GENI, GENOMI E CROMOSOMI

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENI, GENOMI E CROMOSOMI"

Transcript

1 GENI, GENOMI E CROMOSOMI

2 GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna specie Caratteristiche del genoma di alcune specie a Organismo E. coli Saccharomyces cerevisiae (lievito) Drosophila melanogaster (moscerino della frutta) Homo sapiens Dimensioni (coppie di basi) 4,5 X X X X 10 6 Dimensioni (mm) 1,4 4, a per gli Eucarioti le dimensioni sono riferite al genoma aploide

3 GENI GENI: unità in cui è suddivisa l informazione genetica contenuta nel genoma Un GENE è un tratto di DNA, con una specifica sequenza, che contiene le informazioni necessarie per la sintesi di una proteina o, piu generalmente, di un RNA Organismo E. coli Saccharomyces cerevisiae Drosophila melanogaster Homo sapiens Numero geni

4 CROMOSOMI Il genoma di una specie può essere costituito da un unica o da più molecole di DNA, associato a proteine, che prendono il nome di cromosomi Organismo E. coli Saccharomyces cerevisiae Drosophila melanogaster Homo sapiens Numero a cromosomi Forma cromosomi circolare lineare lineare lineare a per gli Eucarioti il numero è riferito al genoma aploide

5 IL CROMOSOMA DEI PROCARIOTI E. coli ha un cromosoma circolare di circa 4,5x10 6 coppie di basi che sarebbe lungo 1,4 mm (1000 volte più dell intero batterio) se non fosse condensato mediante avvolgimenti del DNA Cromosoma non condensato rilasciato da una cellula lisata di E. coli.

6 I CROMOSOMI EUCARIOTICI I cromosomi eucariotici sono lunghe molecole lineari di DNA avvolte e ripiegate più volte Nei cromosomi il DNA è associato a proteine, formando una sostanza fibrosa detta cromatina. L associazione con proteine permette la compattazione delle molecole di DNA, che è massima durante la metafase, uno stadio della divisione cellulare Nella metafase i cromosomi formano delle strutture compatte e ben distinguibili

7 L UNITA DI BASE DELLA CROMATINA IL NUCLEOSOMA Un nucleosoma è formato da un corto segmento di DNA (146 coppie di nucleotidi) avvolto intorno a un ottamero di istoni Istoni: piccole proteine basiche con carica positiva, che facilita il loro legame con il DNA, carico negativamente 2 nm DNA OTTAMERO DI ISTONI (2 H2A + 2 H2B + 2 H3 +2 H4) Istone H1 L istone H1 stabilizza il legame tra il DNA e l ottamero di istoni

8 I nucleosomi sono connessi da segmenti di DNA linker, di circa 60 coppie di nucleotidi. Ne risulta una fibra di cromatina con una struttura detta a collana di perle 11 nm DNA linker

9 LIVELLI DI CONDENSAZIONE DEL DNA Nel cromosoma metafasico la molecola di DNA risulta volte più corta di quando è distesa

10

11 CORREDO CROMOSOMICO Ogni specie possiede un numero caratteristico di cromosomi Negli organismi a riproduzione sessuata le cellule somatiche contengono un set di cromosomi di origine materna e uno di origine paterna Ad esempio, nelle cellule somatiche della specie umana, sono presenti 46 cromosomi, 23 di origine paterna e 23 di origine materna. Questo costituisce il corredo cromosomico diploide (2n = 46) Nei gameti (cellule uovo e spermatozoi) sono presenti 23 cromosomi. Questo costituisce il corredo cromosomico aploide (n = 23)

12 CROMOSOMI OMOLOGHI Origine paterna Origine materna Cromosomi omologhi

13 ALLELI I cromosomi omologhi portano gli stessi geni. Quindi ogni gene è presente in duplice copia. I due geni possono però essere presenti in versioni diverse, dette alleli

14 CICLO CELLULARE MITOSI MEIOSI GAMETOGENESI

15 DIVISIONE CELLULARE NEI PROCARIOTI I batteri hanno un ciclo vitale di minuti La divisione cellulare avviene per scissione binaria e coincide con la riproduzione dell organismo, che è asessuata Le cellule figlie sono geneticamente identiche alla cellula madre. L insieme delle cellule derivate dalla stessa cellula madre sono tutte geneticamente identiche (cloni) Fattore che può rendere diverse le cellule: il verificarsi di mutazioni

16 DIVISIONE CELLULARE NEGLI EUCARIOTI Due tipi di mecanismi: MITOSI: riproduzione delle cellule somatiche MEIOSI: riproduzione dell organismo nelle specie a riproduzione sessuata. Avviene nelle cellule della linea germinale e porta alla formazione dei gameti Entrambi i meccanismi assicurano la corretta distribuzione dei cromosomi alle cellule figlie

17 CICLO CELLULARE Serie di eventi che avvengono tra una divisione e la cellulare e quella successiva Le cellule si dividono per permettere l accrescimento corporeo, per rimpiazzare altre cellule o per riprodurre l organismo

18 IL CICLO CELLULARE MITOTICO Si divide in due fasi principali: INTERFASE e FASE M INTERFASE E il periodo tra una divisione cellulare e la successiva. Si suddivide in tre fasi: G 1 : sintesi proteine e accrescimento della cellula S: duplicazione del DNA G 2 : crescita della cellula e preparazione alla mitosi FASE M: divisione dei cromosomi (mitosi) seguita da divisione cellulare (citocinesi)

19 DURATA DEL CICLO CELLULARE Per cellule umane in attiva proliferazione o in coltura la durata media del ciclo cellulare è di circa 24 ore, così suddivise Interfase Mitosi G1 S G2 M ore La durata complessiva del ciclo cellulare è però molto variabile, e dipende essenzialmente dalla durata della fase G1, che può andare, a seconda del tipo di cellula, da ore a mesi

20 IN BASE ALLA LORO CAPACITÀ DI CRESCERE E DI DIVIDERSI SI POSSONO DISTINGUERE: cellule che hanno perso la capacità di dividersi (cellule del tessuto nervoso e muscolare) cellule che normalmente non si dividono ma possono riprendere a dividersi in determinate situazioni, come la ri parazione di una ferita (cellule del fegato, fibroblasti della pelle). Queste cellule escono temporaneamente dal ciclo e rimangono in quiescenza per molto tempo, fino a quando un appropriato stimolo non le induce nuovamente a dividersi cellule che continuano a dividersi (cellule della pelle e degli altri epiteli, cellule staminali, cellule della linea germinale)

21 MITOSI Processo somatiche di divisione e riproduzione delle cellule Porta alle formazione di due cellule figlie diploidi Le due cellule figlie sono geneticamente uguali alla cellula madre e fra di loro Nell uomo 2n 2n 2n Cellula madre Cellule figlie

22 CROMOSOMI PRIMA E DOPO LA DUPLICAZIONE DEL DNA Cromosoma prima della duplicazione del DNA Cromosoma dopo duplicazione del DNA: formato da due cromatidi fratelli uguali Centromero Mitosi Ripartizione dei cromosomi alle cellule figlie

23 IL FUSO MITOTICO Il Il fuso fuso si si forma durante la la profase a partire da da due due centri organizzatori, detti centrosomi, ai ai poli poli opposti La La struttura che che permette la la migrazione dei dei cromatidi fratelli ai ai poli poli opposti e la la suddivisione precisa del del materiale genetico è il il fuso fuso mitotico Dal Dal centrosoma parte una una serie di di microtubuli, strutture fibrillari proteiche che che si si ancorano ai ai cromosomi In In molte cellule ciascun centrosoma contiene un un paio paio di di centrioli

24 I microtubuli del fuso agganciano i cromosomi e trascinano i cromatidi fratelli ai poli opposti della cellula Cinetocori: complessi proteici che si formano a livello dei centromeri e ai quali si agganciano i cromosomi

25 MITOSI FASI DELLA MITOSI PROFASE METAFASE - PRECOCE -TARDIVA ANAFASE TELOFASE

26 FASI DELLA MITOSI

27 FASI DELLA MITOSI

28 RIPRODUZIONE E MEIOSI

29 LA RIPRODUZIONE La riproduzione permette il trasferimento del materiale genetico a nuovi individui assicurando la continuazione della specie. Può essere di due tipi: asessuata (o agamica): il nuovo organismo origina da un singolo genitore. Gli organismi derivati sono geneticamente identici e costituiscono un clone. Nei Procarioti avviene per scissione binaria; avviene anche in alcuni Eucarioti, nei quali la divisione della cellula è preceduta dalla mitosi sessuata (o gamica): origina dalla fusione di due cellule sessuali diverse, i gameti, prodotti da due genitori di sesso diverso attraverso il meccanismo della meiosi

30 MEIOSI E RIPRODUZIONE I gameti aploidi vengono prodotti per meiosi, a partire da cellule diploidi della linea germinale Durante la fecondazione, l unione dei gameti aploidi ripristina il corredo diploide nello zigote Dallo zigote diploide, per mitosi successive, si sviluppano gli organismi adulti diploidi

31 MEIOSI Avviene nelle cellule della linea germinale Porta alla formazione di quattro cellule aploidi, i gameti Gameti Consta di due divisioni cellulari I a divisione meiotica o meiosi I II a divisione meiotica o meiosi II:

32 La riduzione del numero dei cromosomi avviene nella meiosi I Meiosi II come una mitosi

33 FASI DELLA MEIOSI: I DIVISIONE Profase I iniziale Profase I intermedia Profase I tardiva Crossing over La cromatina inizia a condensarsi I cromosomi si compattano ulteriormente. I cromosomi omologhi si appaiano Tra cromosomi omologhi avviene il crossing over. L involucro nucleare si dissolve Metafase I Anafase I Telofase I I cromosomi omologhi si allineano lungo la piastra metafasica I cromosomi omologhi migrano verso i poli opposti della cellula I cromosomi omologhi si raggruppano in due nuclei e la cellula si divide

34 FASI DELLA MEIOSI: II DIVISIONE Profase II Metafase II Anafase II Dopo una breve interfase, durante la quale il DNA non si duplica, i cromosomi si condensano nuovamente I cromosomi si allineano sulla piastra equatoriale I cromatidi di ciascun cromosoma si dividono e migrano verso i poli opposti delle cellule Telofase II Prodotti I cromosomi si raggruppano in due nuclei e le cellule si dividono Si sono formate 4 cellule, ciascuna con un numero aploide di cromosomi

35 n = corredo cromosomico aploide 2n = corredo cromosomico diploide

36 IL CROSSING-OVER Processo di ricombinazione (scambio di materiale genetico) tra cromosomi omologhi Profase I: i cromosomi omologhi si appaiano strettamente Tra i cromatidi dei due omologhi avviene il crossing-over: i cromatidi si rompono, si scambiano e si risaldano in modo che dopo il crossing-over una porzione di cromatidio di origine materna si trova su quello di origine paterna e viceversa Il risultato del crossing-over è un rimescolamento di pezzi di cromosomi e quindi dei geni

37 ASSORTIMENTO INDIPENDENTE DEI CROMOSOMI I cromosomi di ciascuna coppia di omologhi si separano e si combinano in maniera indipendente da quelli di un altra coppia. M= materno P = paterno 1P 1M 1P 1M 2P 2M 2M 2P 1P 1M 1P 1M 2P 2M 2M 2P 1P 1P 1M 1M 1P 1P 1M 1M 2P 2P 2M 2M 2M 2M 2P 2P I cromosomi di due coppie di omologhi possono così generare 4 diversi tipi di gameti

38 2 coppie di omologhi = (2 2 ) 4 gameti 3 coppie di omologhi = (2 3 ) 8 gameti. Nell uomo: 23 coppie di omologhi = 2 23 = 8,4 x 10 6 possibili gameti Ciascun individuo può produrre 8,4 x 10 6 possibili gameti che differiscono nella combinazione dei cromosomi

39 LA MEIOSI PRODUCE VARIABILITA GENETICA assortimento casuale dei cromosomi durante la I divisione meiotica: un individuo può produrre 2 23 (8,4 x 10 6 ) diversi tipi di gameti casualità della fecondazione di una certa cellula uovo con un certo spermatozoo cellula uovo (2 23 ) x spermatozoo (2 23 ) = 2 46 tipi di zigote crossing-over tra cromosomi omologhi: produce nuove combinazioni di geni Questi meccanismi fanno sì che ogni individuo abbia una costituzione genetica praticamente unica (ad eccezione dei gemelli monozigoti) La riproduzione sessuata produce diversità tra gli individui

40 CONFRONTO TRA MITOSI E MEIOSI n = corredo aploide 2n = corredo diploide

41 CONFRONTO TRA MITOSI E MEIOSI MITOSI Avviene nelle cellule somatiche Una divisione cellulare Produce due cellule diploidi (2 n) No crossing-over Cellule figlie geneticamente identiche MEIOSI Avviene nelle cellule linea germinale Due divisioni cellulari Produce quattro cellule aploidi (n) Sì crossing over Cellule figlie geneticamente diverse

42 GAMETOGENESI

43 SPERMATOGENESI Inizia alla pubertà Avviene nei tubuli seminiferi dei testicoli Complessivamente l intero processo impiega 48 giorni

44 OOOGENESI 2n 2n n n n n n n

45 OOOGENESI Inizia prima della nascita (intorno al 2-3 mese di vita embrionale) quando cellule specializzate per la riproduazione, gli oogoni, iniziano a dividersi per mitosi e a maturare in oociti primari (oociti I) Questi iniziano la I divisione meiotica, che si arresta nella profase I fino alla pubertà. Alla nascita, nelle ovaie, sono presenti circa oociti I, fermi in profase I A partire dalla pubertà, ogni mese, un oocita I completa la I divisione meiotica, originando un oocita secondario (oocita II) e un globulo polare, che degenera L oocita II inizia la II divisione meiotica che si arresta in metafase II e viene completata solo se si ha la fecondazione, generando una cellula uovo e un globulo polare

46 CONFRONTO TRA OVOGENESI E SPERMATOGENESI 1 sola cellula uovo 4 spermatozoi

47 Solo uno spermatozoo feconderà la cellula uovo, generando uno zigote La fecondazione ristabilisce nello zigote il numero diploide di cromosomi

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini pallavic@units.it MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento

Dettagli

CICLO CELLULARE MITOSI MEIOSI

CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

Cromosomi MITOSI MEIOSI

Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte I: Scissione Binaria dei Procarioti, Ciclo Cellulare e Mitosi degli Eucarioti. 1 riproduzione Negli organismi in cui avviene la riproduzione

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti.

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. 5.1 La divisione cellulare La divisione cellulare è il processo in seguito al quale una cellula si divide in due cellule figlie; generalmente

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà

Le basi cellulari della riproduzione e dell ereditarietà Le basi cellulari della riproduzione e dell ereditarietà riproduzione e divisione cellulare Negli organismi in cui avviene la riproduzione asessuata, la progenie è la copia genetica esatta dell unico genitore

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

CICLO CELLULARE MITOTICO

CICLO CELLULARE MITOTICO Cellula Procariotica La divisione cellulare è rapida e semplice. I batteri non hanno un nucleo e contengono un solo cromosoma di DNA circolare attaccato alla membrana plasmatica dove resta mentre si duplica.

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

MOLTIPLICAZIONE CELLULARE

MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Il concetto di riproduzione e la divisione cellulare 8.1 Il simile genera (quasi) sempre il simile Negli organismi in cui avviene la

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

MITOSI 09/11/16 CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI

MITOSI 09/11/16 CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C 4C MITOSI CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C (il valore C indica la quantità di DNA contenuto delle cellule, dove C è il contenuto aploide della specie). Dopo la replicazione C è raddoppiato

Dettagli

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE 1 4.1 Il simile genera (più o meno) il simile Gli organismi si riproducono secondo due modalità Riproduzione asessuata I figli ereditano il DNA di un

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

MERISTEMI APICALI. Apice del germoglio. Apice radicale

MERISTEMI APICALI. Apice del germoglio. Apice radicale MERISTEMI APICALI Apice del germoglio Apice radicale CICLO CELLULARE CHECK POINT 3 CHECK POINT 2 CHECK POINT 1 Le cellule vegetali differentemente da quelle animali possono abbandonare il ciclo di divisione

Dettagli

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I LA MEIOSI Una coppia di cromosomi omologhi, presenti nel nucleo di una cellula diploide, è costituita da un primo cromosoma isolato di derivazione paterna e da un secondo cromosoma isolato di derivazione

Dettagli

SPERMATOGONI A(scuri) poia1(chiari) SPERMATOCITA PRIMARIO (max 64 da 1 cell) SPERMATOCITI SECONDARI SPERMATIDI SPERMATOZOI MATURI.

SPERMATOGONI A(scuri) poia1(chiari) SPERMATOCITA PRIMARIO (max 64 da 1 cell) SPERMATOCITI SECONDARI SPERMATIDI SPERMATOZOI MATURI. Riproduzione asessuata o agama sessuata o gamica genera individui, questi costituiscono un clone dalla ricombinazione dei genotipi parentali emerge la producono una generazione di figli con un genoma risultante

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

MITOSI. Ciclo del centrosoma CARIOTIPO UMANO (2N) LA FASE M DEL CICLO CELLULARE. Struttura del citoscheletro durante la fase M

MITOSI. Ciclo del centrosoma CARIOTIPO UMANO (2N) LA FASE M DEL CICLO CELLULARE. Struttura del citoscheletro durante la fase M LA FASE M DEL CICLO CELLULARE MITOSI La fase M del ciclo cellulare comprende mitosi e citochinesi ed è innescata da M-CdK (chinasi ciclinadipendente di fase M) e da M-ciclina. Struttura del citoscheletro

Dettagli

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura Università di Bari Teoria Cromosomica Alcune caratteristiche fenotipiche di D. melanogaster Incrocio di un maschio white con femmina selvatica in D. melanogaster P SE FOSSE IL SEMPLICE FATTORE MEDELIANO?

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL CICLO CELLULARE, MITOSI E MEIOSI NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CELLULA DEVE CRESCERE

Dettagli

Genetica e Biometria

Genetica e Biometria Genetica e Biometria Info utili 1. Corso a frequenza OBBLIGATORIA 2. Tutte le lezioni saranno disponibili sul sito biotech in format pdf dopo essere state tenute dal docente! 3. Sono previste 2 VERIFICHE:

Dettagli

a.a CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata Mitosi e Meiosi

a.a CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata Mitosi e Meiosi a.a. 2015-16 CORSO DI LAUREA IN INFERMIERISTICA Dott.ssa Marilena Greco Biologia applicata Mitosi e Meiosi 1 Quando le cellule raggiungono una certa dimensione devono arrestare l accrescimento o dividersi.

Dettagli

GAMETOGENESI Dove avviene la meiosi nel nostro corpo?

GAMETOGENESI Dove avviene la meiosi nel nostro corpo? GAMETOGENESI Dove avviene la meiosi nel nostro corpo? gametogenesi nella femmina e nel maschio prima divisione meiotica globulo polare seconda divisione meiotica gametogenesi nella femmina e nel maschio

Dettagli

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1.

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Insieme delle caratteristiche contenute nei geni, sia quelle manifeste, sia

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

REGOLAZIONE DEL CICLO CELLULARE

REGOLAZIONE DEL CICLO CELLULARE REGOLAZIONE DEL CICLO CELLULARE Il sistema di controllo che regola la progressione del ciclo cellulare deve: 1) Garantire che tutti i processi associati con le diverse fasi siano portati a termine al tempo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

I MECCANISMI ALLA BASE DEL CROSSING OVER

I MECCANISMI ALLA BASE DEL CROSSING OVER I MECCANISMI ALLA BASE DEL CROSSING OVER I quattro prodotti della meiosi di un fungo rimangono racchiusi in un contenitore chiamato asco Vantaggi dei funghi nell analisi genetica Facilità è rapidità di

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it, unimi.it, wikipedia.it,

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Nucleo. Contiene il materiale genetico DNA associato a proteine

Nucleo. Contiene il materiale genetico DNA associato a proteine Nucleo Contiene il materiale genetico DNA associato a proteine I cromosomi Sono depositari del materiale genetico. Sono composti da una lunga molecola di DNA, che costituisce il materiale genetico,e da

Dettagli

La capacità di crescere è una caratteristica fondamentale degli esseri viventi

La capacità di crescere è una caratteristica fondamentale degli esseri viventi La capacità di crescere è una caratteristica fondamentale degli esseri viventi Negli organismi unicellulari, la divisione cellulare fa aumentare il numero totale degli individui di una popolazione Negli

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

Come si dividono le cellule: mitosi e meiosi

Come si dividono le cellule: mitosi e meiosi UNITÀ 4 Come si dividono le cellule: mitosi e meiosi Missione di soccorso nelle foreste pluviali La divisione cellulare è il processo fondamentale alla base della riproduzione degli organismi. lezione

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

La divisione cellulare e la riproduzione

La divisione cellulare e la riproduzione LEZIONE 1 La divisione cellulare e la riproduzione Perché in tutti gli organismi le cellule si dividono? Mentre studi l unità, metti a fuoco il lessico progressivo evidenziato nel testo L ameba è un organismo

Dettagli