GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali"

Transcript

1 GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei procarioti vi è un unico cromosoma Negli eucarioti vi sono due serie complete di cromosomi diversi tra di loro: il loro numero totale è indicato con il numero 2n La quantità totale di DNA presente in una cellula procariota o in una cellula gametica eucariota si indica con c c varia da pochi kb nei virus a milioni di kb in piante e animali non è detto che a una maggior complessità biologica corrisponda una maggior quantità di DNA (es. rane)

2 Solo una parte del DNA è codificante, cioè viene trascritto e tradotto in catene polipetidiche anche meno del 10% in alcuni vegetali Il DNA non codificante è costituito da: - sequenze introniche - sequenze di controllo della trascrizione - sequenze ripetute da poche basi ripetute fino a qualche milione di volte a sequenze più lunghe ripetute qualche migliaio di volte le ripetizioni possono essere contigue o distribuite nel genoma nel loro insieme costituiscono il DNA SATELLITE

3 CROMOSOMI Depositari fisici e visibili dell informazione genetica Complesso nucleoproteico cromatina PROCARIOTI EUCARIOTI Circolare, poche proteine, milioni di bp A bastone, molte proteine, miliardi di bp CROMATINA Costituita da DNA, proteine, tracce di RNA e ioni metallici Rapporto di 20 : : 1 Ca, Mg

4 PROTEINE CROMOSOMICHE 1. ISTONI proteine basiche basso p.m. (da a ) noti 5 diversi tipi (H1, H2A, H2B, H3, H4) simili in tutti gli organismi 2. PROTEINE ACIDE elevata eterogeneità, tra specie ma anche tra tessuti p.m. variabile (da a oltre )

5 DNA linker (video)

6

7 A B C D telocentrico acrocentrico sub-metacentrico metacentrico

8 CARIOTIPO Definizione numero e forma dei cromosomi di una cellula Caratteristico per ciascuna specie Esempi Mosca 12 Orzo 14 Cipolla 16 Carota 18 Pomodoro 24 Vite 38 Topo 40 Soia 40 Mirabils 58 Mucca 60 Cane 78 Uomo 46 I cromosomi sono presenti in coppie, detti OMOLOGHI Uno deriva dal genitore materno, l altro da quello paterno Cromosomi omologhi hanno dimensioni e forma uguali e portano l informazione genetica degli stessi caratteri (alleli)

9 IL CICLO CELLULARE 2c 4c 2c 2c 4c 4c c = contenuto DNA cellula aploide 2c = contenuto DNA cellula diploide

10 Cromatidi

11 Divisione cellulare I: la mitosi

12 PROFASE METAFASE ANAFASE TELOFASE (video)

13 Divisione cellulare II: la meiosi C = interfase A = prima divisione meiotica, D = profase I, E = metafase I, F = anafase I, G = telofase I B = seconda divisione meiotica, H = profase II, I = metafase II, J = anafase II, K = telofase II

14 (video)

15

16

17

18 (video)

19 (video) Replicazione DNA MITOSI In interfase, prima della duplicazione cellulare MEIOSI In interfase, prima della duplicazione cellulare Numero divisioni Una Due N. cellule figlie Due Quattro Numero cromosomi cellule figlie Caratteristiche cellule figlie 2n (diploide) Identiche fra loro e alla cellula di origine n (aploide) Tutte diverse e ricombinanti in vario modo caratteri materni e paterni Funzione Cellule somatiche Gameti sessuali

20 Caratteri ereditati solo dalla madre controllo a livello di citoplasma Il genitore maschile contribuisce solo con il nucleo

21 DNA MITOCONDRIALE Negli animali circa 20 kb Nei vegetali oltre kb Nessuna relazione tra dimensione dei mitocondri e contenuto in DNA Una o più molecole circolari Controllo su circa 20 prodotti di trascrizione, sia in piante che in animali alcuni con funzioni essenziali (respirazione) il mancato funzionamento è letale Controllo anche su ribosomi e RNA transfer Maschiosterilità nelle piante Eredità per via materna eccezioni: gimnosperme (via paterna o combinata)

22 DNA PLASTIDIALE Solo in specie dotate di plastidi Dimensioni di circa 200 kb nelle angiosperme Molecole circolari di dimensioni simili Controllo sulla sintesi di circa 25 proteine (implicate nella fotosintesi), oltre a ribosomi e RNA transfer I geni per l RNA ribosomale presenti in copie multiple

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini pallavic@units.it MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare

Dettagli

CICLO CELLULARE MITOSI MEIOSI

CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

LA MEIOSI E LA RIPRODUZIONE

LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

Cap. 12 La cellula. Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5

Cap. 12 La cellula. Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5 ( Cap. 12 La cellula 12.1 Le cellule Con l invenzione del microscopio l uomo ha potuto esplorare il ondo degli organismi molto piccoli il cui studio ha permesso di sviluppare la Teoria Cellulare. Questa

Dettagli

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

GENI, GENOMI E CROMOSOMI

GENI, GENOMI E CROMOSOMI www.fisiokinesiterapia.biz GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna

Dettagli

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà GENETICA... lessico Genetica: studio dei geni e dell'ereditarietà Geni: porzioni di DNA contenenti un'informazione che permette di decodificare una certa proteina. Es: gene che determina il colore dei

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

Prove associate al percorso UGUALI EPPUR DIVERSI

Prove associate al percorso UGUALI EPPUR DIVERSI Titolo: Prove associate al percorso UGUALI EPPUR DIVERSI Autore: Laura Cassata Percorsi didattici associati: A- Uguali eppur diversi AVVERTENZA: Le domande che seguono si ispirano al percorso o ai percorsi

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna Eredità mitocondriale Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna I mitocondri dello spermatozoo non entrano a far

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

TEST Lo Studente Ricercatore edizione 2011

TEST Lo Studente Ricercatore edizione 2011 TEST Lo Studente Ricercatore edizione 2011 1. A chi soffre di colesterolo elevato è sconsigliato mangiare i crostacei, che ne contengono una quantità elevata. Dovrà pertanto eliminare dal suo menù soprattutto

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed anche la maggiore dipendenza dalle proteine policomb per

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli