espressione genica processo attraverso cui l informazione di un gene viene decodificata

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "espressione genica processo attraverso cui l informazione di un gene viene decodificata"

Transcript

1 espressione genica processo attraverso cui l informazione di un gene viene decodificata

2 regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso o non espresso controlli post-trascrizionali

3 geni a espressione costitutiva geni a espressione regolata proteine regolatrici dell espressione genica sequenza regolatrice di DNA

4 proteine regolatrici dell espressione genica domini o motivi strutturali elica-giro-elica zinc finger (dita di zinco) leucine zipper (dimero a cerniera lampo di leucina)

5 proteine regolatrici dell espressione genica regolazione + regolazione -

6 sequenza regolatrice di DNA

7 come operano sequenze regolatrici e proteine regolatrici? cellula procariotica: E. coli

8 cistrone: sequenza di DNA codificante per una proteina operone = cistroni + unico promotore operone del triptofano triptofano disponibile: operone spento triptofano non disponibile: operone acceso proteina regolatrice: repressore del triptofano sequenza regolatrice: operatore

9 repressore del triptofano triptofano funziona da co-repressore controllo negativo (prevalente nei procarioti) operone reprimibile

10 gene costitutivo

11 controllo positivo proteina regolatrice: attivatore sequenza regolatrice: operatore

12 lattosio = glucosio + galattosio enzimi per il metabolismo del lattosio: β-galattosidasi, lattosio permeasi, galattoside trans-acetilasi operone lac (operone del lattosio)

13 operone lac (operone del lattosio) controllo negativo e controllo positivo glucosio è il substrato preferenziale per produrre energia

14 operone lac (operone del lattosio) - lattosio controllo negativo

15 + lattosio assenza del controllo negativo

16 [glucosio] [camp] + CAP CAP: proteina attivatrice dei geni catabolici (regolazione positiva) + lattosio - glucosio

17 CAP: proteina attivatrice dei geni catabolici (regolazione positiva) repressore (regolazione negativa)

18 lac operon

19 eucarioti pluricelullari risposte ai cambiamenti dell ambiente differenziamento cellulare processo attraverso cui una cellula di un tessuto acquisisce le proprietà morfologiche e strutturali che la caratterizzano

20 epiteliale connettivo muscolare nervoso

21 cellule somatiche specializzazione cellulare cellule germinali zigote

22 primo esperimento di clonaggio di un organismo animale pluricellulare clone: individuo con tutti gli elementi cellulari geneticamente uguali

23 durante il differenziamento cellulare non c è perdita di materiale genetico, le differenze fra le varie cellule stanno nei sistemi di regolazione di espressione genica geni a espressione costitutiva (house-keeping) geni a espressione regolata geni tessuto-specifici (dipendono dal differenziamento cellulare)

24 cellule eucariotiche non ci sono operoni integrazione di diversi segnali sul promotore compattamento del DNA in cromatina

25 RNA polimerasi eucariotiche richiedono i fattori generali di trascrizione

26 oltre ai fattori generali di trascrizione gli eucarioti presentano proteine regolatrici dette fattori trascrizionali specifici

27 proteine regolatrici negli eucarioti si chiamano fattori trascrizionali proteine regolatrici: due domini dominio di legame al DNA (motivo strutturale visto in precedenza) dominio di attivazione della trascrizione proteine regolatrici: attivatori le proteine attivatrici si legano a sequenze di DNA regolatorie dette enhancer

28 mediatore formazione di anse di DNA (DNA looping)

29 proteine regolatrici: repressori o inibitori le proteine inibitrici si legano a sequenze di DNA regolatorie dette silencer

30 eterocromatina: struttura molto compatta eucrocromatina: struttura decondensata

31 nuclei interfasici eterocromatina eucrocromatina si può regolare l espressione di un gene modificando l organizzazione della cromatina

32 proteine regolatrici modificano la struttura locale della cromatina modificando covalentemente gli istoni rimodellando i nucleosomi acetilazione di lisina metilazione di lisina fosforilazione di serina rimuovendo i nucleosomi sostituendo i nucleosomi

33 proteine regolatrici modificano la struttura locale della cromatina istone acetilasi (HAT) complesso di rimodellamento della cromatina

34 metilazione della citosina rende il DNA meno trascrivibile il quadro di metilazione viene trasmesso durante la duplicazione del DNA

35 eredità epigenetica forma di eredità che si sovrappone alla eredità genetica che coinvolge cambiamenti nella sequenza nucleotidica di un gene si può dunque influenzare l architettura dei nostri geni senza modificare la sequenza del DNA la metilazione di una base del DNA può inattivare il gene in questione, viceversa il suo distacco attiva l espressione del gene

36 un tipo di meccanismo epigenetico si basa sull eredità di modificazioni istoniche

37 regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso o non espresso controlli post-trascrizionali

38 mirna: microrna si appaiano agli mrna e ne regolano stabilità riducono la traduzione della proteina

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Mutazioni genetiche 2

Mutazioni genetiche 2 Mutazioni genetiche 2 Cosa sono le mutazioni? Le proteine sono in grado di svolgere la loro funzione solo se la loro sequenza amminoacidica è quella corretta. In caso contrario si possono generare delle

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,

Dettagli

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi Enorme diversità di forme Costanza di struttura interna La cellula è l unità fondamentale di tutti gli organismi viventi

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

3 modulo didattico - Le

3 modulo didattico - Le 3 modulo didattico - Le mutazioni del DNA e le malattie monogeniche. Le mutazioni del genoma umano Mutazione: qualsiasi cambiamento permanente ed ereditabile del DNA Mutazione ereditata proveniente dai

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni

Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Programma del corso di Istologia CL in Infermieristica-sedi di Perugia e Terni Docente: dott. Tiziano Baroni (tbaroni@unipg.it) Il corso (1 CFU=30 ore), affronterà argomenti teorici e pratici concernenti

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 15 Capitolo 12

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 15 Capitolo 12 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 15 Capitolo 12 1 Genetica del lievito S. cerevisiae

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

Cosetta Greco. psicogenealogia: Traumi e Destini familiari

Cosetta Greco. psicogenealogia: Traumi e Destini familiari Cosetta Greco psicogenealogia: Traumi e Destini familiari Ogni individuo riceve dalle generazioni precedenti e trasmette alle successive sia strutture genetiche che sovrastrutture epigenetiche cioè il

Dettagli

Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da

Dettagli

Attività fisica e stress cellulare: la ricetta dell eterna giovinezza?

Attività fisica e stress cellulare: la ricetta dell eterna giovinezza? Attività fisica e stress cellulare: la ricetta dell eterna giovinezza? Claudio Stefanelli Dipartimento di Biochimica Università di Bologna Istituto Nazionale per la Ricerca Cardiovascolare Invecchiamento

Dettagli

unità 4. Dalla genetica alle biotecnologie

unità 4. Dalla genetica alle biotecnologie I virus I virus non vengono considerati esseri viventi. Ciò è dovuto al fatto che queste particelle microscopiche non sono in grado di svolgere alcuna funzione metabolica e non possono riprodursi autonomamente.

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

PROGRAMMA EFFETTIVAMENTE SVOLTO DAL DOCENTE

PROGRAMMA EFFETTIVAMENTE SVOLTO DAL DOCENTE Ministero dell istruzione, dell università e della ricerca Istituto d Istruzione Superiore Severi-Correnti IIS Severi-Correnti 02-318112/1 via Alcuino 4-20149 Milano 02-33100578 codice fiscale 97504620150

Dettagli

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti Gli attivatori trascrizionali sono delle proteine modulari domini funzionali sovrapposti DIMOSTRAZIONE SPERIMENTALE DI DOMINI FUNZIONALI SEPARATI NEL TF DI LIEVITO GAL 4! Esperimenti di Ptshane. Cellule

Dettagli

Geni e ambiente. Veronica Mariotti

Geni e ambiente. Veronica Mariotti Geni e ambiente nello sviluppo del fenotipo Veronica Mariotti Innato e Appreso XVII secolo- filosofo Jhon Locke : le esperienze hanno un ruolo predominante nella formazione dell individuo XIX secolo -

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

DIFFERENZIAMENTO CELLULARE

DIFFERENZIAMENTO CELLULARE DIFFERENZIAMENTO CELLULARE In un organismo pluricellulare, il processo che conduce alla formazione di differenti tipi di cellule si definisce differenziamento cellulare. Il destino di ciascuna cellula

Dettagli

PROF. Edoardo Soverini

PROF. Edoardo Soverini PROGRAMMA SVOLTO A.S. 2015-2016 PROF. Edoardo Soverini MATERIA: Scienze Naturali CLASSE IIB Liceo I. CONTENUTI DISCIPLINARI, FINALITÀ E OBIETTIVI FORMATIVI DELLA DISCIPLINA UNITÀ DIDATTICHE - MODULI PERIODO

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

1 modulo didattico - Impatto clinico delle malattie genetiche e

1 modulo didattico - Impatto clinico delle malattie genetiche e 1 modulo didattico - Impatto clinico delle malattie genetiche e fondamenti di genetica GENETICA MEDICA OBBIETTIVI FORMATIVI Conoscere le basi cellulari e molecolari dell eredità Conoscere le basi genetiche

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R

proteasi (distrugge le proteine) batteri virulenti del ceppo S e del ceppo R unità 1. La funzione del DN negli organismi La funzione del DN L acido desossiribonucleico o DN (dall inglese deoxyribonucleic acid) è la molecola informazionale delle cellule. Essa contiene e trasmette

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

La pompa Na + /Glucosio: simporto

La pompa Na + /Glucosio: simporto MFN0366-A1 (I. Perroteau) - trasportatori e canali La pompa Na + /Glucosio: simporto Il trasportatore oscilla fra due stati alternativi (A e B); nello stato A la proteina è aperta nello spazio extracellulare,

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! rimodellatori? Svolgimento del DNA nucleosmale a par6re

Dettagli

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione La mappatura dei geni umani SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione Un grande impulso alla costruzione di mappe genetiche è stato dato da le tecniche della

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli