Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte"

Transcript

1 Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania La stru(ura del gene Stefano Forte

2 I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La maggior parte dei geni codifica proteine, che sono le macromolecole maggiormente coinvolte nei processi biochimici e metabolici della cellula. Altri geni non codificano proteine, ma producono RNA non codificante, che può giocare un ruolo fondamentale nella sintesi delle proteine e nell'espressione genica (La trascrizione del DNA in RNA e la traduzione dell'rna in proteina). Parte del contenuto dei geni non viene trascritto, ma può coordinare la stessa espressione genica. Tra queste regioni figurano i promotori, i terminatori e gli introni.

3 Tre classi di geni I geni non sono sequenze casuali ma hanno caratteristiche ben precise. Buona parte dell'informazione contenuta in un gene viene "copiata" in una molecola di RNA; il resto del gene è coinvolto comunque nel processo di "copia" (trascrizione). Alcuni tipi di RNA vengono utilizzati per la sintesi delle proteine, altri svolgono svariati tipi di funzioni. Esistono tre classi di geni, che differiscono in base al tipo di RNA che viene prodotto con la loro espressione: Geni della I classe RNA ribosomiale (rrna) Geni della II classe RNA messaggero (mrna) Piccoli RNA nucleari (snrna) Micro RNA (mirna) Geni della III classe RNA transfer (trna) Piccoli RNA nucleolari (snorna) Piccoli RNA citoplasmatici (scrna) Micro RNA (mirna)

4 L'RNA messaggero Gli RNA Messaggeri (mrna) sono gli unici tipi di RNA codificante. Sono i trascritti dei geni che codificano proteine. Trasportano l'informazione genica nel citoplasma, dove tale informazione viene impiegata per la sintesi delle proteine. Costituiscono solo il 4% circa degli RNA totali della cellula ed hanno vita breve, in quanto vengono degradati poco dopo la sintesi proteica.

5 I principali RNA non codificanti RNA ribosomiali (rrna) Sono i più abbondanti nelle cellule Sono parte integrante dei ribosomi, le particelle dove ha luogo la sintesi proteica RNA transfer (trna) Sono piccole molecole coinvolte nella sintesi proteica Trasportano gli aminoacidi ai ribosomi in modo tale da permettere la loro unione nell'ordine specificato dalla sequenza nucleotidica dell'mrna

6 Altri tipi di RNA non codificante Piccoli RNA nucleari (snrna) Sono coinvolti nella maturazione degli mrna Piccoli RNA nucleolari (snorna) Svolgono un ruolo cruciale nella maturazione delle molecole di rrna Piccoli RNA citoplasmatici (scrna) Gruppo eterogeneo che comprende molecole con una varietà di funzioni diverse, alcune ancora misteriose microrna (mirna) Sono piccole molecole che regolano l'espressione genica a livello post-trascrizionale

7 Com'è fatto un gene? ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAACTAT TCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAG ATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGGCTGAAC TTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGACACCAATGA ACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATAATCCAAAGAGGT TTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGAAAGTATGCTCGCGT GGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAGTTCAGTAGTTATGA GCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTACGAAGCATTTGAAAACA TGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCC TTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAA TAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCAC CAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTT CTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACCCAAAGAGGTTTGCTGCAGTAATAATG AGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAAGTATGCTCGTGTGGTGCAGAAGCTCGG GTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAGTTCAGTAGTTATGAACCTGAACTTTTCCCC GGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATGAAGCATTTGAAAACATGTATCCTATTCTAGAAA GTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTCCCCTGTTCAGCCCAGTTGTACCTTATGATATGTAC ATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTACCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCT GTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGGGCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAG CTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACCAATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAA CTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCCAAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAG GACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTC GATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTTCAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATG GTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAAGCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGA GAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAAAAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAA CAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAGCAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATG GGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGTACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTAT ATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATATTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGA CTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCCTGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGG CAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGCATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAA ACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGTTAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAG TGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTACTGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCAC ACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTAGTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTT CTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAATCCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACA TCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACCATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTAC ATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTATTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGC TGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAGTAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGT TAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCTCTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATA GGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAGAAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTC TTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTCTTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGA ATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAA AGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGAGAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCA CCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCTCTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAG GTATCTGCTCCCACAGCCAGACTGGTACTAACAAAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGC CTTTAGACATGCACTCACTTCCATCTAATCCAGG

8 Struttura dei Geni eucariotici codificanti I geni codificanti sono quelli che vengono trascritti in mrna. Contengono una parte realmente codificante, che specifica la sequenza degli aminoacidi che costituiranno la proteina, ed una parte non codificante. A monte della sequenza che verrà trascritta in mrna vi sono le sequenze regolatrici. La sequenza trascritta è costituita da due tipi di elementi, detti esoni ed introni. Solo gli esoni contengono informazioni per la sintesi della proteina.

9 Struttura del gene

10 Sequenze regolatrici Le sequenze regolatrici sono situate a monte del sito di inizio della trascrizione. Svolgono un ruolo fondamentale nell'espressione del gene, permettendo l'avvio e la regolazione della trascrizione. Le sequenze regolatrici prossimali, cioè vicine al sito di inizio della trascrizione, sono dette Promotori. Elementi Promotori fondamentali sono il TATA box, il CAAT box e il GC box. Altri elementi regolatori distali, cioè lontani dal sito di inizio della trascrizione, sono gli enhancers e i silencers (i primi amplificano, i secondi reprimono la trascrizione).

11 Sequenza trascritta La sequenza che viene trascritta in mrna, contiene le informazioni necessarie per la sintesi proteica (regione codificante tradotta) ed altre sotto-sequenze non tradotte. La regione codificante è formata da elementi chiamati Esoni, intervallati da elementi non codificanti chiamati Introni.

12 Com'è fatta una sequenza codificante? I geni sono sequenze nucleotidiche, sequenze di 4 tipi diversi di caratteri: A, C, G e T. I geni che codificano proteine contengono schemi di lettura aperti, ORF (Open Reading Frames), costituiti da una serie di triplette di nucleotidi dette codoni. L'informazione contenuta nel gene specifica la sequenza della proteina che dovrà essere sintetizzata, ovvero la successione degli aminoacidi della proteina, mediante una successione di codoni: ATGGGACAGCAGGGATTTAATTAA Ogni codone specifica uno ed un solo aminoacido.

13 Come sono fatte le ORF? Le ORF cominciano con un codone di inizio, normalmente ATG, e finiscono con un codone di stop che può essere TAA, TAG o TGA. Il DNA è formato da due filamenti complementari che sono avvolti a formare una doppia elica, conformazione a bassa energia che conferisce stabilità alla molecola. Le due estremità sono dette per convenzione 5 e 3. Le sequenze vengono lette sempre nell ordine 5 -> 3, su entrambi i filamenti. Gli appaiamenti canonici (di Watson/Crick) sono: A-T G-C 5 - AGTAGAACGCCAAATCGAGCCTAGCATA TCATCTTGCGGTTTAGCTCGGATCGTAT 5 La sequenza di un gene si trova su uno dei due filamenti: solo uno dei due filamenti contiene la sequenza da trascrivere.

14 Come sono fatte le ORF? (2) Ogni sequenza di DNA ha 6 possibili schemi di lettura, tre in una direzione e tre nella direzione opposta sul filamento complementare: GGT TGG ATG ATGGTAACGCCAAATCGAGCCTAGCATA TCATCTTGCGGTTTAGCTCGGATCGTAT TAT GTA CGT Normalmente la ORF codificante è quella più lunga.

15 I codoni I codoni della ORF corretta specificano la sequenza di aminoacidi della proteina corrispondente. Il primo codone, che è di solito ATG, specifica sia l'inizio della traduzione che un particolare aminoacido, la Metionina (M). I tre codoni di stop invece indicano solo la fine della traduzione e non codificano nessun aminoacido. 5 - GTATGAACGCCAAATCGAGCTAGCATA 3

16 In questo caso il 5' UTR è costituito da tutto il 1 esone e da parte del 2 esone (regione arancione). La regione codificante è indicata in blu, inizia nel 2 esone e termina nell'ultimo esone. Il 3' UTR è costituito da parte dell'ultimo esone (regione gialla). Non tutti gli esoni codificano Gli esoni sono normalmente codificanti, ad eccezione di quelli alle estremità 5' e 3' del gene. Tali esoni prendono il nome di UTR (UnTranslated Region). Introni Esoni

17 Il segnale di poliadenilazione Segnale di poliadenilazione

18 Un gene tante proteine Promotore Alternativo

19 Un gene tante proteine Splicing Alternativo

20 Struttura dei geni procariotici La struttura dei geni procariotici è più semplice. Spesso, nei genomi procariotici, diversi geni vengono controllati da un'unica regione regolatrice: un tale insieme di geni viene definito operone (Es. operone formato dai geni A, B, C, D, E). I geni dell'operone codificano determinate proteine. Il promotore, a monte dei geni, è necessario all'inizio della trascrizione. L'operatore, nella sequenza regolatrice, regola l'espressione dei geni.

21 Com'è fatto un promotore? La funzione di un promotore non è di essere trascritta e tradotta, ma di farsi riconoscere dalle proteine. L'informazione per la funzione del promotore sta direttamente nella sua sequenza, che costituisce il segnale. La sequenza di un promotore non deve necessariamente essere contigua e lo spazio tra due elementi distaccati può essere parte stessa del segnale.

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Biologia Molecolare. CDLM in CTF La Genomica ed il Dogma Centrale della Biologia

Biologia Molecolare. CDLM in CTF La Genomica ed il Dogma Centrale della Biologia Biologia Molecolare CDLM in CTF 2010-2011 La Genomica ed il Dogma Centrale della Biologia Il Genoma I Geni Il Dogma centrale della Biologia Il genoma è l'insieme di tutte le informazioni biologiche necessarie

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Codice Genetico (segue)

Codice Genetico (segue) CODICE GENETICO Nucleotidi, acidi nucleici CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. Consiste

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

IL CODICE GENETICO E I CARATTERI EREDITARI

IL CODICE GENETICO E I CARATTERI EREDITARI IL CODICE GENETICO E I CARATTERI EREDITARI Il DNA porta le informazioni genetiche scritte nella sequenza di basi. Qualunque sequenza è possibile. Il DNA virus più semplici: 5000 basi appaiate; 46 cromosomi

Dettagli

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA 2. Trasmissione dell informazione genetica dal gene alla proteina LA TRASCRIZIONE NEI PROCARIOTI E NEGLI EUCARIOTI PROCARIOTI EUCARIOTI LA TRASCRIZIONE

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO http://www.atdbio.com/img/articles/rna wobble base pairs large.png CODICE GENETICO Codice mediante il quale la sequenza nucleotidica

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

microrna Struttura e Funzione

microrna Struttura e Funzione microrna Struttura e Funzione Cinzia Di Pietro Università degli Studi di Catania Dipartimento di Scienze Biomediche e Biotecnologiche Sezione di Biologia e Genetica G. Sichel I MicroRNAs (mirnas) sono

Dettagli

18. L RNA regolatore. Espressione geni è controllata da regolatori che interagiscono con una struttura specifica dell mrna

18. L RNA regolatore. Espressione geni è controllata da regolatori che interagiscono con una struttura specifica dell mrna 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Espressione geni è controllata da regolatori che interagiscono

Dettagli

SINTESI DELLE PROTEINE

SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

SDD Seconde Gli acidi nucleici. Gli acidi nucleici

SDD Seconde Gli acidi nucleici. Gli acidi nucleici 1 Capire come le informazioni genetiche sono immagazzinate nelle cellule e come avviene la trasformazione di queste informazioni nei meccanismi metabolici delle cellule. Quattro mattoncini La cellula ha

Dettagli

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE?

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE? DNA E PROTEINE NUMEROSI DATI SUGGERISCONO CHE IL DNA SVOLGA IL SUO RUOLO GENETICO CONTROLLANDO LA SINTESI DELLE PROTEINE, IN PARTICOLARE DETERMINANDONE LA SEQUENZA IN AMINOACIDI E NECESSARIO RISPONDERE

Dettagli

La Terminazione della Trascrizione

La Terminazione della Trascrizione La Terminazione della Trascrizione I geni batterici possiedono dei terminatori della trascrizione. I Terminatori sono sequenze dell RNA che promuovono il distacco dell RNA polimerasi dal templato Ne esistono

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine da sequenze del DN definite geni. Si tratta di un processo a più fasi Nelle sue linee fondamentali questo processo

Dettagli

Espressione ed utilizzo della informazione genetica III Regolazione

Espressione ed utilizzo della informazione genetica III Regolazione Espressione ed utilizzo della informazione genetica III Regolazione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Controllo o regolazione della espressione genica negli EUCARIOTI Scopo:

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?

Dettagli

La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Trascrizione negli Eucariotici

Trascrizione negli Eucariotici Trascrizione negli Eucariotici Cytoplasm DNA RNA Transcription RNA Processing mrna G Nucleus AAAAAA Export G AAAAAA CLASSI DI GENI Le unità di trascrizione eucariotiche sono più complesse di quelle procariotiche

Dettagli

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la

Dettagli

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione

Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- Codice genetico- Traduzione Le proprietà elettive della cellula: Espressione della informazione genetica e differenziamento II Trascrizione- odice genetico- Traduzione dl Infermieristica aa. 2011/12 Prof.ssa Frabetti ESPRESSIONE

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

Codice genetico CODICE GENETICO [1]

Codice genetico CODICE GENETICO [1] Codice genetico CODICE GENETICO [1] Codice mediante il quale la sequenza nucleotidica di una molecola di DNA, tramite un mrna, specifica la sequenza amminoacidica di un polipeptide. Consiste di codoni

Dettagli

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza di aminoacidi. Come le mutazioni

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni

Evoluzione del concetto di gene. Da Mendel ai giorni nostri passando per diverse definizioni Evoluzione del concetto di gene Da Mendel ai giorni nostri passando per diverse definizioni Fino al 1940 Teoria perle di una collana, considerate come unità indivisibili Gene = Unita dell informazione

Dettagli

Struttura ed espressione del Gene

Struttura ed espressione del Gene Struttura ed espressione del Gene PowerPoint Lectures for Essential Biology, Third Edition Neil Campbell, Jane Reece, and Eric Simon Essential Biology with Physiology, Second Edition Neil Campbell, Jane

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Definizione Composti quaternari: C H O N S P Fe Mg I

Definizione Composti quaternari: C H O N S P Fe Mg I PROTIDI Definizione Composti quaternari: C H O N S P Fe Mg I ORIGINE cellulare ogni cellula sintetizza le sue prote CARATTERISTICHE insolubili in acqua sensibili a variazioni di ph coagulano in presenza

Dettagli

flusso dell'informazione genetica è monodirezionale

flusso dell'informazione genetica è monodirezionale 5. La Trascrizione contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale dogma centrale della biologia molecolare flusso dell'informazione

Dettagli

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente:

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente: Materiale Didattico Titolo modulo: Biologia applicata alla ricerca Biomedica LA TRASCRIZIONE Docente: FLUSSI DI INFORMAZIONE ATTRAVERSO LA CELLULA 1. Accessibilità del genoma 2. Assemblaggio del complesso

Dettagli

LA REGOLAZIONE GENICA DEI PROCARIOTI.

LA REGOLAZIONE GENICA DEI PROCARIOTI. LA REGOLAZIONE GENICA DEI PROCARIOTI www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con cui viene

Dettagli

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito

Dettagli

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi)

TRADUZIONE. 2. Transfer (legato agli aminoacidi) 3. Ribosomale (associato a proteine nei ribosomi) enhancer promotore regione trascritta TATA trascrizione 5 3 splicing mrna 5 3 traduzione Proteina NH2 COOH Funzione biologica TRADUZIONE I tre ruoli svolti dall RNA: 1. Messaggero 2. Transfer (legato agli

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Trascrizione e sue regolazioni

Trascrizione e sue regolazioni Corso di Laurea in Chimica e Tecnologie Farmaceu0che a.a. 2011-2012 Università di Catania Trascrizione e sue regolazioni Trascrizione nei procario0 Stefano Forte Le tre fasi della trascrizione Trascrizione

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

INTERAZIONE TRA mrna, trna e RIBOSOMI

INTERAZIONE TRA mrna, trna e RIBOSOMI INTERAZIONE TRA mrna, trna e RIBOSOMI mrna: porta l'informazione della sequenza degli aminoacidi di una determinata proteina. trna: ogni trna è specifico per il trasporto di un determinato aminoacido Ribosoma:

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT2 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 IL MATERIALE GENETICO 2 2 Per svolgere il proprio ruolo, il materiale genetico

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie Lezione 1 Il clonaggio 2 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi

Dettagli

Biologia Molecolare. CDLM in CTF La trascrizione nei procarioti

Biologia Molecolare. CDLM in CTF La trascrizione nei procarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione nei procarioti I meccanismi della trascrizione Il modello dell operone L attenuazione Batteri Polimerasi RNA Polimerasi Geni Trascritti Tutti

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

Corso di Genetica -Lezione 12- Cenci

Corso di Genetica -Lezione 12- Cenci Corso di Genetica -Lezione 12- Cenci Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

1) Un gene-un enzima 2) Un gene- una catena polipeptidica

1) Un gene-un enzima 2) Un gene- una catena polipeptidica 1) Un gene-un enzima 2) Un gene- una catena polipeptidica 3) Un gene è una unità funzionale di DNA che codifica per la sequenza amminoacidica di uno o più polipeptidi o alternativamente per uno o più tipi

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2013-2014 corso A- L Docente: Massimo Gulisano m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza dei legami deboli

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2014-2015 corso A- L Docente: Massimo Gulisano Cell 3483391646 Email m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza

Dettagli

Lezione 6 - Trascrizione del DNA

Lezione 6 - Trascrizione del DNA Lezione 6 - Trascrizione del DNA 1. Flusso dell informazione genetica 2. RNA polimerasi 3. Siti di inizio e fine trascrizione 4. Reazione 5. Differenze tra procarioti ed eucarioti 6. Enhancer 7. Maturazione

Dettagli

MODELLO SCHEDA INSEGNAMENTO

MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino

Dettagli

Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi

Dettagli

Lezione 1. Le molecole di base che costituiscono la vita

Lezione 1. Le molecole di base che costituiscono la vita Lezione 1 Le molecole di base che costituiscono la vita Le molecole dell ereditarietà 5 3 L informazione ereditaria di tutti gli organismi viventi, con l eccezione di alcuni virus, è a carico della molecola

Dettagli

Codice Genetico (segue) 29/10/2014 CODICE GENETICO

Codice Genetico (segue) 29/10/2014 CODICE GENETICO CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. CODICE GENETICO Consiste di codoni a tre nucleotidi

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE BIOLOGIA MOLECOLARE DEGLI EUCARIOTI Roberto Giacominelli Stuffler 1. I geni ed il DNA degli eucarioti 2. La replicazione, la trascrizione e la

Dettagli

La cellula eucariotica e i suoi organuli (seconda parte)

La cellula eucariotica e i suoi organuli (seconda parte) Università di Ferrara Corso di Laurea in Scienze Motorie Primo anno di corso Corso di Biologia Applicata Lezione di Biologia Cellulare La cellula eucariotica e i suoi organuli (seconda parte) Dott.ssa

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

QUANTI MECCANISMI DI REGOLAZIONE DELL ESPRESSIONE GENICA ESISTONO?

QUANTI MECCANISMI DI REGOLAZIONE DELL ESPRESSIONE GENICA ESISTONO? QUANTI MECCANISMI DI REGOLAZIONE DELL ESPRESSIONE GENICA ESISTONO? L espressione genica nei procarioti e negli eucarioti e regolata a vari livelli: -Trascrizionale - Emivita dell RNA -Traduzionale - durante

Dettagli

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA Corso di Laurea in Chimica e Tecnologie Farmaceu,che a.a. 2014-2015 Università di Catania Il Codice Gene,co Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del

Dettagli

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957

IL FLUSSO DELL INFORMAZIONE GENETICA. DNA à RNA. RNA à PROTEINA. DNA à RNA à PROTEINA. Dogma centrale della biologia molecolare di Francis Crick, 1957 IL FLUSSO DELL INFORMAZIONE GENETICA DNA à RNA à PROTEINA Dogma centrale della biologia molecolare di Francis Crick, 1957 DNA/RNA (seq polinucleotidica) DNA à RNA mrna trna rrna RNA à PROTEINA Proteina

Dettagli

GENOME: total genetic information carried by a cell or organism

GENOME: total genetic information carried by a cell or organism LA TRASCRIZIONE Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries information from one generation

Dettagli