILI E ALLE CONDIZIONI CHIMICO- FISICHE DEL MOMENTO. NEL CASO DEGLI ORGANISMI EUCARIOTI PLURICELLULARI L AMBIENTE EXTRACELLULARE E SPESSO UN FLUIDO CORPOREO CHE HA UNA COMPOSIZIONE PIUTTOSTO COSTANTE NEL TEMPO. QUESTE CELLULE HANNO PERO NECESSITA DI COOPERARE PER

37 MANTENERE L INTEGRITA STRUTTURALE E FUNZIONALE DELL ORGANISMO. TALE COOPERAZIONE E POSSIBILE GRAZIE AD UN COMPLESSO SISTEMA DI MESSAGGERI CHIMICI, GLI ORMONI, CHE TRASMETTONO INFORMAZIONI DA UNA CELLULA ALL ALTRA. NEL CASO DEGLI ORGANISMI PLURICELLULARI GLI STIMOLI MAGGIORI PROVENGONO QUINDI DA ORMONI E FATTORI DI CRESCITA.

38 FIGURA 12.5 GENOMI II

39 FIGURA 12.8 GENOMI II

40 NEGLI EUCARIOTI L ESPRESSIONE GENICA E ANCHE REGOLATA MODULANDO LA STRUTTURA DELLA CROMATINA. AD ESEMPIO, I GENI CHE NON DEVONO ESSERE ESPRESSI SONO SEGREGATI NELL ETEROCROMATINA MENTRE QUELLI ATTIVI SI TROVANO NELL EUCROMATINA.

41 ANCHE NELL EUCROMATINA,L ESPRESSIONE DI UN GENE RICHIEDE LA SEPARAZIONE DEL DNA DALLE PROTEINE ISTONICHE IN MODO CHE L RNA POLIMERASI ABBIA ACCESSO AL DNA.

42 INFINE, NEGLI EUCARIOTI E STATO SCOPERTO UN MECCANISMO DI REGOLAZIONE DELL ESPRESSIONE GENICA A LIVELLO POST-TRASCRIZIONALE. ESSO COINVOLGE I MICRORNA.

43 I MICRORNA SONO PICCOLE MOLECOLE DI RNA IN GRADO DI LEGARE SEQUENZE NUCLEOTIDICHE COMPLEMENTARI PRESENTI NEGLI RNA MESSAGGERI ALLO SCOPO DI BLOCCARE LA SINTESI PROTEICA.

44

45 I MICRORNA CONTRIBUISCONO A REALIZZARE UNA REGOLAZIONE FINE DELL ESPRESSIONE GENICA: IN CIASCUN TESSUTO, IL LIVELLO DI ESPRESSIONE DI UN GENE DIPENDE INFATTI DALLA SPECIFICA COMBINAZIONE DEI FATTORI TRASCRIZIONALI PRESENTI NEL NUCLEO E DEI MICRORNA PRESENTI NEL CITOPLASMA

46 PER QUESTE PROPRIETA, I MICRORNA SVOLGONO UN RUOLO FONDAMENTALE NELLO SVILUPPO E DIFFERENZIAMENTO. ESSI CONTRIBUISCONO INFATTI ALL ACQUISIZIONE DI UNA SPECIFICA IDENTITA CELLULARE IN DUE MODI: REGOLANO FINEMENTE L ESPRESSIONE DEI GENI NECESSARI AL TIPO CELLULARE IN ESAME ED EVITANO L ESPRESSIONE DEI GENI LA CUI FUNZIONE DEVE ESSERE CONFINATA AD ALTRI MOMENTI DELLO SVILUPPO O ALTRI TIPI CELLULARI.

47 LA REGOLAZIONE MEDIATA DAI MICRORNA E ANCHE DEFINITA INTERFERENZA DA RNA O RNA INTERFERENCE (PREMIO NOBEL A FIRE E MELLO NEL 2006).

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Mutazioni genetiche 2

Mutazioni genetiche 2 Mutazioni genetiche 2 Cosa sono le mutazioni? Le proteine sono in grado di svolgere la loro funzione solo se la loro sequenza amminoacidica è quella corretta. In caso contrario si possono generare delle

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi Enorme diversità di forme Costanza di struttura interna La cellula è l unità fondamentale di tutti gli organismi viventi

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

La metagenomica al servizio dell agricoltura

La metagenomica al servizio dell agricoltura La metagenomica al servizio dell agricoltura Marco Bazzicalupo Department of Biology University of Florence, Firenze, Italy http://www.unifi.it/dblage/mdswitch.html L albero della vita è microbico RNA

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

www.slidetube.it Pagina 1

www.slidetube.it Pagina 1 Lezione di Patologia Generale POLIMORFISMI E VARIABILITA GENETICA Ripartiamo dal concetto di polimorfismo di cui abbiamo parlato nelle lezioni precedenti. I polimorfismi sono di per loro mutazioni. Se

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy astr.gsu.edu/hbase/biology/ribosome.html http://www.accessexcellence.org/rc/vl/gg/ecb/ecb_images/01_24_organelles.jpg

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

PROGRAMMA EFFETTIVAMENTE SVOLTO DAL DOCENTE

PROGRAMMA EFFETTIVAMENTE SVOLTO DAL DOCENTE Ministero dell istruzione, dell università e della ricerca Istituto d Istruzione Superiore Severi-Correnti IIS Severi-Correnti 02-318112/1 via Alcuino 4-20149 Milano 02-33100578 codice fiscale 97504620150

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?

Dettagli

20. La traduzione 10/05/16

20. La traduzione 10/05/16 20. La traduzione contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale 1 L RNA transfer è l adattatore 2 La struttura secondaria

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà

Bioinformatica RNA non codificanti ed RNAi. Dott. Alessandro Laganà Bioinformatica RNA non codificanti ed RNAi Dott. Alessandro Laganà Piccoli RNA non codificanti Struttura dell RNA RNA regolatore microrna RNAi e sirna 2 Bioinformatica: RNA non codificanti ed RNAi L RNA

Dettagli

CARBOIDRATI C H O ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO

CARBOIDRATI C H O ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO CARBOIDRATI ZUCCHERO SACCARIDE GLUCIDE CARBOIDRATO C H O carboidrati C n H 2n O n H C O C O Il glucosio è un monosaccaride con 6 atomi di carbonio GLUCOSIO Forma ciclica Forma lineare a ph 7 circa lo 0,0026%

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

3 modulo didattico - Le

3 modulo didattico - Le 3 modulo didattico - Le mutazioni del DNA e le malattie monogeniche. Le mutazioni del genoma umano Mutazione: qualsiasi cambiamento permanente ed ereditabile del DNA Mutazione ereditata proveniente dai

Dettagli

Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA

ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA ORGANIZZAZIONE DI UNA CELLULA PROCARIOTICA Costituisce gli gli organismi PROCARIOTI = unicellulari BACILLI (bastoncelli) COCCHI (sferici) SPIRILLI (spirale) 0.3-2 µm Streptococchi (catenella) Stafilococchi,

Dettagli

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento www.unitn.it/cibio

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Differenze tra RNA e DNA

Differenze tra RNA e DNA Differenze tra RNA e DNA Acidi nucleici RNA TIPI PRINCIPALI DI RNA PRODOTTI NELLE CELLULE Funzione e struttura del RNA Tipo di RNA mrna rrna trna snrna snorna Altri RNA non codificanti Funzione RNA messaggeri,

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Docente: dott. Tiziano Baroni (tbaroni@unipg.it) Il corso (1 CFU=30 ore), affronterà argomenti teorici e pratici concernenti

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

La vita media delle cellule del sangue è breve

La vita media delle cellule del sangue è breve La vita media delle cellule del sangue è breve Eritrociti: 120 giorni Neutrofili: 6 ore in circolo; pochi giorni nei tessuti Eosinofili: 8-12 giorni Monociti: 14 ore in circolo; mesi-anni nei tessuti (macrofagi)

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

unità C1. All interno delle cellule

unità C1. All interno delle cellule Tutti gli organismi sono formati da cellule procariotiche (con DNA sparso all interno) eucariotiche (con DNA contenuto nel nulcleo) animali vegetali Le cellule hanno in comune la membrana plasmatica il

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli