CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina"

Transcript

1 CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono cinque tipi di istoni: H1, H2A, H2B, H3 e H4 H2A, H2B, H3 e H4 = core = ottamero formato da due molecole di ognuno dei 4 istoni H1 = istone di giunzione

2 Funzione degli istoni Gli istoni agiscono sulla cromatina principalmente come elementi strutturali che mantengono il DNA in specifiche conformazioni tridimensionali I cinque tipi di istoni possono essere modificati dall aggiunta di gruppi chimici ai singoli residui aminoacidici. Aggiunta di gruppi acetilici, metilici o fosfato o di proteine quali l ubiquitina

3 istoni e protammine Gli istoni di tutte le specie eucariotiche sono codificati da geni presenti in copie multiple Ne derivano varianti anche in individui appartenenti alla stessa specie Le varianti possono apparire o scomparire in relazione allo sviluppo embrionale, a cicli di crescita e di divisione di singole linee cellulari Durante le modificazioni biochimiche e strutturali che portano alla formazione dei gameti maschili dotati di movimento, sia nelle piante che negli animali, gli istoni sono in parte o completamente sostituiti da un gruppo di proteine molto più piccole e dotate di una maggiore carica positiva, le protammine

4 Nucleosoma Unità fondamentale e ripetitiva della cromatina formata da un ottamero di due copie di ciascuno dei quattro istoni (H2A, H2B, H3, H4) attorno a cui è avvolto il DNA per 1 giro e ¾ (146 nucleotidi). Due nucleosomi successivi sono associati dall istone H1 Il DNA linker è un segmento di DNA che connette un nucleosoma al successivo

5 Organizzazione del DNA Il DNA è organizzato in ordini strutturali che dipendono da proteine chiamate istoni. Esse permettono la compattazione del materiale genetico in modo che esso possa essere contenuto all interno del nucleo. Inoltre, il complesso DNA+istoni è ancorato ad una impalcatura, detta scaffold, che costituisce lo scheletro del cromosoma. Organizzazione degli istoni Il filamento di DNA è attaccato allo scaffold in modo da formare numerose anse ( loops ). Le zone di DNA attaccate ad esso si chiamano regioni SAR (Scaffold Attachment Regions) e sono ricche di A-T. Scaffold e loops di DNA

6 I nucleosomi sono costituiti da DNA avvolto attorno a un ottamero costituito da 2 copie degli istoni H2A, H2B, H3 e H4.

7 Il DNA nei cromosomi non è lineare fibra di 30 nm cromatina decondensata (collana di perle)

8 I nucleosomi sono compattati insieme dall istone H1 a formare la fibra da 30 nm (cromatina).

9 Il modello a solenoide della cromatina condensata (fibra da 30 nm)

10 La cromatina viene ulteriormente compattata nel cromosoma metafasico.

11

12

13 30 nm

14 30 nm

15

16

17

18

19 Strutture di ordine superiore della cromatina LA CROMATINA E UNA STRUTTURA ALTAMENTE DINAMICA CON LIVELLI DIVERSI DI ORGANIZZAZIONE CHE RIFLETTONO LA SUA ATTIVITA Durante la trascrizione e la replicazione del DNA i nucleosomi vanno incontro a modificazioni A livello dei geni attivati i nucleosomi vengono perduti parzialmente o completamente La configurazione a collana è presente solo in preparazioni cellulari trattate con agenti che allentano la struttura della cromatina Nella cromatina allo stato nativo i nucleosomi si avvolgono in una spirale regolare chiamata SOLENOIDE

20 Strutture di ordine superiore della cromatina LA CROMATINA E UNA STRUTTURA ALTAMENTE DINAMICA CON LIVELLI DIVERSI DI ORGANIZZAZIONE CHE RIFLETTONO LA SUA ATTIVITA NUCLEOSOMA FIBRA CROMATINICA i nucleosomi adiacenti sono connessi da un corto segmento di DNA spaziatore. Nell insieme tale struttura assume l aspetto di un filo di perle SOLENOIDE è una spirale che contiene da 6 a 8 nucleosomi per giro. I solenoidi si organizzano intorno ad una impalcatura centrale formando delle ANSE Le anse si spiralizzano ulteriormente

21 Si individuano due distinti tipi di cromatina l eucromatina e l eterocromatina. EUCROMATINA Trascrizionalmente attiva Elevata velocità di replicazione Elevata sensibilità alle nucleasi Bassa condensazione ETEROCROMATINA Trascrizionalmente inattiva Bassa velocità di replicazione Bassa sensibilità alle nucleasi Elevata condensazione

22 Ipotesi per la rimozione dei nucleosomi Gli istoni ed i nucleosomi sono rimossi quasi completamente dai siti di trascrizione o di replicazione a) In seguito alla conversione della cromatina dallo stato inattivo a quello attivo l istone H1 può essere rilasciato permettendo lo scorrimento dei nucleosomi lungo il DNA per fare spazio agli enzimi della trascrizione b) L acetilazione degli istoni legati al DNA attivo trascrizionalmente riduce l attrazione elettrostatica e facilita lo svolgimento del DNA e la rimozione dei nucleosomi dai siti attivi c) i complessi enzimatici attivi nella trascrizione e replicazione legano il DNA così fortemente da spiazzare i nucleosomi

23 Gli istoni nel nucleosoma contengono code aminoterminali flessibili che sporgono dalla loro porzione globulare, ricche in lisine (aa con carica positiva). In virtù della carica positiva, le lisine interagiscono con i gruppi fosfato del DNA COMPATTAMENTO Le lisine possono essere reversibilmente acetilate e deacetilate da enzimi specifici (HAT acetilasi degli istoni, HDAC de-acetilasi dgli istoni) L acetilazione neutralizza la carica positiva eliminando l interazione con il DNA e rendendo meno facile la compattazione dei nucleosomi. Acetilazione degli istoni

24 Proteine non istoniche TUTTE QUELLE PROTEINE, ESCLUSI GLI ISTONI, CHE SONO ASSOCIATE CON IL DNA NELLA CROMATINA - Hanno carica negativa a ph fisiologico - Sono classificate in diversi gruppi: a) Proteine che regolano la trascrizione genica b) Enzimi e fattori attivi nella trascrizione, replicazione, ricombinazione, riparazione del DNA. c) Proteine che contribuiscono al mantenimento della struttura della cromatina dallo stato decondensato allo stato altamente compatto

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

Struttura della cromatina= struttura quaternaria del DNA

Struttura della cromatina= struttura quaternaria del DNA Struttura della cromatina= struttura quaternaria del DNA Confronto fra cellula eucariotica e procariotica I procarioti hanno una copia unica del/dei cromosoma/i, organizzata in una struttura detta nucleoide.

Dettagli

Dogma centrale DNA RNA PROTEINE

Dogma centrale DNA RNA PROTEINE Dogma centrale DNA RNA PROTEINE Il DNA è un lungo polimero lineare che contiene l informazione genetica. L informazione genetica è contenuta nell ordine lineare dei nucleotidi. Si trova nel nucleo delle

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 5. NUCLEOSOMI contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

La struttura della cromatina

La struttura della cromatina La struttura della cromatina Istoni e nucleosomi La cromatina Il DNA all interno del nucleo eucariotico è associato a delle proteine. Il complesso DNA-proteina si chiama cromatina. Se nuclei interfasici

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

informazione ed espressione genica

informazione ed espressione genica a.a. 2015-16 CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata informazione ed espressione genica Biologia Applicata_M.Greco 1 ACIDI NUCLEICI (DNA, RNA) Gli acidi nucleici trasmettono

Dettagli

Organizzazione del DNA negli organismi superiori. La cromatina (DNA + proteine)

Organizzazione del DNA negli organismi superiori. La cromatina (DNA + proteine) Organizzazione del DNA negli organismi superiori La cromatina (DNA + proteine) Piccole proteine basiche altamente conservate Gli istoni IL NUCLEOSOMA Il nucleosoma è formato da quattro coppie degli istoni

Dettagli

Dogma centrale DNA RNA PROTEINE

Dogma centrale DNA RNA PROTEINE Dogma centrale DNA RNA PROTEINE Il Genoma cellulare specifica: La struttura primaria delle proteine Destinazione delle proteine all interno della cellula Presenza o assenza della proteina in un determinato

Dettagli

2. I nucleosomi 11/02/16

2. I nucleosomi 11/02/16 2. I nucleosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale u Ordinato e dinamico u Formazione della struttura terziaria

Dettagli

Studio della regolazione dell espressione genica

Studio della regolazione dell espressione genica Studio della regolazione dell espressione genica Un gene soggetto a regolazione possiede una o più sequenze regolatorie posizionate in maniera diversa rispetto al gene. I regolatori possono essere positivi

Dettagli

Dimensioni di Genomi

Dimensioni di Genomi Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Una cellula somatica umana possiede circa 4000 pori nucleari

Una cellula somatica umana possiede circa 4000 pori nucleari IL NUCLEO Una cellula somatica umana possiede circa 4000 pori nucleari Cisterna perinucleare 40-50 nm La membrana nucleare esterna è continua con le membrane del reticolo endoplasmatico per cui lo spazio

Dettagli

Stesso DNA ma cellule diverse

Stesso DNA ma cellule diverse Stesso DNA ma cellule diverse Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico I cromosomi sono in coppia Ogni cromosoma

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

La regolazione genica negli eucarioti

La regolazione genica negli eucarioti La regolazione genica negli eucarioti neuroni globuli rossi globulo bianco fibroblasti adipociti Sezione di testicolo Surrene Come mai alcuni geni sono trascritti e tradotti in alcune cellule ma non in

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

GENOTIPO: costituzione genetica di un individuo (sia riferito ad un singolo gene, sia all insieme dei suoi geni).

GENOTIPO: costituzione genetica di un individuo (sia riferito ad un singolo gene, sia all insieme dei suoi geni). DNA e geni Cosa sono i geni? Sono tratti di DNA ben delimitati Sono sequenze codificanti: tramite le istruzioni contenute in uno specifico gene viene prodotta una caratteristica fenotipica (carattere).

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

La struttura dell RNA

La struttura dell RNA La struttura dell RNA L RNA differisce dal DNA per tre differenti caratteristiche: 1. L impalcatura fondamentale contiene il ribosio e non il 2 -deossiribosio. 2. Contiene l uracile al posto della timina.

Dettagli

Il ruolo del DNA nell ereditarietà

Il ruolo del DNA nell ereditarietà Il ruolo del DNA nell ereditarietà Gli esperimenti di Fredrick Griffith su Streptococcus pneumoniae hanno dimostrato la presenza di un «principio trasformante» ereditabile. Il ruolo del DNA nell ereditarietà

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

ORGANIZZAZIONE. IMPACCHETTAMENTO del DNA EUCARIOTICO

ORGANIZZAZIONE. IMPACCHETTAMENTO del DNA EUCARIOTICO ORGANIZZAZIONE FISICA ED IMPACCHETTAMENTO del DNA EUCARIOTICO Aspetti fondamentali di un genoma EUCARIOTICO E LINEARE E fisicamente organizzato in una struttura: NUCLEOSOMA (DNA+istoni) che forma altre

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Involucro nucleare Doppia membrana Pori Matrice Nucleare /Nucleoplasma

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

La lunghezza degli acidi nucleici è molto più grande delle dimensioni dei compartimenti che li racchiudono

La lunghezza degli acidi nucleici è molto più grande delle dimensioni dei compartimenti che li racchiudono La lunghezza degli acidi nucleici è molto più grande delle dimensioni dei compartimenti che li racchiudono ASSEMBLAGGIO DEL VIRUS TMV (Mosaico del tabacco) Ha 1 molecola di RNA a singolo filamento della

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

BASI DI GENETICA E GENOMICA

BASI DI GENETICA E GENOMICA BASI DI GENETICA E GENOMICA CORSO TANDEM 2018-2019 Dr. Marzia Rossato Ricercatore RTDB, settore Genetica Cà Vignal 1 laboratorio 1.63 - ufficio 2.14 marzia.rossato@univr.it Email per apputamento - ricevimento

Dettagli

Nucleo 21/10/15. Nucleo. Nucleo. Involucro nucleare: sistema doppio di membrane separate, continuo al RER, senza ribosomi sulla faccia interna

Nucleo 21/10/15. Nucleo. Nucleo. Involucro nucleare: sistema doppio di membrane separate, continuo al RER, senza ribosomi sulla faccia interna Organulo più voluminoso (5 µm) Rapporto /plasmatico: indice caratteristico delle cellule somatiche di un organismo => divisione cellulare Forma: correlata alla cellula; regolare (fusata, sferica, ellittica...)

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

CAPITOLO 1. collaboratori, possiede un attività inibitoria nei confronti dell istone deacetilasi di classe

CAPITOLO 1. collaboratori, possiede un attività inibitoria nei confronti dell istone deacetilasi di classe CAPITOLO 1 1. Introduzione Il Cambinol, composto chimico stabile identificato e caratterizzato da Bedalov e collaboratori, possiede un attività inibitoria nei confronti dell istone deacetilasi di classe

Dettagli

Jay Phelan, Maria Cristina Pignocchino. Scopriamo la biologia

Jay Phelan, Maria Cristina Pignocchino. Scopriamo la biologia Jay Phelan, Maria Cristina Pignocchino Scopriamo la biologia Capitolo 4 La divisione cellulare e la riproduzione 3 1. La divisione cellulare /1 La divisione cellulare negli organismi unicellulari coincide

Dettagli

Una cellula somatica umana possiede circa 4000 pori nucleari

Una cellula somatica umana possiede circa 4000 pori nucleari IL NUCLEO Una cellula somatica umana possiede circa 4000 pori nucleari Cisterna perinucleare 40-50 nm La membrana nucleare esterna è continua con le membrane del reticolo endoplasmatico per cui lo spazio

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

La cellula eucariotica animale

La cellula eucariotica animale Tutte le cellule sono circondate da una membrana plasmatica costituita da fosfolipidi e proteine. Le cellule eucariotiche posseggono organuli rivestiti di membrana. L organulo di dimensioni maggiori è

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica Cenni al controllo dell espressione genica Essentials of Cell Biology Unit 2: How Do Cells Decode Genetic Information into Functional Proteins? Biotecnologie_2013 http://www.nature.com/scitable/ebooks/essentials

Dettagli

un gene-una proteina un gene- un polipeptide

un gene-una proteina un gene- un polipeptide REGOLAZIONE GENICA ESPRESSIONE GENICA RELAZIONE GENI PROTEINE Gorge Beadle e Edward Tatum (1940) Beadle e Tatum condussero negli anni quaranta ricerche sulla muffa del pane (neurospora crassa) Mutando

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

ll materiale genetico: DNA e RNA (parte 2)

ll materiale genetico: DNA e RNA (parte 2) ll materiale genetico: DNA e RNA (parte 2) Gli Acidi Nucleici: struttura dei nucleotidi I nucleotidi sono molecole in cui si possono riconoscere tre porzioni: una base azotata, uno zucchero e un gruppo

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita.

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita. MFN0366-A1 (I. Perroteau) - Ciclo cellulare 21_bct_2011 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

LA GENETICA MOLECOLARE

LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2011 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita. 08_bct_2011 1

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita. 08_bct_2011 1 MFN0366-A1 (I. Perroteau) - il nucleo 08_bct_2011 1 MFN0366-A1 (I. Perroteau) - il nucleo Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma

Dettagli

BIOMOLECOLE (PROTEINE)

BIOMOLECOLE (PROTEINE) BIOMOLECOLE (PROTEINE) Proteine: funzioni Strutturale (muscoli, scheletro, legamenti ) Contrattile (actina e miosina) Di riserva (ovoalbumina) Di difesa (anticorpi) Di trasporto (emoglobina, di membrana)

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 20 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 20 Geni e cromosomi Concetti chiave: Il DNA superavvolto può essere descritto in termini di numero di legami, avvolgimenti

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica Ogni processo che porta dal DNA alla proteina funzionale è soggetto a regolazione. Il primo processo relativo alla trascrizione è il più importante punto di regolazione

Dettagli

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Lunghezza del cromosoma di E.coli (1,7 mm) paragonata alla lunghezza di una tipica cellula di E. coli (2μm) DNA di una cellula

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Biologia. La divisione cellulare

Biologia. La divisione cellulare Biologia La divisione cellulare Lezione 1 Il ciclo cellulare: una visione d insieme Cavazzuti La vita intorno a noi Zanichelli editore 2010 1. Crescere e riprodursi sono caratteristiche fondamentali degli

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Nucleo 14/01/2013 NUCLEO. Biotec 2012 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 14/01/2013 NUCLEO. Biotec 2012 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2012 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare

Dettagli

GENI, GENOMI E CROMOSOMI

GENI, GENOMI E CROMOSOMI www.fisiokinesiterapia.biz GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna

Dettagli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Doppia membrana Pori Matrice

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria cellulare (Schleiden e

Dettagli

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali Fattori di crescita Recettori di fattori di crescita Membrana citoplasmatica roteine trasduttrici del segnale Nucleo Fattori trascrizionali roteine del ciclo cellulare Ciclo di divisione cellulare Fattori

Dettagli

Nucleo INVOLUCRO NUCLEARE 15/01/2014. Biotecnologie INVOLUCRO NUCLEARE (1)

Nucleo INVOLUCRO NUCLEARE 15/01/2014. Biotecnologie INVOLUCRO NUCLEARE (1) Nucleo Biotecnologie Nucleo Organello che contiene il materiale genetico di una cellula eucariote INVOLUCRO NUCLEARE (1) Nucleo INVOLUCRO NUCLEARE http://www.nature.com/nrm/journal/v5/n1/images/nrm1263

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

= è il processo che permette di formare, da una cellula madre, 2 cellule figlie

= è il processo che permette di formare, da una cellula madre, 2 cellule figlie Divisione cellulare = è il processo che permette di formare, da una cellula madre, 2 cellule figlie Esistono due tipi diversi di divisione cellulare: Mitosi (unicallulari/pluricellulari) e Meiosi (pluricellulari)

Dettagli

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT2 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 IL MATERIALE GENETICO 2 2 Per svolgere il proprio ruolo, il materiale genetico

Dettagli

L esperimento di Griffith sulla trasformazione genetica in pneumococco.

L esperimento di Griffith sulla trasformazione genetica in pneumococco. L esperimento di Griffith sulla trasformazione genetica in pneumococco. La natura chimica del materiale genetico ACIDI NUCLEICI DNA : deposito informazioni RNA: a) espressione informazione (es. sintesi

Dettagli

GENETICA la scienza dell ereditarietà e della variabilità. 2 incontro Regiroli Giovanni, biologo

GENETICA la scienza dell ereditarietà e della variabilità. 2 incontro Regiroli Giovanni, biologo GENETICA la scienza dell ereditarietà e della variabilità 2 incontro Regiroli Giovanni, biologo Il dogma centrale della biologia molecolare il DNA (acido deossiribonucleico) contiene l informazione genetica

Dettagli

21. Regolazione dell espressione genica

21. Regolazione dell espressione genica 21. Regolazione dell espressione genica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le cellule di un organismo pluricellulare

Dettagli

Nucleo. Spesso è la struttura più evidente TEM

Nucleo. Spesso è la struttura più evidente TEM Nucleo Spesso è la struttura più evidente MO TEM è delimitato da una doppia membrana (involucro nucleare) interrotta da numerosi pori poro nucleare ( 30-100nm) vi passano le grandi molecole RNA, proteine

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

La Chimica della Vita

La Chimica della Vita La Chimica della Vita I componenti chimici delle cellule Nell atomo il numero di elettroni è uguale al numero di protoni del suo nucleo. Il nucleo dei diversi isotopi di uno stesso elemento contiene lo

Dettagli

Nucleotidi e acidi nucleici

Nucleotidi e acidi nucleici Nucleotidi e acidi nucleici ACIDI NUCLEICI Biomolecole fondamentali per tutti gli organismi viventi Unici nella capacità di autoduplicazione Conservazione e trasmissione da una generazione all altra dell

Dettagli

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei.

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. DNA e RNA Composizione e proprietà Struttura Analisi 1 STRUTTURA DAGLI ACIDI NUCLEICI Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. I gruppi fosforici hanno pka vicino

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

vita delle cellule nelle cellule eucariote (con nucleo) il ciclo cellulare avviene in 5 fasi:

vita delle cellule nelle cellule eucariote (con nucleo) il ciclo cellulare avviene in 5 fasi: vita delle cellule negli organismi pluricellulari la produzione di cellule e la sostituzione di quelle danneggiate si chiama divisione cellulare sia nelle cellule procariote che in quelle eucariote la

Dettagli

2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI

2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 2. DUPLICAZIONE DNA 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 1 1. COMPOSIZIONE e STRUTTURA Ma che cos è il DNA? è un contenitore di informazioni... scritte come sequenza di basi azotate 2 Acidi Nucleici:

Dettagli

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI IL MATERIALE GENETICO Fino agli anni 40 si credeva che le proteine fossero le molecole della informazione ereditaria. C erano comunque

Dettagli

MODIFICAZIONI POST-TRADUZIONALI

MODIFICAZIONI POST-TRADUZIONALI MODIFICAZIONI POST-TRADUZIONALI Ilaria Lampronti, Ph. Biologia molecolare Biologia molecolare, Capranico G et al., EdiSES Biologia molecolare della cellula, B. Alberts et al., Zanichelli Modificazioni

Dettagli

LOCALIZZAZIONE CELLULARE DEGLI ACIDI NUCLEICI

LOCALIZZAZIONE CELLULARE DEGLI ACIDI NUCLEICI GLI ACIDI NUCLEICI PROF.SSA AUSILIA ELCE Indice 1 INTRODUZIONE -------------------------------------------------------------------------------------------------------------- 3 2 LOCALIZZAZIONE CELLULARE

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

COME SI DIVIDONO LE CELLULE:

COME SI DIVIDONO LE CELLULE: Percorso formativo disciplinare Disciplina: SCIENZE NATURALI CLASSE 3 Ct LICEO CLASSICO Anno scolastico 2017/2018 PARTE A CITOLOGIA UNITA 1 COME SI DIVIDONO LE CELLULE: TEMA n 1: la divisione cellulare

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Capitolo B4 Dal DNA alla genetica dei microrganismi

Capitolo B4 Dal DNA alla genetica dei microrganismi Quesiti e problemi 1 Uno zucchero pentoso, il desossiribosio; un residuo fosforico PO 4 2- ; una delle seguenti basi azotate: adenina, guanina, citosina e timina. 2 Manca il legame fosfodiestere tra i

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA PER ESPRESSIONE GENICA SI INTENDE L INSIEME DEI PROCESSI CHE PORTANO ALL UTILIZZO DELL INFORMAZIONE GENICA PER LA SINTESI DI UNA SPECIFICA PROTEINA. CONCETTUALMENTE,

Dettagli

MFN0366-A1 (I. Perroteau) - Trascrizione. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita.

MFN0366-A1 (I. Perroteau) - Trascrizione. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita. MFN0366-A1 (I. Perroteau) - Trascrizione 09_bct_2011 1 MFN0366-A1 (I. Perroteau) - Trascrizione NUCLEOLO Molti nuclei, contengono una o più strutture estremamente dense chiamate nucleoli, che sono i siti

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi. Possono assumere forme diverse a seconda della funzione

Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi. Possono assumere forme diverse a seconda della funzione Le proteine sono polimeri lineari costituiti da unità base formate da oltre 40 amminoacidi Hanno elevato PM Possono assumere forme diverse a seconda della funzione svolgono molteplici funzioni Tra le proteine

Dettagli